Mercurial > repos > petr-novak > repeatrxplorer

comparison repex_tarean.xml @ 0:1d1b9e1b2e2f draft

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
Uploaded
author petr-novak
date Thu, 19 Dec 2019 10:24:45 -0500
parents
children c0ae68651c11
comparison
equal deleted inserted replaced
-1:000000000000 0:1d1b9e1b2e2f
1 <tool id="tarean" name="Tandem Repeat Analyzer" >
2 <stdio>
3 <regex match="Traceback" source="stderr" level="fatal" description="Unknown error" />
4 <regex match="error" source="stderr" level="fatal" description="Unknown error" />
5 <regex match="warning" source="stderr" level="warning" description="Unknown warning" />
6 <exit_code range="1:" level="fatal" description="Error" />
7 </stdio>
8 <description>Identification of genomic tandem repeats from NGS data</description>
9 <requirements>
10 <requirement type="package" version="3.7">python</requirement>
11 <requirement type="package" version="0.9.1" >pyrserve</requirement>
12 <requirement type="package">mafft</requirement>
13 <requirement type="package">imagemagick</requirement>
14 <requirement type="package">blast</requirement>
15 <requirement type="package">diamond</requirement>
16 <requirement type="package">blast-legacy</requirement>
17 <requirement type="package">r-igraph</requirement>
18 <requirement type="package">r-data.tree</requirement>
19 <requirement type="package">r-stringr</requirement>
20 <requirement type="package">r-r2html</requirement>
21 <requirement type="package">r-hwriter</requirement>
22 <requirement type="package">r-dt</requirement>
23 <requirement type="package">r-scales</requirement>
24 <requirement type="package">r-plotrix</requirement>
25 <requirement type="package">r-png</requirement>
26 <requirement type="package">r-plyr</requirement>
27 <requirement type="package">r-dplyr</requirement>
28 <requirement type="package">r-optparse</requirement>
29 <requirement type="package">r-dbi</requirement>
30 <requirement type="package">r-rsqlite</requirement>
31 <requirement type="package">r-rserve</requirement>
32 <requirement type="package">bioconductor-biostrings</requirement>
33 </requirements>
34
35 <command detect_errors="exit_code">
36 export PYTHONHASHSEED=0;
37 ${__tool_directory__}/seqclust --paired --sample ${sample} --output_dir=tarean_output --logfile=${log} --cleanup --tarean_mode
38 #if $advanced_options.advanced:
39 --mincl $advanced_options.size_threshold $advanced_options.keep_names $advanced_options.automatic_filtering -M $advanced_options.merging
40 #if $advanced_options.custom_library.options_custom_library :
41 -d $advanced_options.custom_library.library extra_database
42 #end if
43 #if $advanced_options.options.options:
44 -opt $advanced_options.options.options
45 #end if
46 #else:
47 -M 0.2
48
49 #end if
50 ${FastaFile} >stdout.log 2> stderr.log ;
51 echo "STDOUT CONTENT:" >> ${log} ;
52 cat stdout.log >> ${log} ;
53 echo "STDERR CONTENT:" >> ${log} ;
54 cat stderr.log >> ${log} &amp;&amp;
55 ${__tool_directory__}/stderr_filter.py stderr.log &amp;&amp;
56 cd tarean_output &amp;&amp;
57 zip -r ${ReportArchive}.zip * &amp;&amp;
58 mv ${ReportArchive}.zip ${ReportArchive} &amp;&amp;
59 cp index.html ${ReportFile} &amp;&amp;
60 mkdir ${ReportFile.files_path} &amp;&amp;
61 cp -r --parents libdir ${ReportFile.files_path} &amp;&amp;
62 cp -r --parents seqclust/clustering/superclusters ${ReportFile.files_path} &amp;&amp;
63 cp -r --parents seqclust/clustering/clusters ${ReportFile.files_path} &amp;&amp;
64 cp seqclust/clustering/hitsort.cls ${ReportFile.files_path}/seqclust/clustering/hitsort.cls &amp;&amp;
65 cp *.png ${ReportFile.files_path}/ &amp;&amp;
66 cp *.csv ${ReportFile.files_path}/ &amp;&amp;
67 cp *.html ${ReportFile.files_path}/ &amp;&amp;
68 cp *.css ${ReportFile.files_path}/ &amp;&amp;
69 cp *.fasta ${ReportFile.files_path}/ 2>>$log &amp;&amp; rm -r ../tarean_output || :
70
71
72 </command>
73
74 <inputs>
75 <param name="FastaFile" label="paired-end NGS reads" type="data" format="fasta"
76 help="Input file must contain fasta-formatted interlaced read pairs from paired-end sequencing. All pairs must be complete. Example of input data format is provided in the help below."/>
77 <param name="sample" label="Sample size" type="integer" value="500000" min="10000"/>
78
79 <conditional name="advanced_options">
80 <param name="advanced" type="boolean" truevalue="true" falsevalue="false" checked="False" label="Advanced options" />
81 <when value="false">
82 <!-- pass -->
83 </when>
84 <when value="true">
85 <param name="merging" type="boolean" truevalue="0.2" falsevalue="0" checked="True" label="Perform cluster merging" help="By default, clusters connected through paired-end reads are merged"/>
86 <conditional name="custom_library">
87 <param name="options_custom_library" type="boolean" truevalue="true" falsevalue="false" checked="False" label="Use custom repeat database"/>
88 <when value="false">
89 <!-- do nothing here -->
90 </when>
91 <when value="true">
92 <param name="library" format="fasta" type="data" label="Use custom repeat database" help="Perform additional similarity search to user-provided repeat database. The database should contain FASTA-formatted DNA sequences with headers (sequence names) in the format: '>reapeatname#class/subclass'"/>
93 </when>
94 </conditional>
95 <param name="size_threshold" label="Cluster size threshold for detailed analysis" type="float" value="0.01" min="0.0001" max="100" help ="Minimal size (as percentage of input reads) of the smallest cluster which is analyzed, cluster with less than 20 reads are not considered at all."/>
96 <param name="automatic_filtering" label="Perform automatic filtering of abundant satellite repeats" type="boolean" truevalue="--automatic_filtering" falsevalue="" checked="false"/>
97 <param name="keep_names" label="Keep original sequences names" type="boolean" truevalue="--keep_names" falsevalue="" checked="false" help="By default sequence are relabeled using integers. If you want to keep original names, use this option."/>
98 <conditional name="options">
99 <param name="options" type="select" label="Similarity search options" help="Different similarity search parameters are used depending on the used input data to adjust search to differences in length and error rate">
100 <option value="ILLUMINA" selected="true">Illumina reads, read length 100nt or more </option>
101 <option value="ILLUMINA_SHORT" selected="false">Illumina reads, shorter than 100nt (Do not use reads shorter than 50nt!) </option>
102 <option value="ILLUMINA_DUST_OFF" selected="false">Illumina reads, no masking of low complexity repeats </option>
103 </param>
104 </conditional>
105 </when>
106 </conditional>
107
108 </inputs>
109 <outputs>
110 <data name="log" format="txt" label="TAREAN log file"/>
111 <data name="ReportArchive" format="zip" label="TAREAN Archive with HTML report from data ${FastaFile.hid}"/>
112 <data name="ReportFile" format="html" label="TAREAN HTML report from data ${FastaFile.hid}"/>
113 </outputs>
114
115 <help>
116 **HELP**
117
118 TAREAN - TAndem REpeat ANalyzer is a computational pipeline for
119 **unsupervised identification of satellite repeats** from unassembled
120 sequence reads. The pipeline uses low-pass paired-end whole genome
121 sequence reads and performs graph-based clustering. The resulting
122 clusters, representing all types of repeats present in the genome, are
123 then examined to identify those containing circular structures indicative
124 of tandem repeats. A poster summarizing TAREAN principles and
125 implementation can be found `here.`__
126
127
128 .. __: http://w3lamc.umbr.cas.cz/lamc/?page_id=312
129
130 **Input data**
131
132
133 The analysis requires **paired-end reads** generated by whole genome
134 shotgun sequencing. The data should be provided as a single input file in
135 fasta format with the reads interlaced (see example below). All the pairs
136 must be complete, i.e. both "forward" and "reverse" sequence reads must be
137 present. The reads should all be trimmed to the same length. The optimal
138 size range is between 100 and 200 nucleotides. The number of reads to be
139 analyzed should not exceed 1x coverage of the genome. Genome coverage
140 between 0.01 and 0.5x is recommended. The reads should be filtered for
141 quality. The recommended quality filtering is as follows: each read should
142 have a quality score >=10 for 95% of the bases, i.e. if your reads are 100
143 base pairs long, then a read only passes this quality threshold if 95
144 bases have a quality of 10 or higher. Additionally, any reads containing
145 indeterminate base pairs (indicated as N in the reads) should be removed.
146 Finally, if either one of the reads in a pair fails to meet the
147 aforementioned thresholds, **both** sequences should be removed.
148 example of interlaced input format::
149
150 >0001_f
151 CGTAATATACATACTTGCTAGCTAGTTGGATGCATCCAACTTGCAAGCTAGTTTGATG
152 >0001_r
153 GATTTGACGGACACACTAACTAGCTAGTTGCATCTAAGCGGGCACACTAACTAACTAT
154 >0002_f
155 ACTCATTTGGACTTAACTTTGATAATAAAAACTTAAAAAGGTTTCTGCACATGAATCG
156 >0002_r
157 TATGTTGAAAAATTGAATTTCGGGACGAAACAGCGTCTATCGTCACGACATAGTGCTC
158 >0003_f
159 TGACATTTGTGAACGTTAATGTTCAACAAATCTTTCCAATGTCTTTTTATCTTATCAT
160 >0003_r
161 TATTGAAATACTGGACACAAATTGGAAATGAAACCTTGTGAGTTATTCAATTTATGTT
162 ...
163
164
165 To perform the quality filtering on your fastQ formatted data as described
166 above, and to interlace your paired-end sequence reads,
167 please use the `Preprocessing of paired-reads`__ tool.
168
169 .. __: tool_runner?tool_id=paired_fastq_filtering
170
171
172 **Additional parameters**
173
174 **Sample size** defines how many reads will be used during the computation.
175 The default setting of 500,000 reads will enable detection of high copy
176 number satellites within several hours. For higher
177 sensitivity the sample size can be increased. Since the sample size affects
178 memory usage, this parameter may be automatically adjusted to a lower value
179 during the run. The maximum sample size which can be processed depends on the
180 repetitiveness of the analyzed genome. This significantly limits the number of reads
181 that can be analyzed with the TAREAN pipeline.
182
183 **Perform cluster merging**. Families of repetitive elements are
184 frequently split into multiple clusters rather than being represented as a
185 single one. If you do not want to merge clusters based on the presence
186 of broken read pairs, disable this option.
187
188 **Use custom repeat database**. This option allows users to perform similarity
189 comparison of identified repeats to their custom databases. The repeat class should
190 be encoded in FASTA headers of database entries in order to allow correct
191 parsing of similarity hits.
192
193 **Similarity search options** By default sequence reads are compared using
194 mgblast program. Default threshold is explicitly set to 90% sequence
195 similarity spanning at least 55% of the read length (in the case of reads
196 differing in length it applies to the longer one). Additionally, sequence
197 overlap must be at least 55 nt. If you select option for shorter reads
198 than 100 nt, minimum overlap 55 nt is not required.
199
200 By default,
201 mgblast search use DUST program to filter out
202 low-complexity sequences. If you want
203 to increase sensitivity of detection of satellites with shorter monomer
204 use option with '*no masking of low complexity repeats*'. Note that omitting
205 DUST filtering will significantly increase running times
206
207 **Output**
208
209 A list of clusters identified as putative satellite repeats, their genomic
210 abundance and various cluster characteristics are provided. Length and
211 consensus sequences of reconstructed monomers are also shown and
212 accompanied by a detailed output from kmer-based reconstruction including
213 sequences and sequence logos of alternative variants of monomer sequences.
214
215 The output includes an **HTML summary** with a table listing all analyzed
216 clusters. More detailed information about clusters is provided in
217 additional files and directories. All results are also provided as a
218 downloadable **zip archive**. Since read clustering results in
219 thousands of clusters, the search for satellite repeats is limited to
220 a subset of the largest ones corresponding to the most abundant genomic
221 repeats. The default setting of the pipeline is to analyze all clusters containing at least
222 0.01% of the input reads. Besides the satellite repeats, three other
223 groups of clusters are reported in the output (1) LTR-retrotransposons,
224 (2) 45S and 5S rDNA and (3) all remaining clusters passing the size
225 threshold. As (1) and (2) contain sequences with circular
226 graphs, their consensus is calculated in the same way as for satellite
227 repeats. Additionally a **log file** reporting the progress of the
228 computational pipeline is provided.
229
230
231 </help>
232
233 </tool>