Mercurial > repos > rmarenco > multi_fasta_glimmer_hmm

comparison glimmerhmm.xml @ 0:0ddb5ee32ff6 draft default tip

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
planemo upload for repository https://github.com/remimarenco/multi_fasta_glimmerhmm.git commit 28bd73b26b50165eded1d9ba995979acdf005ad1-dirty
author rmarenco
date Thu, 18 Aug 2016 18:50:00 -0400
parents
children
comparison
equal deleted inserted replaced
-1:000000000000 0:0ddb5ee32ff6
1 <tool id="multi_fasta_glimmerhmm" name="Multi Fasta GlimmerHMM" version="4.0">
2 <description>Predict ORFs in eukaryotic genomes for Multi Fasta file</description>
3 <command detect_errors="aggressive"><![CDATA[
4 python $__tool_directory__/multi_glimmer.py
5 --multi_fasta $input
6 --trained_dir $trained_specie.fields.path
7 --output $output
8 ]]></command>
9 <inputs>
10 <param name="input" type="data" format="fasta" label="Genome Sequence"/>
11 <param name="trained_specie" type="select" label="Select a specie">
12 <options from_data_table="glimmer_hmm_trained_dir">
13 <filter type="sort_by" column="2"/>
14 <validator type="no_options" message="No indexes are available"/>
15 </options>
16 </param>
17 </inputs>
18 <outputs>
19 <data format="gff3" name="output" />
20 </outputs>
21 <help>
22 **What it does**
23
24 GlimmerHMM is a new gene finder based on a Generalized Hidden Markov Model (GHMM).
25 Although the gene finder conforms to the overall mathematical framework of a GHMM,
26 additionally it incorporates splice site models adapted from the GeneSplicer program and a
27 decision tree adapted from GlimmerM. It also utilizes Interpolated Markov Models for the
28 coding and noncoding models . Currently, GlimmerHMM's GHMM structure includes introns of each phase,
29 intergenic regions, and four types of exons (initial, internal, final, and single).
30 A basic user manual can be consulted here.
31
32 **Example**
33
34 Suppose you have the following DNA formatted sequences::
35
36 >SQ Sequence 8667507 BP; 1203558 A; 3121252 C; 3129638 G; 1213059 T; 0 other;
37 cccgcggagcgggtaccacatcgctgcgcgatgtgcgagcgaacacccgggctgcgcccg
38 ggtgttgcgctcccgctccgcgggagcgctggcgggacgctgcgcgtcccgctcaccaag
39 cccgcttcgcgggcttggtgacgctccgtccgctgcgcttccggagttgcggggcttcgc
40 cccgctaaccctgggcctcgcttcgctccgccttgggcctgcggcgggtccgctgcgctc
41 ccccgcctcaagggcccttccggctgcgcctccaggacccaaccgcttgcgcgggcctgg
42
43 Running this tool will produce this::
44
45 ##gff-version 3
46 ##sequence-region ConsensusfromCH236920mapping 1 4148552
47 ConsensusfromCH236920mapping GlimmerHMM mRNA 1 122 . + . ID=ConsensusfromCH236920mapping.path1.gene1;Name=ConsensusfromCH236920mapping.path1.gene1
48 ConsensusfromCH236920mapping GlimmerHMM CDS 1 122 . + 0 ID=ConsensusfromCH236920mapping.cds1.1;
49 ConsensusfromCH236920mapping GlimmerHMM mRNA 14066 15205 . - . ID=ConsensusfromCH236920mapping.path1.gene2;Name=ConsensusfromCH236920mapping.path1.gene2
50 ConsensusfromCH236920mapping GlimmerHMM CDS 14066 15034 . - 0 ID=ConsensusfromCH236920mapping.cds2.1;
51 ConsensusfromCH236920mapping GlimmerHMM CDS 15137 15205 . - 0 ID=ConsensusfromCH236920mapping.cds2.2;
52 ConsensusfromCH236920mapping GlimmerHMM mRNA 19910 24210 . - . ID=ConsensusfromCH236920mapping.path1.gene3;Name=ConsensusfromCH236920mapping.path1.gene3
53 </help>
54 </tool>