diff test-data/illuminaPE_microsats_bad_ranges.out.re_match @ 8:4e625d3672ba draft

Pal_finder tool version 0.02.04.7: add detection/reporting of bad ranges; enable subset of reads to be used; check n-mers.
author pjbriggs
date Wed, 16 May 2018 07:39:16 -0400
parents
children
line wrap: on
line diff
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/illuminaPE_microsats_bad_ranges.out.re_match	Wed May 16 07:39:16 2018 -0400
@@ -0,0 +1,7 @@
+readPairID\	Motifs\(bases\)\	Bases\ in\ all\ Motifs\	Possible\ Extended\	Possible\ Spanning\	Primers\ found\ \(1\=y\,0\=n\)\	F\ Primer\ Name\	Forward\ Primer\	R\ Primer\ Name\	Reverse\ Primer\	Amplicon\ Motifs\	Number\ motif\ bases\ in\ amplicon\	Primers\ on\ sep\ reads\	Extend\ with\ primers\	Spand\ with\ primers\	Occurances\ of\ Forward\ Primer\ in\ Reads\	Occurances\ of\ Reverse\ Primer\ in\ Reads\	Occurances\ of\ Amplifiable\ Primer\ Pair\ in\ Reads\	Occurances\ of\ Amplifiable\ Primer\ Pair\ in\ PALs
+M00879\:99\:000000000\-AH9KG\:1\:2107\:10006\:2535\	AT\(16\)\ AT\(16\)\ \	32\	AT\ \	\	0\	\	\	\	\	\	\	\	\	\	\	\	\	
+M00879\:99\:000000000\-AH9KG\:1\:2107\:10032\:7900\	.*\ \	164\	\	\	1\	test\_.*\	(CGAAAGATGCTATAGAAGCGATGGGG|TATCTATCTATCAATCCGCTCCCC)\	test\_.*\	(GGACATCGAGATAGAAAGGGGACCG|TGATTGGACATCGAGATAGAAAGGG)\	.*\ \	80\	1\	\	\	.*\	.*\	1\	1
+M00879\:99\:000000000\-AH9KG\:1\:2107\:10061\:6317\	.*\ \	76\	\	\	1\	test\_.*\	GAGAGAGTACATAGATATCTCACGGGGCG\	test\_.*\	GCAACGGCACAGATCTCTTCTACGG\	.*\ \	22\	1\	\	\	1\	1\	1\	1
+M00879\:99\:000000000\-AH9KG\:1\:2107\:10072\:8112\	.*\ \	44\	\	\	1\	test\_.*\	AGTTTGTTACAGGGCATGACAACGG\	test\_.*\	TCCTGTTATCTTCTTGTTGCTTGGC\	.*\ \	22\	1\	\	\	1\	1\	1\	1
+M00879\:99\:000000000\-AH9KG\:1\:2107\:10084\:6474\	.*\ \	100\	\	\	0\	\	\	\	\	\	\	\	\	\	\	\	\	
+M00879\:99\:000000000\-AH9KG\:1\:2107\:14372\:5471\	.*\ \	68\	.*\ \	\	0\	\	\	\	\	\	\	\	\	\	\	\	\