Mercurial > repos > pjbriggs > pal_finder
view test-data/illuminaPE_microsats_subset.out.re_match @ 8:4e625d3672ba draft
Pal_finder tool version 0.02.04.7: add detection/reporting of bad ranges; enable subset of reads to be used; check n-mers.
author | pjbriggs |
---|---|
date | Wed, 16 May 2018 07:39:16 -0400 |
parents | |
children |
line wrap: on
line source
readPairID\ Motifs\(bases\)\ Bases\ in\ all\ Motifs\ Possible\ Extended\ Possible\ Spanning\ Primers\ found\ \(1\=y\,0\=n\)\ F\ Primer\ Name\ Forward\ Primer\ R\ Primer\ Name\ Reverse\ Primer\ Amplicon\ Motifs\ Number\ motif\ bases\ in\ amplicon\ Primers\ on\ sep\ reads\ Extend\ with\ primers\ Spand\ with\ primers\ Occurances\ of\ Forward\ Primer\ in\ Reads\ Occurances\ of\ Reverse\ Primer\ in\ Reads\ Occurances\ of\ Amplifiable\ Primer\ Pair\ in\ Reads\ Occurances\ of\ Amplifiable\ Primer\ Pair\ in\ PALs ILLUMINA\-545855\:49\:FC61RLR\:2\:1\:17449\:1584\ (AC|TG)\(36\)\ \ 36\ \ \ 0\ \ \ \ \ \ \ \ \ \ \ \ \ ILLUMINA\-545855\:49\:FC61RLR\:2\:1\:5626\:1554\ AT\(14\)\ (AC|TG)\(16\)\ (AC|TG)\(16\)\ AT\(12\)\ \ 58\ \ \ 0\ \ \ \ \ \ \ \ \ \ \ \ \ ILLUMINA\-545855\:49\:FC61RLR\:2\:1\:5879\:1238\ AT\(12\)\ \ 12\ \ \ 0\ \ \ \ \ \ \ \ \ \ \ \ \ ILLUMINA\-545855\:49\:FC61RLR\:2\:1\:8157\:1636\ (AC|TG)\(12\)\ \ 12\ \ \ 1\ test\_.*\ AAGTACAGTGGGGAGGCTGG\ test\_.*\ TTTTCTACACAGCTCAAGTAGCCC\ (AC|TG)\(12\)\ \ 12\ 1\ \ \ 1\ 1\ 1\ 1 ILLUMINA\-545855\:49\:FC61RLR\:2\:1\:8899\:1514\ (AC|TG)\(12\)\ (AC|TG)\(12\)\ \ 24\ \ \ 1\ test\_.*\ TCTTTATCTAAACACATCCTGAAATACC\ test\_.*\ AAACGCAATTATTTTGAGATGTCC\ (AC|TG)\(12\)\ (AC|TG)\(12\)\ \ 24\ 1\ \ \ 1\ 2\ 1\ 1