Mercurial > repos > petr-novak > repeat_annotation_pipeline3

view format_repeat_library.xml @ 2:7f1032da7a0a draft

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
Uploaded
author petr-novak
date Mon, 21 Feb 2022 10:35:13 +0000
parents ea6a3059a6af
children 5366d5ea04bc
line wrap: on
line source

<tool id="annotate_contigs" name="Format Repeat Library" version="0.1.0" python_template_version="3.5">
    <requirements>
        <requirement type="package" version="2.60.0">bioconductor-biostrings</requirement>
    </requirements>
    <command detect_errors="exit_code"><![CDATA[
        $__tool_directory__/annotate_contigs.R '$contigs' '$cluster_table' '$annotated_contigs'
    ]]></command>
    <inputs>
        <param type="data" name="contigs" format="fasta" label="Contigs - Library of Repeats from TAREAN/RepeatExplorer pipeline" />
        <param type="data" name="cluster_table" format="txt" label="CLUSTER_TABLE from RepeatExplorer pipeline" help="CLUSTER_TABLE which contain annotation of clusters from RepeatExplorer pipeline"/>
    </inputs>
    <outputs>
        <data name="annotated_contigs" format="fasta" label="Annotated Repeat Library based on ${contigs.hid} and ${cluster_table.hid}" />
    </outputs>
    <help><![CDATA[
    **What this tool does**

Contigs from RepeatExplorer archive are annotated based on the classification of repeats from cluster_table.

Preformated CLUSTER_TABLE can be extracted from RepeatExplorer archive and modified accordingly. By default, "Final_annotation" column is used to append annotation to contigs in repeat library (based on the cluster id).  If "Final_annotation" column is incomplete, "Automatic_annotation" column is used instead.

Example of tab delimited CLUSTER_TABLE::


     "Number_of_reads_in_clusters"	3886
     "Number_of_clusters"	822
     "Number_of_superclusters"	821
     "Number_of_singlets"	6114
     "Number_of_analyzed_reads"	10000
     
     "Cluster"	"Supercluster" "Size" "Size_adjusted"	"Automatic_annotation"	"TAREAN_annotation"	                     "Final_annotation"
     1          	1             	260   260            "All/repeat/satellite"	  "Putative satellites (low confidence)" ""
     2          	2             	157   157            "All/repeat/satellite"	  "Putative satellites (low confidence)" ""
     3          	4             	100   100            "All"                  	"Other"                               	 ""
     4          	5             	83   	83             "All"                  	"Other"                               	 ""
     5          	3             	77   	77             "All"                  	"Other"                               	 ""
     6          	3             	65   	65             "All"                  	"Other"                               	 ""
     7          	6             	61   	61             "All"                  	"Other"                               	 ""
     8          	7             	58   	58             "All"                  	"Other"                               	 ""
     9          	8             	53   	53             "All"                  	"Other"                                  ""
     10          	9             	53   	53             "All"                  	"Other"                               	 ""
     11          	10             	51   	51             "All"                  	"Other"                               	 ""
     12          	11             	45   	45             "All"                  	"Other"                               	 ""
     13          	12             	44   	44             "All"                  	"Other"                               	 ""
     14          	13             	44   	44             "All"                  	"Other"                               	 ""
     15          	14             	39   	39             "All"                  	"Other"                               	 ""
     16          	15             	37   	37             "All"                  	"Other"                               	 ""
     17          	16             	30   	30             "All/repeat/satellite"	"Putative satellites (low confidence)"	 ""
     18          	17             	28   	28             "All/repeat/satellite"	"Putative satellites (low confidence)"	 ""
     19          	18             	26   	26             "All/repeat/satellite"   "Putative satellites (high confidence)"	 ""
     20          	19             	23   	23             "All/repeat/../CRM"    	"Other"	                                 ""
     21          	20             	21   	21             "All"                  	"Other"	                                 ""
     22          	21             	21   	21             "All"                  	"Other"	                                 ""
     23          	22             	21   	21             "All"                  	"Other"	                                 ""
     24          	23             	21   	21             "All"                  	"Other"	                                 ""
     25          	24             	20   	20             "All/repeat/../Ogre" "Other"                                   	""


Only Cluster, Automatic_annotation/Final_annnotation are mandatory"

Clusters with higher number than those in CLUSTER_TABLE are removed from Repeat library

Contigs are provided in followinf format::


     >CL25Contig1
     AGATCAAGATGGCGCCGGAGGACATGGAGAAAACGACGTTTATCACTCCCTGGGGAACATTTTGCTACAAGGTAATGCCT
     TTCGGTCTGAAGAACGCAGGGGCCACTTACCAACGAGCAATGGTAACTT
     >CL1Contig4#All/repeat/satellite
     ACCCGAAGGCCGGCTCAACCCGAAGTTGAGAAGAACATCTGACCTCGCCGTCAGGCATCTGTTAAACAAACAGGCATCGA
     A
     >CL1Contig5
     TGAGAAGAACATCTGACCTCGCCGTCAGGCATCTGTTAAACAAACAGGCATCGAACCCGAAGGCCGGCTCAACCCGAAGT
     TGATAAGAACATCTGACCTCGCCGTCAGGCATCTGTTAAACAAACAGGCATCGAACCCGAAGGCCGGCTCAACACGAAGT
     TGAGAGGAACATCTGACCTCGCCGTCAGGCATCTGTTAAA


Resulting repeat library will have following format::

     >CL25Contig1#All/repeat/mobile_element/Class_I/LTR/Ty3_gypsy/non-chromovirus/OTA/Tat/Ogre
     AGATCAAGATGGCGCCGGAGGACATGGAGAAAACGACGTTTATCACTCCCTGGGGAACATTTTGCTACAAGGTAATGCCT
     TTCGGTCTGAAGAACGCAGGGGCCACTTACCAACGAGCAATGGTAACTT
     >CL1Contig4#All/repeat/satellite
     ACCCGAAGGCCGGCTCAACCCGAAGTTGAGAAGAACATCTGACCTCGCCGTCAGGCATCTGTTAAACAAACAGGCATCGA
     A
     >CL1Contig5#All/repeat/satellite
     TGAGAAGAACATCTGACCTCGCCGTCAGGCATCTGTTAAACAAACAGGCATCGAACCCGAAGGCCGGCTCAACCCGAAGT
     TGATAAGAACATCTGACCTCGCCGTCAGGCATCTGTTAAACAAACAGGCATCGAACCCGAAGGCCGGCTCAACACGAAGT
     TGAGAGGAACATCTGACCTCGCCGTCAGGCATCTGTTAAA
     



    ]]></help>
</tool>