Mercurial > repos > petr-novak > repeatexplorer2

comparison repex_tarean.xml @ 0:15b422443267 draft

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
Uploaded
author petr-novak
date Wed, 08 Jan 2020 06:44:56 -0500
parents
children 2f52966cbaf1
comparison
equal deleted inserted replaced
-1:000000000000 0:15b422443267
1 <tool id="tarean" name="Tandem Repeat Analyzer" version="2.3.7" >
2 <stdio>
3 <regex match="Traceback" source="stderr" level="fatal" description="Unknown error" />
4 <regex match="error" source="stderr" level="fatal" description="Unknown error" />
5 <regex match="warning" source="stderr" level="warning" description="Unknown warning" />
6 <exit_code range="1:" level="fatal" description="Error" />
7 </stdio>
8 <description>Identification of genomic tandem repeats from NGS data</description>
9 <requirements>
10 <requirement type="package">imagemagick</requirement>
11 <requirement type="package">mafft</requirement>
12 <requirement type="package">blast</requirement>
13 <requirement type="package">diamond</requirement>
14 <requirement type="package">blast-legacy</requirement>
15 <requirement type="package">r-igraph</requirement>
16 <requirement type="package">r-data.tree</requirement>
17 <requirement type="package">r-stringr</requirement>
18 <requirement type="package">r-r2html</requirement>
19 <requirement type="package">r-hwriter</requirement>
20 <requirement type="package">r-dt</requirement>
21 <requirement type="package">r-scales</requirement>
22 <requirement type="package">r-plotrix</requirement>
23 <requirement type="package">r-png</requirement>
24 <requirement type="package">r-plyr</requirement>
25 <requirement type="package">r-dplyr</requirement>
26 <requirement type="package">r-optparse</requirement>
27 <requirement type="package">r-dbi</requirement>
28 <requirement type="package">r-rsqlite</requirement>
29 <requirement type="package">r-rserve</requirement>
30 <requirement type="package">bioconductor-biostrings</requirement>
31 <requirement type="package" version="2.3.7">repex_tarean</requirement>
32 <requirement type="set_environment">REPEX</requirement>
33 <requirement type="set_environment">REPEX_VERSION</requirement>
34 <requirement type="package" version="0.9.1">pyrserve</requirement>
35 </requirements>
36 <command detect_errors="exit_code">
37 export PYTHONHASHSEED=0;
38 \${REPEX}/seqclust --paired --sample ${sample} --output_dir=tarean_output --logfile=${log} --cleanup --tarean_mode
39 #if $advanced_options.advanced:
40 --mincl $advanced_options.size_threshold $advanced_options.keep_names $advanced_options.automatic_filtering -M $advanced_options.merging
41 #if $advanced_options.custom_library.options_custom_library :
42 -d $advanced_options.custom_library.library extra_database
43 #end if
44 #if $advanced_options.options.options:
45 -opt $advanced_options.options.options
46 #end if
47 #else:
48 -M 0.2
49
50 #end if
51 ${FastaFile} >stdout.log 2> stderr.log ;
52 echo "STDOUT CONTENT:" >> ${log} ;
53 cat stdout.log >> ${log} ;
54 echo "STDERR CONTENT:" >> ${log} ;
55 cat stderr.log >> ${log} &amp;&amp;
56 \${REPEX}/stderr_filter.py stderr.log &amp;&amp;
57 cd tarean_output &amp;&amp;
58 zip -r ${ReportArchive}.zip * &amp;&amp;
59 mv ${ReportArchive}.zip ${ReportArchive} &amp;&amp;
60 cp index.html ${ReportFile} &amp;&amp;
61 mkdir ${ReportFile.files_path} &amp;&amp;
62 cp -r --parents libdir ${ReportFile.files_path} &amp;&amp;
63 cp -r --parents seqclust/clustering/superclusters ${ReportFile.files_path} &amp;&amp;
64 cp -r --parents seqclust/clustering/clusters ${ReportFile.files_path} &amp;&amp;
65 cp seqclust/clustering/hitsort.cls ${ReportFile.files_path}/seqclust/clustering/hitsort.cls &amp;&amp;
66 cp *.png ${ReportFile.files_path}/ &amp;&amp;
67 cp *.csv ${ReportFile.files_path}/ &amp;&amp;
68 cp *.html ${ReportFile.files_path}/ &amp;&amp;
69 cp *.css ${ReportFile.files_path}/ &amp;&amp;
70 cp *.fasta ${ReportFile.files_path}/ 2>>$log &amp;&amp; rm -r ../tarean_output || :
71
72
73 </command>
74
75 <inputs>
76 <param name="FastaFile" label="paired-end NGS reads" type="data" format="fasta"
77 help="Input file must contain fasta-formatted interlaced read pairs from paired-end sequencing. All pairs must be complete. Example of input data format is provided in the help below."/>
78 <param name="sample" label="Sample size" type="integer" value="500000" min="10000"/>
79
80 <conditional name="advanced_options">
81 <param name="advanced" type="boolean" truevalue="true" falsevalue="false" checked="False" label="Advanced options" />
82 <when value="false">
83 <!-- pass -->
84 </when>
85 <when value="true">
86 <param name="merging" type="boolean" truevalue="0.2" falsevalue="0" checked="True" label="Perform cluster merging" help="By default, clusters connected through paired-end reads are merged"/>
87 <conditional name="custom_library">
88 <param name="options_custom_library" type="boolean" truevalue="true" falsevalue="false" checked="False" label="Use custom repeat database"/>
89 <when value="false">
90 <!-- do nothing here -->
91 </when>
92 <when value="true">
93 <param name="library" format="fasta" type="data" label="Use custom repeat database" help="Perform additional similarity search to user-provided repeat database. The database should contain FASTA-formatted DNA sequences with headers (sequence names) in the format: '>reapeatname#class/subclass'"/>
94 </when>
95 </conditional>
96 <param name="size_threshold" label="Cluster size threshold for detailed analysis" type="float" value="0.01" min="0.0001" max="100" help ="Minimal size (as percentage of input reads) of the smallest cluster which is analyzed, cluster with less than 20 reads are not considered at all."/>
97 <param name="automatic_filtering" label="Perform automatic filtering of abundant satellite repeats" type="boolean" truevalue="--automatic_filtering" falsevalue="" checked="false"/>
98 <param name="keep_names" label="Keep original sequences names" type="boolean" truevalue="--keep_names" falsevalue="" checked="false" help="By default sequence are relabeled using integers. If you want to keep original names, use this option."/>
99 <conditional name="options">
100 <param name="options" type="select" label="Similarity search options" help="Different similarity search parameters are used depending on the used input data to adjust search to differences in length and error rate">
101 <option value="ILLUMINA" selected="true">Illumina reads, read length 100nt or more </option>
102 <option value="ILLUMINA_SHORT" selected="false">Illumina reads, shorter than 100nt (Do not use reads shorter than 50nt!) </option>
103 <option value="ILLUMINA_DUST_OFF" selected="false">Illumina reads, no masking of low complexity repeats </option>
104 </param>
105 </conditional>
106 </when>
107 </conditional>
108
109
110
111 </inputs>
112 <outputs>
113 <data name="log" format="txt" label="TAREAN log file"/>
114 <data name="ReportArchive" format="zip" label="TAREAN Archive with HTML report from data ${FastaFile.hid}"/>
115 <data name="ReportFile" format="html" label="TAREAN HTML report from data ${FastaFile.hid}"/>
116 </outputs>
117
118 <help>
119 **HELP**
120
121 TAREAN - TAndem REpeat ANalyzer is a computational pipeline for
122 **unsupervised identification of satellite repeats** from unassembled
123 sequence reads. The pipeline uses low-pass paired-end whole genome
124 sequence reads and performs graph-based clustering. The resulting
125 clusters, representing all types of repeats present in the genome, are
126 then examined to identify those containing circular structures indicative
127 of tandem repeats. A poster summarizing TAREAN principles and
128 implementation can be found `here.`__
129
130
131 .. __: http://w3lamc.umbr.cas.cz/lamc/?page_id=312
132
133 **Input data**
134
135
136 The analysis requires **paired-end reads** generated by whole genome
137 shotgun sequencing. The data should be provided as a single input file in
138 fasta format with the reads interlaced (see example below). All the pairs
139 must be complete, i.e. both "forward" and "reverse" sequence reads must be
140 present. The reads should all be trimmed to the same length. The optimal
141 size range is between 100 and 200 nucleotides. The number of reads to be
142 analyzed should not exceed 1x coverage of the genome. Genome coverage
143 between 0.01 and 0.5x is recommended. The reads should be filtered for
144 quality. The recommended quality filtering is as follows: each read should
145 have a quality score >=10 for 95% of the bases, i.e. if your reads are 100
146 base pairs long, then a read only passes this quality threshold if 95
147 bases have a quality of 10 or higher. Additionally, any reads containing
148 indeterminate base pairs (indicated as N in the reads) should be removed.
149 Finally, if either one of the reads in a pair fails to meet the
150 aforementioned thresholds, **both** sequences should be removed.
151 example of interlaced input format::
152
153 >0001_f
154 CGTAATATACATACTTGCTAGCTAGTTGGATGCATCCAACTTGCAAGCTAGTTTGATG
155 >0001_r
156 GATTTGACGGACACACTAACTAGCTAGTTGCATCTAAGCGGGCACACTAACTAACTAT
157 >0002_f
158 ACTCATTTGGACTTAACTTTGATAATAAAAACTTAAAAAGGTTTCTGCACATGAATCG
159 >0002_r
160 TATGTTGAAAAATTGAATTTCGGGACGAAACAGCGTCTATCGTCACGACATAGTGCTC
161 >0003_f
162 TGACATTTGTGAACGTTAATGTTCAACAAATCTTTCCAATGTCTTTTTATCTTATCAT
163 >0003_r
164 TATTGAAATACTGGACACAAATTGGAAATGAAACCTTGTGAGTTATTCAATTTATGTT
165 ...
166
167
168 To perform the quality filtering on your fastQ formatted data as described
169 above, and to interlace your paired-end sequence reads,
170 please use the `Preprocessing of paired-reads`__ tool.
171
172 .. __: tool_runner?tool_id=paired_fastq_filtering
173
174
175 **Additional parameters**
176
177 **Sample size** defines how many reads will be used during the computation.
178 The default setting of 500,000 reads will enable detection of high copy
179 number satellites within several hours. For higher
180 sensitivity the sample size can be increased. Since the sample size affects
181 memory usage, this parameter may be automatically adjusted to a lower value
182 during the run. The maximum sample size which can be processed depends on the
183 repetitiveness of the analyzed genome. This significantly limits the number of reads
184 that can be analyzed with the TAREAN pipeline.
185
186 **Perform cluster merging**. Families of repetitive elements are
187 frequently split into multiple clusters rather than being represented as a
188 single one. If you do not want to merge clusters based on the presence
189 of broken read pairs, disable this option.
190
191 **Use custom repeat database**. This option allows users to perform similarity
192 comparison of identified repeats to their custom databases. The repeat class should
193 be encoded in FASTA headers of database entries in order to allow correct
194 parsing of similarity hits.
195
196 **Similarity search options** By default sequence reads are compared using
197 mgblast program. Default threshold is explicitly set to 90% sequence
198 similarity spanning at least 55% of the read length (in the case of reads
199 differing in length it applies to the longer one). Additionally, sequence
200 overlap must be at least 55 nt. If you select option for shorter reads
201 than 100 nt, minimum overlap 55 nt is not required.
202
203 By default,
204 mgblast search use DUST program to filter out
205 low-complexity sequences. If you want
206 to increase sensitivity of detection of satellites with shorter monomer
207 use option with '*no masking of low complexity repeats*'. Note that omitting
208 DUST filtering will significantly increase running times
209
210 **Output**
211
212 A list of clusters identified as putative satellite repeats, their genomic
213 abundance and various cluster characteristics are provided. Length and
214 consensus sequences of reconstructed monomers are also shown and
215 accompanied by a detailed output from kmer-based reconstruction including
216 sequences and sequence logos of alternative variants of monomer sequences.
217
218 The output includes an **HTML summary** with a table listing all analyzed
219 clusters. More detailed information about clusters is provided in
220 additional files and directories. All results are also provided as a
221 downloadable **zip archive**. Since read clustering results in
222 thousands of clusters, the search for satellite repeats is limited to
223 a subset of the largest ones corresponding to the most abundant genomic
224 repeats. The default setting of the pipeline is to analyze all clusters containing at least
225 0.01% of the input reads. Besides the satellite repeats, three other
226 groups of clusters are reported in the output (1) LTR-retrotransposons,
227 (2) 45S and 5S rDNA and (3) all remaining clusters passing the size
228 threshold. As (1) and (2) contain sequences with circular
229 graphs, their consensus is calculated in the same way as for satellite
230 repeats. Additionally a **log file** reporting the progress of the
231 computational pipeline is provided.
232
233
234 </help>
235
236 </tool>