Mercurial > repos > rnateam > cofold
view test-data/example1_ss.ps @ 1:4306e2b9ec40 draft
planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/rna_tools/cofold commit edee3afc7d729be9a224d21729bb7490a3761a0e-dirty
| author | rnateam |
|---|---|
| date | Sun, 18 Sep 2016 06:22:52 -0400 |
| parents | 76d9140e8fa5 |
| children |
line wrap: on
line source
%!PS-Adobe-3.0 EPSF-3.0 %%Creator: PS_dot.c,v 1.38 2007/02/02 15:18:13 ivo Exp $, ViennaRNA-2.0.4 %%CreationDate: Mon Jan 12 21:39:30 2015 %%Title: RNA Secondary Structure Plot %%BoundingBox: 66 210 518 662 %%DocumentFonts: Helvetica %%Pages: 1 %%EndComments %Options: -d2 % to switch off outline pairs of sequence comment or % delete the appropriate line near the end of the file %%BeginProlog /RNAplot 100 dict def RNAplot begin /fsize 14 def /outlinecolor {0.2 setgray} bind def /paircolor {0.2 setgray} bind def /seqcolor {0 setgray} bind def /cshow { dup stringwidth pop -2 div fsize -3 div rmoveto show} bind def /min { 2 copy gt { exch } if pop } bind def /max { 2 copy lt { exch } if pop } bind def /arccoords { % i j arccoords % puts optimal x1 y1 x2 y2 coordinates used in bezier curves from i to j % onto the stack dup 3 -1 roll dup 4 -1 roll lt dup dup 5 2 roll {exch} if dup 3 -1 roll dup 3 -1 roll exch sub 1 sub dup 4 -2 roll 5 -1 roll {exch} if 4 2 roll sequence length dup 2 div exch 3 1 roll lt {exch 5 -1 roll pop 4 -2 roll exch 4 2 roll} { 4 2 roll 5 -1 roll dup 6 1 roll {exch} if 4 -2 roll exch pop dup 3 -1 roll dup 4 1 roll exch add 4 -1 roll dup 5 1 roll sub 1 sub 5 -1 roll not {4 -2 roll exch 4 2 roll} if }ifelse % compute the scalingfactor and prepare (1-sf) and sf*r 2 mul exch cpr 3 1 roll div dup 3 -1 roll mul exch 1 exch sub exch % compute the coordinates 3 -1 roll 1 sub coor exch get aload pop % get coord for i 4 -1 roll dup 5 1 roll mul 3 -1 roll dup 4 1 roll add exch % calculate y1 4 -1 roll dup 5 1 roll mul 3 -1 roll dup 4 1 roll add exch % calculate x1 5 -1 roll 1 sub coor exch get aload pop % get coord for j % duplicate j coord dup 3 -1 roll dup 4 1 roll exch 8 2 roll 6 -1 roll dup 7 1 roll mul 5 -1 roll dup 6 1 roll add exch % calculate y2 6 -1 roll mul 5 -1 roll add exch % calculate x2 6 -2 roll % reorder } bind def /drawoutline { gsave outlinecolor newpath coor 0 get aload pop 0.8 0 360 arc % draw 5' circle of 1st sequence currentdict /cutpoint known % check if cutpoint is defined {coor 0 cutpoint getinterval {aload pop lineto} forall % draw outline of 1st sequence coor cutpoint 1 add get aload pop 2 copy moveto 0.8 0 360 arc % draw 5' circle of 2nd sequence coor cutpoint 1 add coor length cutpoint 1 add sub getinterval {aload pop lineto} forall} % draw outline of 2nd sequence {coor {aload pop lineto} forall} % draw outline as a whole ifelse stroke grestore } bind def /drawpairs { paircolor 0.7 setlinewidth [9 3.01] 9 setdash newpath pairs {aload pop currentdict (cpr) known { exch dup coor exch 1 sub get aload pop moveto exch arccoords curveto } { coor exch 1 sub get aload pop moveto coor exch 1 sub get aload pop lineto }ifelse } forall stroke } bind def % draw bases /drawbases { [] 0 setdash seqcolor 0 coor { aload pop moveto dup sequence exch 1 getinterval cshow 1 add } forall pop } bind def /init { /Helvetica findfont fsize scalefont setfont 1 setlinejoin 1 setlinecap 0.8 setlinewidth 72 216 translate % find the coordinate range /xmax -1000 def /xmin 10000 def /ymax -1000 def /ymin 10000 def coor { aload pop dup ymin lt {dup /ymin exch def} if dup ymax gt {/ymax exch def} {pop} ifelse dup xmin lt {dup /xmin exch def} if dup xmax gt {/xmax exch def} {pop} ifelse } forall /size {xmax xmin sub ymax ymin sub max} bind def 72 6 mul size div dup scale size xmin sub xmax sub 2 div size ymin sub ymax sub 2 div translate } bind def end %%EndProlog RNAplot begin % data start here /sequence (\ AUGCAGGAAAUGCGGGUAGCCGCUGCCGCAAUCGUCUCGGCGAUUGGCGGUAGAGGAAAGUCCAGGCUCGCCCAAGCUGAGAUGCUUGGAGUGUUCGUACCUGGCGCAAGCCAGGGCAAGUGAGGCGCAAGCCUCGCUGACGGCGUGGAAAGGGCUCUCUCUGAGGCCCGAGUACGCUGAAAGUGCCACAGAAACGUAGCUUUUCUGGCGACAGAAAAGAUGGAACGCGGUAAACCCUGCGAGCGAGAAACCCAA\ AUUUGGUAGGGGAACCGUCCUGAAGGAAUCAAACGGAAGGGACGGAUGGUAUCUUCGGAUGCCAUAGAUAGAUGGCUACCGCUCUUGGUGCGAGGGAUACGUCCCGCUUGCAGCACGGGAGAGACAGAACCUGGCUUAUAGCAUUUCCUGCUGGAU\ ) def /coor [ [42.06064606 297.00585938] [46.61352158 282.17175293] [59.03635025 272.87374878] [58.69324493 257.87765503] [58.35013962 242.88159180] [58.00703430 227.88551331] [57.66392899 212.88943481] [57.32082748 197.89335632] [56.97772217 182.89727783] [56.63461685 167.90121460] [56.29151154 152.90513611] [55.94840622 137.90905762] [55.60530090 122.91297913] [46.82557678 110.75089264] [32.70000839 105.70427704] [18.57444000 100.65766144] [4.44887257 95.61104584] [-9.94205666 99.84201813] [-19.08859444 111.73070526] [-28.23513222 123.61939240] [-37.38166809 135.50807190] [-29.15162849 152.90130615] [-41.59085464 175.22094727] [-49.80515671 187.77185059] [-58.01945496 200.32276917] [-66.23375702 212.87367249] [-74.44805145 225.42457581] [-82.66235352 237.97549438] [-90.82874298 250.55761719] [-98.94709778 263.17080688] [-107.06545258 275.78396606] [-115.18381500 288.39715576] [-123.30216980 301.01034546] [-131.42053223 313.62350464] [-139.53887939 326.23669434] [-139.78965759 342.63391113] [-154.24520874 350.37789917] [-168.03489685 341.50228882] [-166.97308350 325.13757324] [-152.15206909 318.11834717] [-144.03370667 305.50515747] [-135.91534424 292.89196777] [-127.79698944 280.27880859] [-119.67863464 267.66561890] [-111.56027222 255.05244446] [-103.44191742 242.43927002] [-102.47118378 235.17279053] [-95.21325684 229.76118469] [-86.99896240 217.21028137] [-78.78466034 204.65937805] [-70.57036591 192.10845947] [-62.35606384 179.55755615] [-54.14176559 167.00665283] [-59.68206406 161.95144653] [-76.30296326 146.78584290] [-88.05078125 156.11260986] [-91.30287170 171.82260132] [-105.67762756 178.94621277] [-120.14797974 172.01882935] [-123.61350250 156.35453796] [-113.41574860 143.96966553] [-97.37755585 144.36479187] [-85.62973785 135.03802490] [-66.41344452 121.66181946] [-49.27035522 126.36154175] [-40.12381744 114.47285461] [-30.97727966 102.58416748] [-21.83074188 90.69548035] [-26.24375725 84.63121796] [-41.16038132 86.21054840] [-35.06978607 72.50268555] [-39.48280334 66.43842316] [-53.60836792 71.48503876] [-67.73394012 76.53165436] [-81.85950470 81.57826996] [-95.98506927 86.62489319] [-110.11064148 91.67150879] [-116.64728546 106.06066132] [-131.47320557 111.53492737] [-145.79244995 104.84651947] [-151.10966492 89.96355438] [-144.27023315 75.71582031] [-129.33187866 70.55625916] [-115.15725708 77.54593658] [-101.03168488 72.49932098] [-86.90612030 67.45270538] [-72.78055573 62.40608978] [-58.65498734 57.35947418] [-44.52941895 52.31285477] [-37.56217957 38.52346039] [-26.96384048 30.84691238] [-36.73162842 19.46313858] [-46.49941635 8.07936382] [-56.26720428 -3.30441141] [-66.03498840 -14.68818665] [-75.80278015 -26.07196045] [-98.98574066 -31.25790787] [-103.97647858 -53.77650833] [-115.58070374 -63.28135300] [-127.18492889 -72.78619385] [-141.12904358 -78.31444550] [-156.09373474 -79.34304047] [-171.05842590 -80.37163544] [-186.02311707 -81.40023804] [-200.98780823 -82.42883301] [-215.47293091 -74.74032593] [-229.22850037 -83.66873169] [-228.10395813 -100.02927399] [-213.25614929 -106.99163055] [-199.95921326 -97.39352417] [-184.99452209 -96.36492920] [-170.02983093 -95.33632660] [-155.06513977 -94.30773163] [-140.10044861 -93.27913666] [-134.25469971 -107.09315491] [-145.41206360 -117.11877441] [-156.56942749 -127.14439392] [-167.72680664 -137.17001343] [-180.43200684 -145.14358521] [-194.31199646 -150.83094788] [-208.19197083 -156.51832581] [-222.07194519 -162.20570374] [-235.95191956 -167.89308167] [-249.83189392 -173.58044434] [-263.71188354 -179.26782227] [-277.59185791 -184.95520020] [-293.76089478 -182.21772766] [-304.00628662 -195.02258301] [-297.78839111 -210.19723511] [-281.50369263 -212.13130188] [-271.90447998 -198.83517456] [-258.02450562 -193.14779663] [-244.14453125 -187.46043396] [-230.26455688 -181.77305603] [-216.38456726 -176.08567810] [-202.50459290 -170.39830017] [-188.62461853 -164.71093750] [-174.74464417 -159.02355957] [-170.33161926 -165.08781433] [-161.50559998 -177.21635437] [-157.09257507 -183.28060913] [-166.77328491 -194.73854065] [-176.45397949 -206.19645691] [-186.13467407 -217.65438843] [-195.81538391 -229.11230469] [-205.49607849 -240.57023621] [-215.17678833 -252.02816772] [-228.76481628 -249.99882507] [-241.48760986 -254.89045715] [-250.07904053 -265.33328247] [-252.38992310 -278.54754639] [-247.92489624 -291.08288574] [-257.51794434 -302.61428833] [-267.11099243 -314.14569092] [-276.70404053 -325.67709351] [-284.53216553 -330.22500610] [-286.32586670 -337.33322144] [-295.83071899 -348.93743896] [-305.33557129 -360.54165649] [-320.04965210 -368.96374512] [-316.02999878 -385.43426514] [-299.09036255 -386.13119507] [-293.73135376 -370.04650879] [-284.22650146 -358.44229126] [-274.72164917 -346.83804321] [-265.17263794 -335.27017212] [-255.57958984 -323.73873901] [-245.98654175 -312.20733643] [-236.39349365 -300.67593384] [-220.01821899 -302.26220703] [-205.79644775 -293.66452026] [-199.46578979 -278.11874390] [-203.71885681 -261.70886230] [-194.03816223 -250.25093079] [-184.35745239 -238.79301453] [-174.67675781 -227.33508301] [-164.99606323 -215.87716675] [-155.31535339 -204.41923523] [-145.63465881 -192.96131897] [-141.63436890 -180.67662048] [-141.60919189 -169.09901428] [-144.92291260 -159.34556580] [-150.65541077 -152.25607300] [-157.70118713 -148.32739258] [-146.54380798 -138.30177307] [-135.38644409 -128.27615356] [-124.22907257 -118.25052643] [-113.94187164 -129.16719055] [-99.47093964 -133.11585999] [-85.06471252 -128.93724060] [-74.95267487 -117.85813141] [-72.10356140 -103.13119507] [-77.35384369 -89.08005524] [-89.16210175 -79.82991791] [-104.06160736 -78.09649658] [-117.68008423 -84.39041901] [-106.07585907 -74.88557434] [-94.47164154 -65.38072968] [-92.45198059 -66.40425110] [-90.33458710 -67.20630646] [-89.53431702 -82.18494415] [-88.73405457 -97.16358185] [-87.93378448 -112.14221954] [-87.13351440 -127.12085724] [-86.33324432 -142.09948730] [-85.53297424 -157.07812500] [-84.73271179 -172.05676270] [-92.64122009 -186.42295837] [-83.92362213 -200.31307983] [-67.54782867 -199.43817139] [-60.35985565 -184.69825745] [-69.75407410 -171.25650024] [-70.55434418 -156.27786255] [-71.35460663 -141.29922485] [-72.15487671 -126.32058716] [-72.95514679 -111.34194946] [-73.75541687 -96.36331177] [-74.55567932 -81.38467407] [-75.35594940 -66.40604401] [-67.97018433 -61.46640778] [-63.16696167 -53.83242416] [-61.87234116 -44.77110291] [-64.41900635 -35.83974838] [-54.65121460 -24.45597458] [-44.88342667 -13.07219887] [-35.11563873 -1.68842399] [-25.34785271 9.69535065] [-15.58006573 21.07912636] [-2.12498283 16.75079727] [12.84111309 20.26181984] [24.76665306 31.82793236] [29.40202522 49.07128906] [24.23037720 67.45729828] [9.49548912 81.48547363] [23.62105751 86.53208923] [37.74662399 91.57870483] [51.87219238 96.62532043] [118.20749664 79.33209991] [133.13385010 77.84761047] [148.06022644 76.36312866] [162.98658752 74.87864685] [177.91294861 73.39415741] [192.83930969 71.90967560] [207.76567078 70.42518616] [206.81819153 65.40071869] [207.11807251 59.85226059] [208.82124329 54.08790207] [212.00886536 48.45391846] [216.67895508 43.31697083] [222.74208069 39.04468155] [230.02160645 35.98537064] [238.25845337 34.44812012] [253.02836609 31.83088112] [267.79827881 29.21364403] [282.56817627 26.59640694] [289.42739868 12.80303001] [302.93545532 5.77555704] [317.81539917 8.02305317] [328.39208984 18.47637749] [343.16198730 15.85914040] [357.93188477 13.24190331] [372.70178223 10.62466621] [387.47171021 8.00742912] [402.24160767 5.39019156] [405.42944336 -14.38106346] [416.64169312 -31.34718895] [434.10409546 -42.36170959] [454.85861206 -45.25786591] [475.26364136 -39.27045441] [491.63278198 -25.21584892] [505.63922119 -30.58424950] [519.64562988 -35.95264816] [533.65209961 -41.32104874] [547.65850830 -46.68944931] [561.66497803 -52.05784988] [575.67138672 -57.42624664] [579.85992432 -73.85271454] [592.90319824 -84.41780853] [609.50823975 -85.09050751] [623.08813477 -75.80330658] [626.86700439 -90.85321808] [638.79187012 -100.78182983] [654.27734375 -101.77139282] [667.36901855 -93.44140625] [673.03277588 -78.99491119] [669.09088135 -63.98688126] [657.05902100 -54.18821335] [641.56365967 -53.36669159] [628.56317139 -61.83821106] [626.42895508 -48.70367050] [618.03155518 -38.24233246] [605.46887207 -33.23781967] [591.96435547 -35.08874130] [581.03979492 -43.41981125] [567.03338623 -38.05141068] [553.02691650 -32.68301010] [539.02050781 -27.31461143] [525.01403809 -21.94621086] [511.00759888 -16.57781219] [497.00115967 -11.20941162] [499.56207275 3.57036328] [514.55816650 3.91346860] [529.55426025 4.25657368] [544.55029297 4.59967899] [559.54638672 4.94278431] [574.54248047 5.28588915] [589.53851318 5.62899446] [604.53460693 5.97209978] [618.65295410 -2.37084746] [632.80242920 5.91910172] [632.42736816 22.31395912] [617.91351318 29.94809914] [604.19152832 20.96817589] [589.19543457 20.62507057] [574.19934082 20.28196526] [559.20324707 19.93885994] [544.20721436 19.59575462] [529.21112061 19.25264931] [514.21502686 18.90954399] [499.21896362 18.56643867] [494.37283325 29.36221313] [487.24349976 38.69115067] [478.24191284 46.08493042] [467.87142944 51.18465424] [456.69982910 53.75814056] [445.32806396 53.71020508] [434.35815430 51.08555603] [424.36123657 46.06418991] [415.84774780 38.94970322] [409.24157715 30.15123749] [404.85882568 20.16009521] [390.08892822 22.77733231] [375.31903076 25.39456940] [360.54913330 28.01180840] [345.77923584 30.62904549] [331.00930786 33.24628067] [324.66851807 46.69739151] [311.46685791 53.92097092] [296.36654663 51.96292496] [285.18539429 41.36631012] [270.41549683 43.98354721] [255.64559937 46.60078430] [240.87568665 49.21802521] [238.95297241 56.46737671] [253.93037415 55.64429092] [259.34143066 69.63430786] [247.70822144 79.10365295] [235.10752869 70.96608734] [233.18479919 78.21543884] [244.71621704 87.80849457] [256.24761963 97.40154266] [267.77902222 106.99459076] [284.02386475 109.23905945] [289.95101929 124.52960968] [279.46316528 137.13662720] [263.34930420 134.09109497] [258.18597412 118.52600098] [246.65457153 108.93295288] [235.12315369 99.33989716] [223.59175110 89.74684906] [209.25015259 85.35155487] [194.32379150 86.83603668] [179.39743042 88.32051849] [164.47106934 89.80500793] [149.54470825 91.28948975] [134.61834717 92.77397919] [119.69197845 94.25846100] [112.70944977 107.53416443] [119.94377136 120.67435455] [126.76836395 126.62311554] [127.18272400 133.94242859] [134.31663513 147.13740540] [141.45056152 160.33238220] [148.58447266 173.52734375] [163.93939209 173.87649536] [177.05422974 181.87004089] [184.40113831 195.35775757] [184.00386047 210.71150208] [175.96923828 223.80122375] [162.45857239 231.10581970] [147.10614014 230.66041565] [134.04167175 222.58480835] [126.77945709 209.05130005] [127.27298737 193.70034790] [135.38949585 180.66125488] [128.25558472 167.46629333] [121.12166595 154.27131653] [113.98775482 141.07635498] [106.80358124 127.90867615] [99.56925964 114.76848602] [92.32728577 116.71883392] [96.22798157 131.20277405] [92.36414337 145.69659424] [81.74404144 135.10346985] [77.84334564 120.61952972] [70.60137177 122.56987762] [70.94448090 137.56594849] [71.28758240 152.56202698] [71.63069153 167.55810547] [71.97379303 182.55418396] [72.31690216 197.55024719] [72.66000366 212.54632568] [73.00311279 227.54240417] [73.34621429 242.53848267] [73.68932343 257.53454590] [74.03242493 272.53063965] [86.86750793 281.25073242] [92.09406281 295.86111450] [87.70237732 310.74374390] [75.38114166 320.17596436] [59.86812592 320.53088379] ] def /pairs [ [3 406] [4 405] [5 404] [6 403] [7 402] [8 401] [9 400] [10 399] [11 398] [12 397] [13 396] [14 237] [15 236] [16 235] [17 234] [18 68] [19 67] [20 66] [21 65] [23 53] [24 52] [25 51] [26 50] [27 49] [28 48] [29 46] [30 45] [31 44] [32 43] [33 42] [34 41] [35 40] [55 63] [56 62] [72 89] [73 88] [74 87] [75 86] [76 85] [77 84] [91 228] [92 227] [93 226] [94 225] [95 224] [96 223] [98 198] [99 197] [100 196] [101 114] [102 113] [103 112] [104 111] [105 110] [115 187] [116 186] [117 185] [118 184] [119 138] [120 137] [121 136] [122 135] [123 134] [124 133] [125 132] [126 131] [141 179] [142 178] [143 177] [144 176] [145 175] [146 174] [147 173] [152 169] [153 168] [154 167] [155 166] [157 165] [158 164] [159 163] [200 219] [201 218] [202 217] [203 216] [204 215] [205 214] [206 213] [207 212] [238 367] [239 366] [240 365] [241 364] [242 363] [243 362] [244 361] [252 343] [253 342] [254 341] [255 340] [259 336] [260 335] [261 334] [262 333] [263 332] [264 331] [270 300] [271 299] [272 298] [273 297] [274 296] [275 295] [276 294] [280 289] [301 320] [302 319] [303 318] [304 317] [305 316] [306 315] [307 314] [308 313] [349 360] [350 359] [351 358] [352 357] [368 390] [369 389] [371 388] [372 387] [373 386] [374 385] ] def init % switch off outline pairs or bases by removing these lines drawoutline drawpairs drawbases % show it showpage end %%EOF
