Mercurial > repos > pjbriggs > pal_finder

comparison test-data/illuminaPE_filtered_microsats_assembly.out @ 2:b6ccc7dd7b02 draft

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
Version 0.02.04.3.
author pjbriggs
date Fri, 04 Dec 2015 07:43:30 -0500
parents
children
comparison
equal deleted inserted replaced
1:771ebe02636f 2:b6ccc7dd7b02
1 readPairID Motifs(bases) Bases in all Motifs Possible Extended Possible Spanning Primers found (1=y,0=n) F Primer Name Forward Primer R Primer Name Reverse Primer Amplicon Motifs Number motif bases in amplicon Primers on sep reads Extend with primers Spand with primers Occurances of Forward Primer in Reads Occurances of Reverse Primer in Reads Occurances of Amplifiable Primer Pair in Reads Occurances of Amplifiable Primer Pair in PALs
2 ILLUMINA-545855:0049:FC61RLR:2:1:1978:1220 AC(12) 12 1 test_3 GCAGTAAACAAAGGCAAAGGG test_4 CCTGGGCAGAGGTGTTCC AC(12) 12 1 1 1 1 1
3 ILLUMINA-545855:0049:FC61RLR:2:1:5879:1238 AT(12) 12 0
4 ILLUMINA-545855:0049:FC61RLR:2:1:17449:1584 AC(36) 36 0
5 ILLUMINA-545855:0049:FC61RLR:2:1:8157:1636 AC(12) 12 1 test_5 AAGTACAGTGGGGAGGCTGG test_6 TTTTCTACACAGCTCAAGTAGCCC AC(12) 12 1 1 1 1 1
6 ILLUMINA-545855:0049:FC61RLR:2:1:8044:1926 AT(12) 12 0
7 ILLUMINA-545855:0049:FC61RLR:2:1:5626:1554 AT(14) AC(16) AC(16) AT(12) 58 0
8 ILLUMINA-545855:0049:FC61RLR:2:1:10979:1695 TC(14) 14 1 test_7 TTCTCCCACTATATTTTGCATTGG test_8 TCCAGACTGAAGCTACCCTGG TC(14) 14 1 1 1 1 1
9 ILLUMINA-545855:0049:FC61RLR:2:1:19063:1614 AT(14) AT(14) AT(14) AT(14) 56 0
10 ILLUMINA-545855:0049:FC61RLR:2:1:6204:1090 TC(12) 12 0
11 ILLUMINA-545855:0049:FC61RLR:2:1:8899:1514 AC(12) AC(12) 24 1 test_2 TCTTTATCTAAACACATCCTGAAATACC test_1 AAACGCAATTATTTTGAGATGTCC AC(12) AC(12) 24 1 1 2 1 1