Mercurial > repos > peterjc > samtools_bam2fq
changeset 0:c961d16801e4 draft default tip
Uploaded v0.0.2
| author | peterjc |
|---|---|
| date | Tue, 04 Nov 2014 07:15:50 -0500 |
| parents | |
| children | |
| files | test-data/sam_spec_padded.bam test-data/sam_spec_padded.bam2fq.fastq test-data/sam_spec_padded.bam2fq_no_suf.fastq test-data/sam_spec_padded.bam2fq_pairs.fastq test-data/sam_spec_padded.bam2fq_singles.fastq test-data/sam_spec_padded.depad.bam test-data/sam_spec_padded.sam tools/samtools_bam2fq/README.rst tools/samtools_bam2fq/samtools_bam2fq.xml tools/samtools_bam2fq/tool_dependencies.xml |
| diffstat | 10 files changed, 293 insertions(+), 0 deletions(-) [+] |
line wrap: on
line diff
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/sam_spec_padded.bam2fq.fastq Tue Nov 04 07:15:50 2014 -0500 @@ -0,0 +1,12 @@ +>ref +AGCATGTTAGATAAGATAGCTGTGCTAGTAGGCAGTCAGCGCCAT +>r001/1 +TTAGATAAAGGATACTG +>r002 +AAAAGATAAGGATA +>r003 +AGCTAA +>r004 +ATAGCTTCAGC +>r001/2 +ATGCCGCTG
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/sam_spec_padded.bam2fq_no_suf.fastq Tue Nov 04 07:15:50 2014 -0500 @@ -0,0 +1,12 @@ +>ref +AGCATGTTAGATAAGATAGCTGTGCTAGTAGGCAGTCAGCGCCAT +>r001 +TTAGATAAAGGATACTG +>r002 +AAAAGATAAGGATA +>r003 +AGCTAA +>r004 +ATAGCTTCAGC +>r001 +ATGCCGCTG
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/sam_spec_padded.bam2fq_pairs.fastq Tue Nov 04 07:15:50 2014 -0500 @@ -0,0 +1,4 @@ +>r001/1 +TTAGATAAAGGATACTG +>r001/2 +ATGCCGCTG
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/sam_spec_padded.bam2fq_singles.fastq Tue Nov 04 07:15:50 2014 -0500 @@ -0,0 +1,8 @@ +>r002 +AAAAGATAAGGATA +>r003 +AGCTAA +>r004 +ATAGCTTCAGC +>ref +AGCATGTTAGATAAGATAGCTGTGCTAGTAGGCAGTCAGCGCCAT
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/sam_spec_padded.sam Tue Nov 04 07:15:50 2014 -0500 @@ -0,0 +1,10 @@ +@HD VN:1.5 SO:coordinate +@SQ SN:ref LN:47 +ref 516 ref 1 0 14M2D31M * 0 0 AGCATGTTAGATAAGATAGCTGTGCTAGTAGGCAGTCAGCGCCAT * +r001 99 ref 7 30 14M1D3M = 39 41 TTAGATAAAGGATACTG * +* 768 ref 8 30 1M * 0 0 * * CT:Z:.;Warning;Note=Ref wrong? +r002 0 ref 9 30 3S6M1D5M * 0 0 AAAAGATAAGGATA * PT:Z:1;4;+;homopolymer +r003 0 ref 9 30 5H6M * 0 0 AGCTAA * NM:i:1 +r004 0 ref 18 30 6M14D5M * 0 0 ATAGCTTCAGC * +r003 2064 ref 31 30 6H5M * 0 0 TAGGC * NM:i:0 +r001 147 ref 39 30 9M = 7 -41 CAGCGGCAT * NM:i:1
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/tools/samtools_bam2fq/README.rst Tue Nov 04 07:15:50 2014 -0500 @@ -0,0 +1,104 @@ +Galaxy wrapper for samtools bam2fq +==================================== + +This wrapper is copyright 2014 by Peter Cock, The James Hutton Institute +(formerly SCRI, Scottish Crop Research Institute), UK. All rights reserved. +See the licence text below. + +This is a wrapper for part of the command line samtools suite. + +This wrapper is available from the Galaxy Tool Shed at: +http://toolshed.g2.bx.psu.edu/view/peterjc/samtools_bam2fq + + +Automated Installation +====================== + +This should be straightforward, Galaxy should automatically download and install +samtools if required. + + +Manual Installation +=================== + +This expects samtools to be on the $PATH, and was tested using v0.1.19. + +To install the wrapper copy or move the following files under the Galaxy tools +folder, e.g. in a ``tools/samtools_bam2fq`` folder: + +* ``samtools_bam2fq.xml`` (the Galaxy tool definition) +* ``README.rst`` (this file) + +You will also need to modify the ``tools_conf.xml`` file to tell Galaxy to offer +the tool. Just add the line, perhaps under the NGS tools section:: + + <tool file="samtools_bam2fq/samtools_bam2fq.xml" /> + +If you wish to run the unit tests, also move/copy the ``test-data/`` files +under Galaxy's ``test-data/`` folder. Then:: + + $ ./run_tests.sh -id samtools_bam2fq + +That's it. + + +History +======= + +======= ====================================================================== +Version Changes +------- ---------------------------------------------------------------------- +v0.0.1 - Initial public release, tested with samtools v1.1. +v0.0.2 - Defaults to pair-aware mode which requires pre-sorting by read name. +======= ====================================================================== + + +Developers +========== + +Development is on this GitHub repository: +https://github.com/peterjc/pico_galaxy/tree/master/tools/samtools_bam2fq + +For making the "Galaxy Tool Shed" http://toolshed.g2.bx.psu.edu/ tarball use +the following command from the Galaxy root folder:: + + $ tar -czf samtools_bam2fq.tar.gz tools/samtools_bam2fq/README.rst tools/samtools_bam2fq/samtools_bam2fq.xml tools/samtools_bam2fq/tool_dependencies.xml test-data/sam_spec_padded.bam test-data/sam_spec_padded.sam test-data/sam_spec_padded.depad.bam test-data/sam_spec_padded.bam2fq.fastq test-data/sam_spec_padded.bam2fq_no_suf.fastq test-data/sam_spec_padded.bam2fq_singles.fastq test-data/sam_spec_padded.bam2fq_pairs.fastq + +Check this worked:: + + $ tar -tzf samtools_bam2fq.tar.gz + tools/samtools_bam2fq/README.rst + tools/samtools_bam2fq/samtools_bam2fq.xml + tools/samtools_bam2fq/tool_dependencies.xml + test-data/sam_spec_padded.bam + test-data/sam_spec_padded.sam + test-data/sam_spec_padded.depad.bam + test-data/sam_spec_padded.bam2fq.fastq + test-data/sam_spec_padded.bam2fq_no_suf.fastq + test-data/sam_spec_padded.bam2fq_singles.fastq + test-data/sam_spec_padded.bam2fq_pairs.fastq + + +Licence (MIT) +============= + +Permission is hereby granted, free of charge, to any person obtaining a copy +of this software and associated documentation files (the "Software"), to deal +in the Software without restriction, including without limitation the rights +to use, copy, modify, merge, publish, distribute, sublicense, and/or sell +copies of the Software, and to permit persons to whom the Software is +furnished to do so, subject to the following conditions: + +The above copyright notice and this permission notice shall be included in +all copies or substantial portions of the Software. + +THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR +IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, +FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE +AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER +LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, +OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN +THE SOFTWARE. + +NOTE: This is the licence for the Galaxy Wrapper only. +samtools is available and licenced separately.
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/tools/samtools_bam2fq/samtools_bam2fq.xml Tue Nov 04 07:15:50 2014 -0500 @@ -0,0 +1,137 @@ +<tool id="samtools_bam2fq" name="Convert BAM to FASTQ" version="0.0.2"> + <description>samtools bam2fq</description> + <requirements> + <requirement type="binary">samtools</requirement> + <requirement type="package" version="1.1">samtools</requirement> + </requirements> + <version_command>samtools 2>&1 | grep -i "Version:"</version_command> + <command> + #if $action_mode.mode == "pairs": + ## Sort by name for pair-aware output (should give nice interlaced FASTQ) + ## Galaxy has a tendancy to automatically apply co-ordindate sorting, + ## so just do this every time. If it was name sorted, pay an IO overhead. + ## Note requiring -T is samtools issue 295 + samtools sort -n -O bam -T TEMP_SORT "$input_bam" | samtools bam2fq -s "$singletons_fastq" - > "$pairs_fastq" + #else + ## Naive conversion using order in the input file + samtools bam2fq $suffices $orig_qual "$input_bam" > "$out_fastq" + #end if + </command> + <inputs> + <!-- Unlike samtools 0.1.x, samtools 1.1 will autodetect SAM vs BAM --> + <param name="input_bam" type="data" format="bam,sam" label="Input SAM/BAM file" /> + <param name="suffices" type="boolean" label="Add /1 and /2 suffices to paired reads?" + truevalue="" falsevalue="-n" checked="true" /> + <param name="orig_qual" type="boolean" label="Use original qualities (OQ tags) if present?" + truevalue="-O" falsevalue="" checked="false" /> + <!-- Using a condition here to allow different output files; default to paired mode --> + <conditional name="action_mode"> + <param name="mode" type="select" label="Mode of action"> + <option value="pairs" selected="true">Sort by name, then divide into paired and singletons (two FASTQ files)</option> + <option value="naive">No pre-sorting, all reads in a single FASTQ file</option> + </param> + </conditional> + </inputs> + <outputs> + <data name="pairs_fastq" format="fastqsanger" label="$input_bam.name (bam2fq pairs)"> + <filter>(action_mode['mode'] == 'pairs')</filter> + </data> + <data name="singletons_fastq" format="fastqsanger" label="$input_bam.name (bam2fq singletons)"> + <filter>(action_mode['mode'] == 'pairs')</filter> + </data> + <data name="out_fastq" format="fastqsanger" label="$input_bam.name (bam2fq)"> + <filter>(action_mode['mode'] == 'naive')</filter> + </data> + </outputs> + <stdio> + <!-- Assume anything other than zero is an error --> + <exit_code range="1:" /> + <exit_code range=":-1" /> + </stdio> + <tests> + <test> + <param name="input_bam" value="sam_spec_padded.bam" ftype="bam" /> + <param name="suffices" value="true" /> + <param name="orig_qual" value="false" /> + <param name="mode" value="naive" /> + <output name="out_fastq" file="sam_spec_padded.bam2fq.fastq" ftype="fastqsanger" /> + </test> + <test> + <param name="input_bam" value="sam_spec_padded.bam" ftype="bam" /> + <param name="suffices" value="true" /> + <param name="orig_qual" value="true" /> + <param name="mode" value="naive" /> + <output name="out_fastq" file="sam_spec_padded.bam2fq.fastq" ftype="fastqsanger" /> + </test> + <test> + <param name="input_bam" value="sam_spec_padded.sam" ftype="sam" /> + <param name="mode" value="naive" /> + <output name="out_fastq" file="sam_spec_padded.bam2fq.fastq" ftype="fastqsanger" /> + </test> + <test> + <param name="input_bam" value="sam_spec_padded.depad.bam" ftype="bam" /> + <param name="mode" value="naive" /> + <output name="out_fastq" file="sam_spec_padded.bam2fq.fastq" ftype="fastqsanger" /> + </test> + <test> + <param name="input_bam" value="sam_spec_padded.bam" ftype="bam" /> + <param name="suffices" value="false"/> + <param name="mode" value="naive" /> + <output name="out_fastq" file="sam_spec_padded.bam2fq_no_suf.fastq" ftype="fastqsanger" /> + </test> + <test> + <param name="input_bam" value="sam_spec_padded.bam" ftype="bam" /> + <param name="suffices" value="true" /> + <param name="orig_qual" value="false" /> + <param name="mode" value="pairs" /> + <output name="pairs_fastq" file="sam_spec_padded.bam2fq_pairs.fastq" ftype="fastqsanger" /> + <output name="singletons_fastq" file="sam_spec_padded.bam2fq_singles.fastq" ftype="fastqsanger" /> + </test> + <test> + <param name="input_bam" value="sam_spec_padded.sam" ftype="sam" /> + <param name="suffices" value="true" /> + <param name="orig_qual" value="false" /> + <param name="mode" value="pairs" /> + <output name="pairs_fastq" file="sam_spec_padded.bam2fq_pairs.fastq" ftype="fastqsanger" /> + <output name="singletons_fastq" file="sam_spec_padded.bam2fq_singles.fastq" ftype="fastqsanger" /> + </test> + </tests> + <help> +**What it does** + +This tool runs the ``samtools bam2fq`` command in the SAMtools toolkit. + +By default this will pre-sort your SAM/BAM file by read name and split your +reads into an interlaced FASTQ file for paired reads, and a separate FASTQ +file for singleton reads. A naive conversion is also offered which gives a +single FASTQ file with the reads ordered as in the input SAM/BAM file. + +It is quite common to wish to remap high-throughput sequencing data. If you +only have the mapped reads in SAM/BAM format, this tool can "unmap" them to +recover FASTQ format reads to input into an alternative mapping tool. + +BAM files can hold both aligned reads and unaligned reads, so another example +usage would be to filter your BAM file to get only the unaligned reads, and +turn those back in FASTQ using this tool ready for *de novo* assembly, or to +try mapping against another reference sequence. + + +**Citation** + +If you use this Galaxy tool in work leading to a scientific publication please +cite: + +Heng Li et al (2009). The Sequence Alignment/Map format and SAMtools. +Bioinformatics 25(16), 2078-9. +http://dx.doi.org/10.1093/bioinformatics/btp352 + +Peter J.A. Cock (2014), Galaxy wrapper for the samtools bam2fq command +http://toolshed.g2.bx.psu.edu/view/peterjc/samtools_bam2fq + +This wrapper is available to install into other Galaxy Instances via the Galaxy +Tool Shed at http://toolshed.g2.bx.psu.edu/view/peterjc/samtools_bam2fq + </help> + <citations> + <citation type="doi">10.1093/bioinformatics/btp352</citation> + </citations> +</tool>
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/tools/samtools_bam2fq/tool_dependencies.xml Tue Nov 04 07:15:50 2014 -0500 @@ -0,0 +1,6 @@ +<?xml version="1.0"?> +<tool_dependency> + <package name="samtools" version="1.1"> + <repository changeset_revision="43f2fbec5d52" name="package_samtools_1_1" owner="iuc" toolshed="https://toolshed.g2.bx.psu.edu" /> + </package> +</tool_dependency>