Mercurial > repos > pjbriggs > pal_finder
view test-data/illuminaPE_microsats_bad_ranges.out.re_match @ 8:4e625d3672ba draft
Pal_finder tool version 0.02.04.7: add detection/reporting of bad ranges; enable subset of reads to be used; check n-mers.
author | pjbriggs |
---|---|
date | Wed, 16 May 2018 07:39:16 -0400 |
parents | |
children |
line wrap: on
line source
readPairID\ Motifs\(bases\)\ Bases\ in\ all\ Motifs\ Possible\ Extended\ Possible\ Spanning\ Primers\ found\ \(1\=y\,0\=n\)\ F\ Primer\ Name\ Forward\ Primer\ R\ Primer\ Name\ Reverse\ Primer\ Amplicon\ Motifs\ Number\ motif\ bases\ in\ amplicon\ Primers\ on\ sep\ reads\ Extend\ with\ primers\ Spand\ with\ primers\ Occurances\ of\ Forward\ Primer\ in\ Reads\ Occurances\ of\ Reverse\ Primer\ in\ Reads\ Occurances\ of\ Amplifiable\ Primer\ Pair\ in\ Reads\ Occurances\ of\ Amplifiable\ Primer\ Pair\ in\ PALs M00879\:99\:000000000\-AH9KG\:1\:2107\:10006\:2535\ AT\(16\)\ AT\(16\)\ \ 32\ AT\ \ \ 0\ \ \ \ \ \ \ \ \ \ \ \ \ M00879\:99\:000000000\-AH9KG\:1\:2107\:10032\:7900\ .*\ \ 164\ \ \ 1\ test\_.*\ (CGAAAGATGCTATAGAAGCGATGGGG|TATCTATCTATCAATCCGCTCCCC)\ test\_.*\ (GGACATCGAGATAGAAAGGGGACCG|TGATTGGACATCGAGATAGAAAGGG)\ .*\ \ 80\ 1\ \ \ .*\ .*\ 1\ 1 M00879\:99\:000000000\-AH9KG\:1\:2107\:10061\:6317\ .*\ \ 76\ \ \ 1\ test\_.*\ GAGAGAGTACATAGATATCTCACGGGGCG\ test\_.*\ GCAACGGCACAGATCTCTTCTACGG\ .*\ \ 22\ 1\ \ \ 1\ 1\ 1\ 1 M00879\:99\:000000000\-AH9KG\:1\:2107\:10072\:8112\ .*\ \ 44\ \ \ 1\ test\_.*\ AGTTTGTTACAGGGCATGACAACGG\ test\_.*\ TCCTGTTATCTTCTTGTTGCTTGGC\ .*\ \ 22\ 1\ \ \ 1\ 1\ 1\ 1 M00879\:99\:000000000\-AH9KG\:1\:2107\:10084\:6474\ .*\ \ 100\ \ \ 0\ \ \ \ \ \ \ \ \ \ \ \ \ M00879\:99\:000000000\-AH9KG\:1\:2107\:14372\:5471\ .*\ \ 68\ .*\ \ \ 0\ \ \ \ \ \ \ \ \ \ \ \ \