|
0
|
1 <tool id="tarean" name="Tandem Repeat Analyzer" >
|
|
|
2 <stdio>
|
|
|
3 <regex match="Traceback" source="stderr" level="fatal" description="Unknown error" />
|
|
|
4 <regex match="error" source="stderr" level="fatal" description="Unknown error" />
|
|
|
5 <regex match="warning" source="stderr" level="warning" description="Unknown warning" />
|
|
|
6 <exit_code range="1:" level="fatal" description="Error" />
|
|
|
7 </stdio>
|
|
|
8 <description>Identification of genomic tandem repeats from NGS data</description>
|
|
|
9 <requirements>
|
|
|
10 <requirement type="package" version="3.7">python</requirement>
|
|
|
11 <requirement type="package" version="0.9.1" >pyrserve</requirement>
|
|
|
12 <requirement type="package">mafft</requirement>
|
|
|
13 <requirement type="package">imagemagick</requirement>
|
|
|
14 <requirement type="package">blast</requirement>
|
|
|
15 <requirement type="package">diamond</requirement>
|
|
|
16 <requirement type="package">blast-legacy</requirement>
|
|
|
17 <requirement type="package">r-igraph</requirement>
|
|
|
18 <requirement type="package">r-data.tree</requirement>
|
|
|
19 <requirement type="package">r-stringr</requirement>
|
|
|
20 <requirement type="package">r-r2html</requirement>
|
|
|
21 <requirement type="package">r-hwriter</requirement>
|
|
|
22 <requirement type="package">r-dt</requirement>
|
|
|
23 <requirement type="package">r-scales</requirement>
|
|
|
24 <requirement type="package">r-plotrix</requirement>
|
|
|
25 <requirement type="package">r-png</requirement>
|
|
|
26 <requirement type="package">r-plyr</requirement>
|
|
|
27 <requirement type="package">r-dplyr</requirement>
|
|
|
28 <requirement type="package">r-optparse</requirement>
|
|
|
29 <requirement type="package">r-dbi</requirement>
|
|
|
30 <requirement type="package">r-rsqlite</requirement>
|
|
|
31 <requirement type="package">r-rserve</requirement>
|
|
|
32 <requirement type="package">bioconductor-biostrings</requirement>
|
|
|
33 </requirements>
|
|
|
34
|
|
|
35 <command detect_errors="exit_code">
|
|
|
36 export PYTHONHASHSEED=0;
|
|
|
37 ${__tool_directory__}/seqclust --paired --sample ${sample} --output_dir=tarean_output --logfile=${log} --cleanup --tarean_mode
|
|
|
38 #if $advanced_options.advanced:
|
|
|
39 --mincl $advanced_options.size_threshold $advanced_options.keep_names $advanced_options.automatic_filtering -M $advanced_options.merging
|
|
|
40 #if $advanced_options.custom_library.options_custom_library :
|
|
|
41 -d $advanced_options.custom_library.library extra_database
|
|
|
42 #end if
|
|
|
43 #if $advanced_options.options.options:
|
|
|
44 -opt $advanced_options.options.options
|
|
|
45 #end if
|
|
|
46 #else:
|
|
|
47 -M 0.2
|
|
|
48
|
|
|
49 #end if
|
|
|
50 ${FastaFile} >stdout.log 2> stderr.log ;
|
|
|
51 echo "STDOUT CONTENT:" >> ${log} ;
|
|
|
52 cat stdout.log >> ${log} ;
|
|
|
53 echo "STDERR CONTENT:" >> ${log} ;
|
|
|
54 cat stderr.log >> ${log} &&
|
|
|
55 ${__tool_directory__}/stderr_filter.py stderr.log &&
|
|
|
56 cd tarean_output &&
|
|
|
57 zip -r ${ReportArchive}.zip * &&
|
|
|
58 mv ${ReportArchive}.zip ${ReportArchive} &&
|
|
|
59 cp index.html ${ReportFile} &&
|
|
|
60 mkdir ${ReportFile.files_path} &&
|
|
|
61 cp -r --parents libdir ${ReportFile.files_path} &&
|
|
|
62 cp -r --parents seqclust/clustering/superclusters ${ReportFile.files_path} &&
|
|
|
63 cp -r --parents seqclust/clustering/clusters ${ReportFile.files_path} &&
|
|
|
64 cp seqclust/clustering/hitsort.cls ${ReportFile.files_path}/seqclust/clustering/hitsort.cls &&
|
|
|
65 cp *.png ${ReportFile.files_path}/ &&
|
|
|
66 cp *.csv ${ReportFile.files_path}/ &&
|
|
|
67 cp *.html ${ReportFile.files_path}/ &&
|
|
|
68 cp *.css ${ReportFile.files_path}/ &&
|
|
|
69 cp *.fasta ${ReportFile.files_path}/ 2>>$log && rm -r ../tarean_output || :
|
|
|
70
|
|
|
71
|
|
|
72 </command>
|
|
|
73
|
|
|
74 <inputs>
|
|
|
75 <param name="FastaFile" label="paired-end NGS reads" type="data" format="fasta"
|
|
|
76 help="Input file must contain fasta-formatted interlaced read pairs from paired-end sequencing. All pairs must be complete. Example of input data format is provided in the help below."/>
|
|
|
77 <param name="sample" label="Sample size" type="integer" value="500000" min="10000"/>
|
|
|
78
|
|
|
79 <conditional name="advanced_options">
|
|
|
80 <param name="advanced" type="boolean" truevalue="true" falsevalue="false" checked="False" label="Advanced options" />
|
|
|
81 <when value="false">
|
|
|
82 <!-- pass -->
|
|
|
83 </when>
|
|
|
84 <when value="true">
|
|
|
85 <param name="merging" type="boolean" truevalue="0.2" falsevalue="0" checked="True" label="Perform cluster merging" help="By default, clusters connected through paired-end reads are merged"/>
|
|
|
86 <conditional name="custom_library">
|
|
|
87 <param name="options_custom_library" type="boolean" truevalue="true" falsevalue="false" checked="False" label="Use custom repeat database"/>
|
|
|
88 <when value="false">
|
|
|
89 <!-- do nothing here -->
|
|
|
90 </when>
|
|
|
91 <when value="true">
|
|
|
92 <param name="library" format="fasta" type="data" label="Use custom repeat database" help="Perform additional similarity search to user-provided repeat database. The database should contain FASTA-formatted DNA sequences with headers (sequence names) in the format: '>reapeatname#class/subclass'"/>
|
|
|
93 </when>
|
|
|
94 </conditional>
|
|
|
95 <param name="size_threshold" label="Cluster size threshold for detailed analysis" type="float" value="0.01" min="0.0001" max="100" help ="Minimal size (as percentage of input reads) of the smallest cluster which is analyzed, cluster with less than 20 reads are not considered at all."/>
|
|
|
96 <param name="automatic_filtering" label="Perform automatic filtering of abundant satellite repeats" type="boolean" truevalue="--automatic_filtering" falsevalue="" checked="false"/>
|
|
|
97 <param name="keep_names" label="Keep original sequences names" type="boolean" truevalue="--keep_names" falsevalue="" checked="false" help="By default sequence are relabeled using integers. If you want to keep original names, use this option."/>
|
|
|
98 <conditional name="options">
|
|
|
99 <param name="options" type="select" label="Similarity search options" help="Different similarity search parameters are used depending on the used input data to adjust search to differences in length and error rate">
|
|
|
100 <option value="ILLUMINA" selected="true">Illumina reads, read length 100nt or more </option>
|
|
|
101 <option value="ILLUMINA_SHORT" selected="false">Illumina reads, shorter than 100nt (Do not use reads shorter than 50nt!) </option>
|
|
|
102 <option value="ILLUMINA_DUST_OFF" selected="false">Illumina reads, no masking of low complexity repeats </option>
|
|
|
103 </param>
|
|
|
104 </conditional>
|
|
|
105 </when>
|
|
|
106 </conditional>
|
|
|
107
|
|
|
108 </inputs>
|
|
|
109 <outputs>
|
|
|
110 <data name="log" format="txt" label="TAREAN log file"/>
|
|
|
111 <data name="ReportArchive" format="zip" label="TAREAN Archive with HTML report from data ${FastaFile.hid}"/>
|
|
|
112 <data name="ReportFile" format="html" label="TAREAN HTML report from data ${FastaFile.hid}"/>
|
|
|
113 </outputs>
|
|
|
114
|
|
|
115 <help>
|
|
|
116 **HELP**
|
|
|
117
|
|
|
118 TAREAN - TAndem REpeat ANalyzer is a computational pipeline for
|
|
|
119 **unsupervised identification of satellite repeats** from unassembled
|
|
|
120 sequence reads. The pipeline uses low-pass paired-end whole genome
|
|
|
121 sequence reads and performs graph-based clustering. The resulting
|
|
|
122 clusters, representing all types of repeats present in the genome, are
|
|
|
123 then examined to identify those containing circular structures indicative
|
|
|
124 of tandem repeats. A poster summarizing TAREAN principles and
|
|
|
125 implementation can be found `here.`__
|
|
|
126
|
|
|
127
|
|
|
128 .. __: http://w3lamc.umbr.cas.cz/lamc/?page_id=312
|
|
|
129
|
|
|
130 **Input data**
|
|
|
131
|
|
|
132
|
|
|
133 The analysis requires **paired-end reads** generated by whole genome
|
|
|
134 shotgun sequencing. The data should be provided as a single input file in
|
|
|
135 fasta format with the reads interlaced (see example below). All the pairs
|
|
|
136 must be complete, i.e. both "forward" and "reverse" sequence reads must be
|
|
|
137 present. The reads should all be trimmed to the same length. The optimal
|
|
|
138 size range is between 100 and 200 nucleotides. The number of reads to be
|
|
|
139 analyzed should not exceed 1x coverage of the genome. Genome coverage
|
|
|
140 between 0.01 and 0.5x is recommended. The reads should be filtered for
|
|
|
141 quality. The recommended quality filtering is as follows: each read should
|
|
|
142 have a quality score >=10 for 95% of the bases, i.e. if your reads are 100
|
|
|
143 base pairs long, then a read only passes this quality threshold if 95
|
|
|
144 bases have a quality of 10 or higher. Additionally, any reads containing
|
|
|
145 indeterminate base pairs (indicated as N in the reads) should be removed.
|
|
|
146 Finally, if either one of the reads in a pair fails to meet the
|
|
|
147 aforementioned thresholds, **both** sequences should be removed.
|
|
|
148 example of interlaced input format::
|
|
|
149
|
|
|
150 >0001_f
|
|
|
151 CGTAATATACATACTTGCTAGCTAGTTGGATGCATCCAACTTGCAAGCTAGTTTGATG
|
|
|
152 >0001_r
|
|
|
153 GATTTGACGGACACACTAACTAGCTAGTTGCATCTAAGCGGGCACACTAACTAACTAT
|
|
|
154 >0002_f
|
|
|
155 ACTCATTTGGACTTAACTTTGATAATAAAAACTTAAAAAGGTTTCTGCACATGAATCG
|
|
|
156 >0002_r
|
|
|
157 TATGTTGAAAAATTGAATTTCGGGACGAAACAGCGTCTATCGTCACGACATAGTGCTC
|
|
|
158 >0003_f
|
|
|
159 TGACATTTGTGAACGTTAATGTTCAACAAATCTTTCCAATGTCTTTTTATCTTATCAT
|
|
|
160 >0003_r
|
|
|
161 TATTGAAATACTGGACACAAATTGGAAATGAAACCTTGTGAGTTATTCAATTTATGTT
|
|
|
162 ...
|
|
|
163
|
|
|
164
|
|
|
165 To perform the quality filtering on your fastQ formatted data as described
|
|
|
166 above, and to interlace your paired-end sequence reads,
|
|
|
167 please use the `Preprocessing of paired-reads`__ tool.
|
|
|
168
|
|
|
169 .. __: tool_runner?tool_id=paired_fastq_filtering
|
|
|
170
|
|
|
171
|
|
|
172 **Additional parameters**
|
|
|
173
|
|
|
174 **Sample size** defines how many reads will be used during the computation.
|
|
|
175 The default setting of 500,000 reads will enable detection of high copy
|
|
|
176 number satellites within several hours. For higher
|
|
|
177 sensitivity the sample size can be increased. Since the sample size affects
|
|
|
178 memory usage, this parameter may be automatically adjusted to a lower value
|
|
|
179 during the run. The maximum sample size which can be processed depends on the
|
|
|
180 repetitiveness of the analyzed genome. This significantly limits the number of reads
|
|
|
181 that can be analyzed with the TAREAN pipeline.
|
|
|
182
|
|
|
183 **Perform cluster merging**. Families of repetitive elements are
|
|
|
184 frequently split into multiple clusters rather than being represented as a
|
|
|
185 single one. If you do not want to merge clusters based on the presence
|
|
|
186 of broken read pairs, disable this option.
|
|
|
187
|
|
|
188 **Use custom repeat database**. This option allows users to perform similarity
|
|
|
189 comparison of identified repeats to their custom databases. The repeat class should
|
|
|
190 be encoded in FASTA headers of database entries in order to allow correct
|
|
|
191 parsing of similarity hits.
|
|
|
192
|
|
|
193 **Similarity search options** By default sequence reads are compared using
|
|
|
194 mgblast program. Default threshold is explicitly set to 90% sequence
|
|
|
195 similarity spanning at least 55% of the read length (in the case of reads
|
|
|
196 differing in length it applies to the longer one). Additionally, sequence
|
|
|
197 overlap must be at least 55 nt. If you select option for shorter reads
|
|
|
198 than 100 nt, minimum overlap 55 nt is not required.
|
|
|
199
|
|
|
200 By default,
|
|
|
201 mgblast search use DUST program to filter out
|
|
|
202 low-complexity sequences. If you want
|
|
|
203 to increase sensitivity of detection of satellites with shorter monomer
|
|
|
204 use option with '*no masking of low complexity repeats*'. Note that omitting
|
|
|
205 DUST filtering will significantly increase running times
|
|
|
206
|
|
|
207 **Output**
|
|
|
208
|
|
|
209 A list of clusters identified as putative satellite repeats, their genomic
|
|
|
210 abundance and various cluster characteristics are provided. Length and
|
|
|
211 consensus sequences of reconstructed monomers are also shown and
|
|
|
212 accompanied by a detailed output from kmer-based reconstruction including
|
|
|
213 sequences and sequence logos of alternative variants of monomer sequences.
|
|
|
214
|
|
|
215 The output includes an **HTML summary** with a table listing all analyzed
|
|
|
216 clusters. More detailed information about clusters is provided in
|
|
|
217 additional files and directories. All results are also provided as a
|
|
|
218 downloadable **zip archive**. Since read clustering results in
|
|
|
219 thousands of clusters, the search for satellite repeats is limited to
|
|
|
220 a subset of the largest ones corresponding to the most abundant genomic
|
|
|
221 repeats. The default setting of the pipeline is to analyze all clusters containing at least
|
|
|
222 0.01% of the input reads. Besides the satellite repeats, three other
|
|
|
223 groups of clusters are reported in the output (1) LTR-retrotransposons,
|
|
|
224 (2) 45S and 5S rDNA and (3) all remaining clusters passing the size
|
|
|
225 threshold. As (1) and (2) contain sequences with circular
|
|
|
226 graphs, their consensus is calculated in the same way as for satellite
|
|
|
227 repeats. Additionally a **log file** reporting the progress of the
|
|
|
228 computational pipeline is provided.
|
|
|
229
|
|
|
230
|
|
|
231 </help>
|
|
|
232
|
|
|
233 </tool>
|
