Mercurial > repos > rnateam > cofold

comparison test-data/example1_ss.ps @ 0:76d9140e8fa5 draft

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
Imported from capsule None
author bjoern-gruening
date Fri, 13 Feb 2015 05:33:32 -0500
parents
children
comparison
equal deleted inserted replaced
-1:000000000000 0:76d9140e8fa5
1 %!PS-Adobe-3.0 EPSF-3.0
2 %%Creator: PS_dot.c,v 1.38 2007/02/02 15:18:13 ivo Exp $, ViennaRNA-2.0.4
3 %%CreationDate: Mon Jan 12 21:39:30 2015
4 %%Title: RNA Secondary Structure Plot
5 %%BoundingBox: 66 210 518 662
6 %%DocumentFonts: Helvetica
7 %%Pages: 1
8 %%EndComments
9
10 %Options: -d2
11 % to switch off outline pairs of sequence comment or
12 % delete the appropriate line near the end of the file
13
14 %%BeginProlog
15 /RNAplot 100 dict def
16 RNAplot begin
17 /fsize 14 def
18 /outlinecolor {0.2 setgray} bind def
19 /paircolor {0.2 setgray} bind def
20 /seqcolor {0 setgray} bind def
21 /cshow { dup stringwidth pop -2 div fsize -3 div rmoveto show} bind def
22 /min { 2 copy gt { exch } if pop } bind def
23 /max { 2 copy lt { exch } if pop } bind def
24 /arccoords { % i j arccoords
25 % puts optimal x1 y1 x2 y2 coordinates used in bezier curves from i to j
26 % onto the stack
27 dup 3 -1 roll dup 4 -1 roll lt dup dup 5 2 roll {exch} if
28 dup 3 -1 roll dup 3 -1 roll exch sub 1 sub dup
29 4 -2 roll 5 -1 roll {exch} if 4 2 roll
30 sequence length dup 2 div exch 3 1 roll lt
31 {exch 5 -1 roll pop 4 -2 roll exch 4 2 roll}
32 { 4 2 roll 5 -1 roll dup 6 1 roll {exch} if
33 4 -2 roll exch pop dup 3 -1 roll dup 4 1 roll
34 exch add 4 -1 roll dup 5 1 roll sub 1 sub
35 5 -1 roll not {4 -2 roll exch 4 2 roll} if
36 }ifelse
37 % compute the scalingfactor and prepare (1-sf) and sf*r
38 2 mul exch cpr 3 1 roll div dup
39 3 -1 roll mul exch 1 exch sub exch
40 % compute the coordinates
41 3 -1 roll 1 sub coor exch get aload pop % get coord for i
42 4 -1 roll dup 5 1 roll mul 3 -1 roll dup 4 1 roll add exch % calculate y1
43 4 -1 roll dup 5 1 roll mul 3 -1 roll dup 4 1 roll add exch % calculate x1
44 5 -1 roll 1 sub coor exch get aload pop % get coord for j
45 % duplicate j coord
46 dup 3 -1 roll dup 4 1 roll exch 8 2 roll
47 6 -1 roll dup 7 1 roll mul 5 -1 roll dup 6 1 roll add exch % calculate y2
48 6 -1 roll mul 5 -1 roll add exch % calculate x2
49 6 -2 roll % reorder
50 } bind def
51 /drawoutline {
52 gsave outlinecolor newpath
53 coor 0 get aload pop 0.8 0 360 arc % draw 5' circle of 1st sequence
54 currentdict /cutpoint known % check if cutpoint is defined
55 {coor 0 cutpoint getinterval
56 {aload pop lineto} forall % draw outline of 1st sequence
57 coor cutpoint 1 add get aload pop
58 2 copy moveto 0.8 0 360 arc % draw 5' circle of 2nd sequence
59 coor cutpoint 1 add coor length cutpoint 1 add sub getinterval
60 {aload pop lineto} forall} % draw outline of 2nd sequence
61 {coor {aload pop lineto} forall} % draw outline as a whole
62 ifelse
63 stroke grestore
64 } bind def
65 /drawpairs {
66 paircolor
67 0.7 setlinewidth
68 [9 3.01] 9 setdash
69 newpath
70 pairs {aload pop
71 currentdict (cpr) known
72 { exch dup
73 coor exch 1 sub get aload pop moveto
74 exch arccoords curveto
75 }
76 { coor exch 1 sub get aload pop moveto
77 coor exch 1 sub get aload pop lineto
78 }ifelse
79 } forall
80 stroke
81 } bind def
82 % draw bases
83 /drawbases {
84 [] 0 setdash
85 seqcolor
86 0
87 coor {
88 aload pop moveto
89 dup sequence exch 1 getinterval cshow
90 1 add
91 } forall
92 pop
93 } bind def
94
95 /init {
96 /Helvetica findfont fsize scalefont setfont
97 1 setlinejoin
98 1 setlinecap
99 0.8 setlinewidth
100 72 216 translate
101 % find the coordinate range
102 /xmax -1000 def /xmin 10000 def
103 /ymax -1000 def /ymin 10000 def
104 coor {
105 aload pop
106 dup ymin lt {dup /ymin exch def} if
107 dup ymax gt {/ymax exch def} {pop} ifelse
108 dup xmin lt {dup /xmin exch def} if
109 dup xmax gt {/xmax exch def} {pop} ifelse
110 } forall
111 /size {xmax xmin sub ymax ymin sub max} bind def
112 72 6 mul size div dup scale
113 size xmin sub xmax sub 2 div size ymin sub ymax sub 2 div
114 translate
115 } bind def
116 end
117 %%EndProlog
118 RNAplot begin
119 % data start here
120 /sequence (\
121 AUGCAGGAAAUGCGGGUAGCCGCUGCCGCAAUCGUCUCGGCGAUUGGCGGUAGAGGAAAGUCCAGGCUCGCCCAAGCUGAGAUGCUUGGAGUGUUCGUACCUGGCGCAAGCCAGGGCAAGUGAGGCGCAAGCCUCGCUGACGGCGUGGAAAGGGCUCUCUCUGAGGCCCGAGUACGCUGAAAGUGCCACAGAAACGUAGCUUUUCUGGCGACAGAAAAGAUGGAACGCGGUAAACCCUGCGAGCGAGAAACCCAA\
122 AUUUGGUAGGGGAACCGUCCUGAAGGAAUCAAACGGAAGGGACGGAUGGUAUCUUCGGAUGCCAUAGAUAGAUGGCUACCGCUCUUGGUGCGAGGGAUACGUCCCGCUUGCAGCACGGGAGAGACAGAACCUGGCUUAUAGCAUUUCCUGCUGGAU\
123 ) def
124 /coor [
125 [42.06064606 297.00585938]
126 [46.61352158 282.17175293]
127 [59.03635025 272.87374878]
128 [58.69324493 257.87765503]
129 [58.35013962 242.88159180]
130 [58.00703430 227.88551331]
131 [57.66392899 212.88943481]
132 [57.32082748 197.89335632]
133 [56.97772217 182.89727783]
134 [56.63461685 167.90121460]
135 [56.29151154 152.90513611]
136 [55.94840622 137.90905762]
137 [55.60530090 122.91297913]
138 [46.82557678 110.75089264]
139 [32.70000839 105.70427704]
140 [18.57444000 100.65766144]
141 [4.44887257 95.61104584]
142 [-9.94205666 99.84201813]
143 [-19.08859444 111.73070526]
144 [-28.23513222 123.61939240]
145 [-37.38166809 135.50807190]
146 [-29.15162849 152.90130615]
147 [-41.59085464 175.22094727]
148 [-49.80515671 187.77185059]
149 [-58.01945496 200.32276917]
150 [-66.23375702 212.87367249]
151 [-74.44805145 225.42457581]
152 [-82.66235352 237.97549438]
153 [-90.82874298 250.55761719]
154 [-98.94709778 263.17080688]
155 [-107.06545258 275.78396606]
156 [-115.18381500 288.39715576]
157 [-123.30216980 301.01034546]
158 [-131.42053223 313.62350464]
159 [-139.53887939 326.23669434]
160 [-139.78965759 342.63391113]
161 [-154.24520874 350.37789917]
162 [-168.03489685 341.50228882]
163 [-166.97308350 325.13757324]
164 [-152.15206909 318.11834717]
165 [-144.03370667 305.50515747]
166 [-135.91534424 292.89196777]
167 [-127.79698944 280.27880859]
168 [-119.67863464 267.66561890]
169 [-111.56027222 255.05244446]
170 [-103.44191742 242.43927002]
171 [-102.47118378 235.17279053]
172 [-95.21325684 229.76118469]
173 [-86.99896240 217.21028137]
174 [-78.78466034 204.65937805]
175 [-70.57036591 192.10845947]
176 [-62.35606384 179.55755615]
177 [-54.14176559 167.00665283]
178 [-59.68206406 161.95144653]
179 [-76.30296326 146.78584290]
180 [-88.05078125 156.11260986]
181 [-91.30287170 171.82260132]
182 [-105.67762756 178.94621277]
183 [-120.14797974 172.01882935]
184 [-123.61350250 156.35453796]
185 [-113.41574860 143.96966553]
186 [-97.37755585 144.36479187]
187 [-85.62973785 135.03802490]
188 [-66.41344452 121.66181946]
189 [-49.27035522 126.36154175]
190 [-40.12381744 114.47285461]
191 [-30.97727966 102.58416748]
192 [-21.83074188 90.69548035]
193 [-26.24375725 84.63121796]
194 [-41.16038132 86.21054840]
195 [-35.06978607 72.50268555]
196 [-39.48280334 66.43842316]
197 [-53.60836792 71.48503876]
198 [-67.73394012 76.53165436]
199 [-81.85950470 81.57826996]
200 [-95.98506927 86.62489319]
201 [-110.11064148 91.67150879]
202 [-116.64728546 106.06066132]
203 [-131.47320557 111.53492737]
204 [-145.79244995 104.84651947]
205 [-151.10966492 89.96355438]
206 [-144.27023315 75.71582031]
207 [-129.33187866 70.55625916]
208 [-115.15725708 77.54593658]
209 [-101.03168488 72.49932098]
210 [-86.90612030 67.45270538]
211 [-72.78055573 62.40608978]
212 [-58.65498734 57.35947418]
213 [-44.52941895 52.31285477]
214 [-37.56217957 38.52346039]
215 [-26.96384048 30.84691238]
216 [-36.73162842 19.46313858]
217 [-46.49941635 8.07936382]
218 [-56.26720428 -3.30441141]
219 [-66.03498840 -14.68818665]
220 [-75.80278015 -26.07196045]
221 [-98.98574066 -31.25790787]
222 [-103.97647858 -53.77650833]
223 [-115.58070374 -63.28135300]
224 [-127.18492889 -72.78619385]
225 [-141.12904358 -78.31444550]
226 [-156.09373474 -79.34304047]
227 [-171.05842590 -80.37163544]
228 [-186.02311707 -81.40023804]
229 [-200.98780823 -82.42883301]
230 [-215.47293091 -74.74032593]
231 [-229.22850037 -83.66873169]
232 [-228.10395813 -100.02927399]
233 [-213.25614929 -106.99163055]
234 [-199.95921326 -97.39352417]
235 [-184.99452209 -96.36492920]
236 [-170.02983093 -95.33632660]
237 [-155.06513977 -94.30773163]
238 [-140.10044861 -93.27913666]
239 [-134.25469971 -107.09315491]
240 [-145.41206360 -117.11877441]
241 [-156.56942749 -127.14439392]
242 [-167.72680664 -137.17001343]
243 [-180.43200684 -145.14358521]
244 [-194.31199646 -150.83094788]
245 [-208.19197083 -156.51832581]
246 [-222.07194519 -162.20570374]
247 [-235.95191956 -167.89308167]
248 [-249.83189392 -173.58044434]
249 [-263.71188354 -179.26782227]
250 [-277.59185791 -184.95520020]
251 [-293.76089478 -182.21772766]
252 [-304.00628662 -195.02258301]
253 [-297.78839111 -210.19723511]
254 [-281.50369263 -212.13130188]
255 [-271.90447998 -198.83517456]
256 [-258.02450562 -193.14779663]
257 [-244.14453125 -187.46043396]
258 [-230.26455688 -181.77305603]
259 [-216.38456726 -176.08567810]
260 [-202.50459290 -170.39830017]
261 [-188.62461853 -164.71093750]
262 [-174.74464417 -159.02355957]
263 [-170.33161926 -165.08781433]
264 [-161.50559998 -177.21635437]
265 [-157.09257507 -183.28060913]
266 [-166.77328491 -194.73854065]
267 [-176.45397949 -206.19645691]
268 [-186.13467407 -217.65438843]
269 [-195.81538391 -229.11230469]
270 [-205.49607849 -240.57023621]
271 [-215.17678833 -252.02816772]
272 [-228.76481628 -249.99882507]
273 [-241.48760986 -254.89045715]
274 [-250.07904053 -265.33328247]
275 [-252.38992310 -278.54754639]
276 [-247.92489624 -291.08288574]
277 [-257.51794434 -302.61428833]
278 [-267.11099243 -314.14569092]
279 [-276.70404053 -325.67709351]
280 [-284.53216553 -330.22500610]
281 [-286.32586670 -337.33322144]
282 [-295.83071899 -348.93743896]
283 [-305.33557129 -360.54165649]
284 [-320.04965210 -368.96374512]
285 [-316.02999878 -385.43426514]
286 [-299.09036255 -386.13119507]
287 [-293.73135376 -370.04650879]
288 [-284.22650146 -358.44229126]
289 [-274.72164917 -346.83804321]
290 [-265.17263794 -335.27017212]
291 [-255.57958984 -323.73873901]
292 [-245.98654175 -312.20733643]
293 [-236.39349365 -300.67593384]
294 [-220.01821899 -302.26220703]
295 [-205.79644775 -293.66452026]
296 [-199.46578979 -278.11874390]
297 [-203.71885681 -261.70886230]
298 [-194.03816223 -250.25093079]
299 [-184.35745239 -238.79301453]
300 [-174.67675781 -227.33508301]
301 [-164.99606323 -215.87716675]
302 [-155.31535339 -204.41923523]
303 [-145.63465881 -192.96131897]
304 [-141.63436890 -180.67662048]
305 [-141.60919189 -169.09901428]
306 [-144.92291260 -159.34556580]
307 [-150.65541077 -152.25607300]
308 [-157.70118713 -148.32739258]
309 [-146.54380798 -138.30177307]
310 [-135.38644409 -128.27615356]
311 [-124.22907257 -118.25052643]
312 [-113.94187164 -129.16719055]
313 [-99.47093964 -133.11585999]
314 [-85.06471252 -128.93724060]
315 [-74.95267487 -117.85813141]
316 [-72.10356140 -103.13119507]
317 [-77.35384369 -89.08005524]
318 [-89.16210175 -79.82991791]
319 [-104.06160736 -78.09649658]
320 [-117.68008423 -84.39041901]
321 [-106.07585907 -74.88557434]
322 [-94.47164154 -65.38072968]
323 [-92.45198059 -66.40425110]
324 [-90.33458710 -67.20630646]
325 [-89.53431702 -82.18494415]
326 [-88.73405457 -97.16358185]
327 [-87.93378448 -112.14221954]
328 [-87.13351440 -127.12085724]
329 [-86.33324432 -142.09948730]
330 [-85.53297424 -157.07812500]
331 [-84.73271179 -172.05676270]
332 [-92.64122009 -186.42295837]
333 [-83.92362213 -200.31307983]
334 [-67.54782867 -199.43817139]
335 [-60.35985565 -184.69825745]
336 [-69.75407410 -171.25650024]
337 [-70.55434418 -156.27786255]
338 [-71.35460663 -141.29922485]
339 [-72.15487671 -126.32058716]
340 [-72.95514679 -111.34194946]
341 [-73.75541687 -96.36331177]
342 [-74.55567932 -81.38467407]
343 [-75.35594940 -66.40604401]
344 [-67.97018433 -61.46640778]
345 [-63.16696167 -53.83242416]
346 [-61.87234116 -44.77110291]
347 [-64.41900635 -35.83974838]
348 [-54.65121460 -24.45597458]
349 [-44.88342667 -13.07219887]
350 [-35.11563873 -1.68842399]
351 [-25.34785271 9.69535065]
352 [-15.58006573 21.07912636]
353 [-2.12498283 16.75079727]
354 [12.84111309 20.26181984]
355 [24.76665306 31.82793236]
356 [29.40202522 49.07128906]
357 [24.23037720 67.45729828]
358 [9.49548912 81.48547363]
359 [23.62105751 86.53208923]
360 [37.74662399 91.57870483]
361 [51.87219238 96.62532043]
362 [118.20749664 79.33209991]
363 [133.13385010 77.84761047]
364 [148.06022644 76.36312866]
365 [162.98658752 74.87864685]
366 [177.91294861 73.39415741]
367 [192.83930969 71.90967560]
368 [207.76567078 70.42518616]
369 [206.81819153 65.40071869]
370 [207.11807251 59.85226059]
371 [208.82124329 54.08790207]
372 [212.00886536 48.45391846]
373 [216.67895508 43.31697083]
374 [222.74208069 39.04468155]
375 [230.02160645 35.98537064]
376 [238.25845337 34.44812012]
377 [253.02836609 31.83088112]
378 [267.79827881 29.21364403]
379 [282.56817627 26.59640694]
380 [289.42739868 12.80303001]
381 [302.93545532 5.77555704]
382 [317.81539917 8.02305317]
383 [328.39208984 18.47637749]
384 [343.16198730 15.85914040]
385 [357.93188477 13.24190331]
386 [372.70178223 10.62466621]
387 [387.47171021 8.00742912]
388 [402.24160767 5.39019156]
389 [405.42944336 -14.38106346]
390 [416.64169312 -31.34718895]
391 [434.10409546 -42.36170959]
392 [454.85861206 -45.25786591]
393 [475.26364136 -39.27045441]
394 [491.63278198 -25.21584892]
395 [505.63922119 -30.58424950]
396 [519.64562988 -35.95264816]
397 [533.65209961 -41.32104874]
398 [547.65850830 -46.68944931]
399 [561.66497803 -52.05784988]
400 [575.67138672 -57.42624664]
401 [579.85992432 -73.85271454]
402 [592.90319824 -84.41780853]
403 [609.50823975 -85.09050751]
404 [623.08813477 -75.80330658]
405 [626.86700439 -90.85321808]
406 [638.79187012 -100.78182983]
407 [654.27734375 -101.77139282]
408 [667.36901855 -93.44140625]
409 [673.03277588 -78.99491119]
410 [669.09088135 -63.98688126]
411 [657.05902100 -54.18821335]
412 [641.56365967 -53.36669159]
413 [628.56317139 -61.83821106]
414 [626.42895508 -48.70367050]
415 [618.03155518 -38.24233246]
416 [605.46887207 -33.23781967]
417 [591.96435547 -35.08874130]
418 [581.03979492 -43.41981125]
419 [567.03338623 -38.05141068]
420 [553.02691650 -32.68301010]
421 [539.02050781 -27.31461143]
422 [525.01403809 -21.94621086]
423 [511.00759888 -16.57781219]
424 [497.00115967 -11.20941162]
425 [499.56207275 3.57036328]
426 [514.55816650 3.91346860]
427 [529.55426025 4.25657368]
428 [544.55029297 4.59967899]
429 [559.54638672 4.94278431]
430 [574.54248047 5.28588915]
431 [589.53851318 5.62899446]
432 [604.53460693 5.97209978]
433 [618.65295410 -2.37084746]
434 [632.80242920 5.91910172]
435 [632.42736816 22.31395912]
436 [617.91351318 29.94809914]
437 [604.19152832 20.96817589]
438 [589.19543457 20.62507057]
439 [574.19934082 20.28196526]
440 [559.20324707 19.93885994]
441 [544.20721436 19.59575462]
442 [529.21112061 19.25264931]
443 [514.21502686 18.90954399]
444 [499.21896362 18.56643867]
445 [494.37283325 29.36221313]
446 [487.24349976 38.69115067]
447 [478.24191284 46.08493042]
448 [467.87142944 51.18465424]
449 [456.69982910 53.75814056]
450 [445.32806396 53.71020508]
451 [434.35815430 51.08555603]
452 [424.36123657 46.06418991]
453 [415.84774780 38.94970322]
454 [409.24157715 30.15123749]
455 [404.85882568 20.16009521]
456 [390.08892822 22.77733231]
457 [375.31903076 25.39456940]
458 [360.54913330 28.01180840]
459 [345.77923584 30.62904549]
460 [331.00930786 33.24628067]
461 [324.66851807 46.69739151]
462 [311.46685791 53.92097092]
463 [296.36654663 51.96292496]
464 [285.18539429 41.36631012]
465 [270.41549683 43.98354721]
466 [255.64559937 46.60078430]
467 [240.87568665 49.21802521]
468 [238.95297241 56.46737671]
469 [253.93037415 55.64429092]
470 [259.34143066 69.63430786]
471 [247.70822144 79.10365295]
472 [235.10752869 70.96608734]
473 [233.18479919 78.21543884]
474 [244.71621704 87.80849457]
475 [256.24761963 97.40154266]
476 [267.77902222 106.99459076]
477 [284.02386475 109.23905945]
478 [289.95101929 124.52960968]
479 [279.46316528 137.13662720]
480 [263.34930420 134.09109497]
481 [258.18597412 118.52600098]
482 [246.65457153 108.93295288]
483 [235.12315369 99.33989716]
484 [223.59175110 89.74684906]
485 [209.25015259 85.35155487]
486 [194.32379150 86.83603668]
487 [179.39743042 88.32051849]
488 [164.47106934 89.80500793]
489 [149.54470825 91.28948975]
490 [134.61834717 92.77397919]
491 [119.69197845 94.25846100]
492 [112.70944977 107.53416443]
493 [119.94377136 120.67435455]
494 [126.76836395 126.62311554]
495 [127.18272400 133.94242859]
496 [134.31663513 147.13740540]
497 [141.45056152 160.33238220]
498 [148.58447266 173.52734375]
499 [163.93939209 173.87649536]
500 [177.05422974 181.87004089]
501 [184.40113831 195.35775757]
502 [184.00386047 210.71150208]
503 [175.96923828 223.80122375]
504 [162.45857239 231.10581970]
505 [147.10614014 230.66041565]
506 [134.04167175 222.58480835]
507 [126.77945709 209.05130005]
508 [127.27298737 193.70034790]
509 [135.38949585 180.66125488]
510 [128.25558472 167.46629333]
511 [121.12166595 154.27131653]
512 [113.98775482 141.07635498]
513 [106.80358124 127.90867615]
514 [99.56925964 114.76848602]
515 [92.32728577 116.71883392]
516 [96.22798157 131.20277405]
517 [92.36414337 145.69659424]
518 [81.74404144 135.10346985]
519 [77.84334564 120.61952972]
520 [70.60137177 122.56987762]
521 [70.94448090 137.56594849]
522 [71.28758240 152.56202698]
523 [71.63069153 167.55810547]
524 [71.97379303 182.55418396]
525 [72.31690216 197.55024719]
526 [72.66000366 212.54632568]
527 [73.00311279 227.54240417]
528 [73.34621429 242.53848267]
529 [73.68932343 257.53454590]
530 [74.03242493 272.53063965]
531 [86.86750793 281.25073242]
532 [92.09406281 295.86111450]
533 [87.70237732 310.74374390]
534 [75.38114166 320.17596436]
535 [59.86812592 320.53088379]
536 ] def
537 /pairs [
538 [3 406]
539 [4 405]
540 [5 404]
541 [6 403]
542 [7 402]
543 [8 401]
544 [9 400]
545 [10 399]
546 [11 398]
547 [12 397]
548 [13 396]
549 [14 237]
550 [15 236]
551 [16 235]
552 [17 234]
553 [18 68]
554 [19 67]
555 [20 66]
556 [21 65]
557 [23 53]
558 [24 52]
559 [25 51]
560 [26 50]
561 [27 49]
562 [28 48]
563 [29 46]
564 [30 45]
565 [31 44]
566 [32 43]
567 [33 42]
568 [34 41]
569 [35 40]
570 [55 63]
571 [56 62]
572 [72 89]
573 [73 88]
574 [74 87]
575 [75 86]
576 [76 85]
577 [77 84]
578 [91 228]
579 [92 227]
580 [93 226]
581 [94 225]
582 [95 224]
583 [96 223]
584 [98 198]
585 [99 197]
586 [100 196]
587 [101 114]
588 [102 113]
589 [103 112]
590 [104 111]
591 [105 110]
592 [115 187]
593 [116 186]
594 [117 185]
595 [118 184]
596 [119 138]
597 [120 137]
598 [121 136]
599 [122 135]
600 [123 134]
601 [124 133]
602 [125 132]
603 [126 131]
604 [141 179]
605 [142 178]
606 [143 177]
607 [144 176]
608 [145 175]
609 [146 174]
610 [147 173]
611 [152 169]
612 [153 168]
613 [154 167]
614 [155 166]
615 [157 165]
616 [158 164]
617 [159 163]
618 [200 219]
619 [201 218]
620 [202 217]
621 [203 216]
622 [204 215]
623 [205 214]
624 [206 213]
625 [207 212]
626 [238 367]
627 [239 366]
628 [240 365]
629 [241 364]
630 [242 363]
631 [243 362]
632 [244 361]
633 [252 343]
634 [253 342]
635 [254 341]
636 [255 340]
637 [259 336]
638 [260 335]
639 [261 334]
640 [262 333]
641 [263 332]
642 [264 331]
643 [270 300]
644 [271 299]
645 [272 298]
646 [273 297]
647 [274 296]
648 [275 295]
649 [276 294]
650 [280 289]
651 [301 320]
652 [302 319]
653 [303 318]
654 [304 317]
655 [305 316]
656 [306 315]
657 [307 314]
658 [308 313]
659 [349 360]
660 [350 359]
661 [351 358]
662 [352 357]
663 [368 390]
664 [369 389]
665 [371 388]
666 [372 387]
667 [373 386]
668 [374 385]
669 ] def
670
671 init
672
673 % switch off outline pairs or bases by removing these lines
674 drawoutline
675 drawpairs
676 drawbases
677 % show it
678 showpage
679 end
680 %%EOF