Mercurial > repos > portiahollyoak > genbank_to_fasta
view genbank_to_fasta.py @ 0:bcdd1a35e545 draft default tip
planemo upload for repository https://github.com/portiahollyoak/Tools commit 132bb96bba8e7aed66a102ed93b7744f36d10d37-dirty
| author | portiahollyoak |
|---|---|
| date | Fri, 22 Apr 2016 12:09:14 -0400 |
| parents | |
| children |
line wrap: on
line source
#!/usr/bin/env python # coding: utf-8 import argparse import doctest # This will test if the functions are working def get_id(line): """ This function reads a line and returns the ID name >>> line = 'ID TE standard; DNA; INV; 7411 BP.' >>> 'TE'== get_id(line) True """ if line.startswith("ID"): id = line.split(" ")[1] #split line into 'ID' and rest of line, take rest of line and define as id id = id.split(" ")[0] #split id into 'ID name' and rest of line, take ID name and define as id return id def get_seq(line): """ This function reads a sequence line from a genbank file and returns a sequence with no spaces or digits >>> line = "AGTGACATAT TCACATACAA AACCACATAA CATAGAGTAA ACATATTGAA AAGCCGCATA 60" >>> 'AGTGACATATTCACATACAAAACCACATAACATAGAGTAAACATATTGAAAAGCCGCATA' == get_seq(line) True """ seq = [] for char in line: if not char.isdigit() and not char == " ": # If a character is not a digit or space, # it will be added to sequence. seq.append(char) seq = "".join(seq) return seq def make_seq_dictionary(input_file_handle): """ This function loops over a multi genbank file and returns a collection of ID and corresponding sequence in a dictionary. """ seq_d = {} # dictionary with id as key and sequence as value next_line_is_seq = False for line in input_file_handle: line = line.strip() # strips any leading or trailing whitespace if line.startswith("ID"): id = get_id(line) seq_d[id]="" # We just create a new key if line.startswith("SQ"): next_line_is_seq = True # If line starts with 'SQ' then state is true continue if line.startswith("//"): # If line starts with '//' then state is false next_line_is_seq = False if next_line_is_seq: # Whatever has been read as true, this is copied to file seq = get_seq(line) seq_d[id] += seq return seq_d def write_seq_d_to_file(seq_d, output): """ This function will write the sequence dictionary to an output file """ for transposon, seq in seq_d.items(): output.write(">%s\n" % transposon) output.write("%s\n" % seq) description = ( "This script will extract ID names and sequences from a multigenbank" "file and format them into a multifasta file." ) parser = argparse.ArgumentParser(description) parser.add_argument("input", help="A multi-genbank file.") parser.add_argument("output", help="Name of the output fasta file.") args = parser.parse_args() try: with open(args.input, encoding = "utf-8") as input_file_handle: # This will perform the tasks seq_d = make_seq_dictionary(input_file_handle) except TypeError: with open(args.input) as input_file_handle: seq_d = make_seq_dictionary(input_file_handle) with open(args.output, "w") as output: write_seq_d_to_file(seq_d, output)
