--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/2.cluster.top5.alirna.ps	Sat Oct 27 13:23:06 2018 -0400
@@ -0,0 +1,425 @@
+%!PS-Adobe-3.0 EPSF-3.0
+%%Creator: ViennaRNA-2.3.1
+%%CreationDate: Tue May 30 20:24:21 2017
+%%Title: RNA Secondary Structure Plot
+%%BoundingBox: 0 0 700 700
+%%DocumentFonts: Helvetica
+%%Pages: 1
+%%EndComments
+
+%Options: --noLP 
+% to switch off outline pairs of sequence comment or
+% delete the appropriate line near the end of the file
+
+%%BeginProlog
+/RNAplot 100 dict def
+RNAplot begin
+/fsize  14 def
+/outlinecolor {0.2 setgray} bind def
+/paircolor    {0.2 setgray} bind def
+/seqcolor     {0   setgray} bind def
+/cshow  { dup stringwidth pop -2 div fsize -3 div rmoveto show} bind def
+/min { 2 copy gt { exch } if pop } bind def
+/max { 2 copy lt { exch } if pop } bind def
+/arccoords { % i j arccoords
+  % puts optimal x1 y1 x2 y2 coordinates used in bezier curves from i to j
+  % onto the stack
+  dup 3 -1 roll dup 4 -1 roll lt dup dup 5 2 roll {exch} if
+  dup 3 -1 roll dup 3 -1 roll exch sub 1 sub dup
+  4 -2 roll 5 -1 roll {exch} if 4 2 roll
+  sequence length dup 2 div exch 3 1 roll lt 
+  {exch 5 -1 roll pop 4 -2 roll exch 4 2 roll}
+  { 4 2 roll 5 -1 roll dup 6 1 roll {exch} if
+    4 -2 roll exch pop dup 3 -1 roll dup 4 1 roll
+    exch add 4 -1 roll dup 5 1 roll sub 1 sub
+    5 -1 roll not {4 -2 roll exch 4 2 roll} if
+  }ifelse
+   % compute the scalingfactor and prepare (1-sf) and sf*r
+  2 mul exch cpr 3 1 roll div dup
+  3 -1 roll mul exch 1 exch sub exch
+   % compute the coordinates
+  3 -1 roll 1 sub coor exch get aload pop % get coord for i
+  4 -1 roll dup 5 1 roll mul 3 -1 roll dup 4 1 roll add exch % calculate y1
+  4 -1 roll dup 5 1 roll mul 3 -1 roll dup 4 1 roll add exch % calculate x1
+  5 -1 roll 1 sub coor exch get aload pop % get coord for j
+  % duplicate j coord
+  dup 3 -1 roll dup 4 1 roll exch 8 2 roll
+  6 -1 roll dup 7 1 roll mul 5 -1 roll dup 6 1 roll add exch % calculate y2
+  6 -1 roll mul 5 -1 roll add exch % calculate x2
+  6 -2 roll % reorder
+} bind def
+/drawoutline {
+  gsave outlinecolor newpath
+  coor 0 get aload pop 0.8 0 360 arc % draw 5' circle of 1st sequence
+  currentdict /cutpoint known        % check if cutpoint is defined
+  {coor 0 cutpoint getinterval
+   {aload pop lineto} forall         % draw outline of 1st sequence
+   coor cutpoint 1 add get aload pop
+   2 copy moveto 0.8 0 360 arc       % draw 5' circle of 2nd sequence
+   coor cutpoint 1 add coor length cutpoint 1 add sub getinterval
+   {aload pop lineto} forall}        % draw outline of 2nd sequence
+  {coor {aload pop lineto} forall}   % draw outline as a whole
+  ifelse
+  stroke grestore
+} bind def
+/drawpairs {
+  paircolor
+  0.7 setlinewidth
+  [9 3.01] 9 setdash
+  newpath
+  pairs {aload pop
+      currentdict (cpr) known
+      { exch dup
+        coor  exch 1 sub get aload pop moveto
+        exch arccoords curveto
+      }
+      { coor exch 1 sub get aload pop moveto
+        coor exch 1 sub get aload pop lineto
+      }ifelse
+  } forall
+  stroke
+} bind def
+% draw bases
+/drawbases {
+  [] 0 setdash
+  seqcolor
+  0
+  coor {
+    aload pop moveto
+    dup sequence exch 1 getinterval cshow
+    1 add
+  } forall
+  pop
+} bind def
+
+/init {
+  /Helvetica findfont fsize scalefont setfont
+  1 setlinejoin
+  1 setlinecap
+  0.8 setlinewidth
+  % find the coordinate range
+  /xmax -1000 def /xmin 10000 def
+  /ymax -1000 def /ymin 10000 def
+  coor {
+      aload pop
+      dup ymin lt {dup /ymin exch def} if
+      dup ymax gt {/ymax exch def} {pop} ifelse
+      dup xmin lt {dup /xmin exch def} if
+      dup xmax gt {/xmax exch def} {pop} ifelse
+  } forall
+  /size {xmax xmin sub ymax ymin sub max} bind def
+  /width {xmax xmin sub} bind def
+  /height {ymax ymin sub} bind def
+  10 10 translate
+  680 size 10 add div dup scale
+  size width sub width xmin sub xmax sub add 2 div 5 add
+  size height sub height ymin sub ymax sub add 2 div 5 add
+  translate
+} bind def
+end
+RNAplot begin
+% extra definitions for standard anotations
+/min { 2 copy gt { exch } if pop } bind def
+/BLACK { 0 0 0 } def
+/RED   { 1 0 0 } def
+/GREEN { 0 1 0 } def
+/BLUE  { 0 0 1 } def
+/WHITE { 1 1 1 } def
+/LabelFont { % font size LabelFont
+  exch findfont exch fsize mul scalefont setfont
+} bind def
+/Label { % i dx dy (text) Label
+  % write text at base i plus offset dx, dy
+  4 3 roll 1 sub coor exch get aload pop moveto
+  3 1 roll fsize mul exch fsize mul exch rmoveto
+  show
+} bind def
+/cmark { % i cmark   draw circle around base i
+  newpath 1 sub coor exch get aload pop
+  fsize 2 div 0 360 arc stroke
+} bind def
+/gmark { % i j c gmark
+  % draw basepair i,j with c counter examples in gray
+  gsave
+  3 min [0 0.33 0.66 0.9] exch get setgray
+  1 sub dup coor exch get aload pop moveto
+  sequence exch 1 getinterval cshow
+  1 sub dup coor exch get aload pop moveto
+  sequence exch 1 getinterval cshow
+  grestore
+} bind def
+/segmark { % f i j lw r g b segmark
+  % mark segment [i,j] with outline width lw and color rgb
+  % use omark and Fomark instead
+  gsave
+  setrgbcolor setlinewidth
+  newpath
+  1 sub exch 1 sub dup
+  coor exch get aload pop moveto
+  currentdict (cpr) known
+  {
+    3 -1 roll dup 4 1 roll dup
+    {
+      3 1 roll dup 3 -1 roll dup
+      4 1 roll exch 5 2 roll exch
+    }
+    {
+      3 1 roll exch
+    } ifelse
+    1 exch { coor exch get aload pop lineto } for
+    {
+      dup 3 1 roll 1 add exch 1 add arccoords pop pop
+      4 2 roll 5 -1 roll coor exch get aload pop curveto
+    } if
+  }
+  {
+    exch 1 exch {
+      coor exch get aload pop lineto
+    } for
+  } ifelse
+  { closepath fill } if  stroke
+  grestore
+} bind def
+/omark { % i j lw r g b omark
+  % stroke segment [i..j] with linewidth lw, color rgb
+  false 7 1 roll segmark
+} bind def
+/Fomark { % i j r g b Fomark
+  % fill segment [i..j] with color rgb
+  % should precede drawbases
+  1 4 1 roll true 7 1 roll segmark
+} bind def
+/BFmark{ % i j k l r g b BFmark
+  % fill block between pairs (i,j) and (k,l) with color rgb
+  % should precede drawbases
+  gsave
+  setrgbcolor
+  newpath
+  currentdict (cpr) known
+  {
+    dup 1 sub coor exch get aload pop moveto % move to l
+    dup 1 sub 4 -1 roll dup 5 1 roll 1 sub 1 exch
+    { coor exch get aload pop lineto } for % lines from l to j
+    3 -1 roll 4 -1 roll dup 5 1 roll arccoords curveto % curve from j to i
+    exch dup 4 -1 roll 1 sub exch 1 sub 1 exch
+    { coor exch get aload pop lineto } for % lines from i to k
+    exch arccoords curveto% curve from k to l
+  }
+  {  exch 4 3 roll exch 1 sub exch 1 sub dup
+     coor exch get aload pop moveto
+     exch 1 exch { coor exch get aload pop lineto } for
+     exch 1 sub exch 1 sub dup
+     coor exch get aload pop lineto
+     exch 1 exch { coor exch get aload pop lineto } for
+  } ifelse
+    closepath fill stroke
+   grestore
+} bind def
+/hsb {
+  dup 0.3 mul 1 exch sub sethsbcolor
+} bind def
+/colorpair { % i j hue sat colorpair
+  % draw basepair i,j in color
+  % 1 index 0.00 ne {
+  gsave
+  newpath
+  hsb
+  fsize setlinewidth
+  currentdict (cpr) known
+  {
+    exch dup
+    coor  exch 1 sub get aload pop moveto
+    exch arccoords curveto
+  }
+  { 1 sub coor exch get aload pop moveto
+    1 sub coor exch get aload pop lineto
+  } ifelse
+   stroke
+   grestore
+   % } if
+} bind def
+end
+
+%%EndProlog
+RNAplot begin
+% data start here
+/sequence (\
+ACCAUCCUUUUCUUGGGGUUGCACUACUGUCCAAUGAGCACAUAGUGAGGGCAGUACUGCUAACGCCUACACAACACACCCACAUCAACUAGAGCUUUGC\
+) def
+/coor [
+[102.77672577 319.04476929]
+[90.46199799 310.08557129]
+[82.86160278 296.88882446]
+[81.29235077 281.74096680]
+[86.02611542 267.26647949]
+[96.24275970 255.97311401]
+[110.17218018 249.81752014]
+[110.17218018 234.81752014]
+[110.17218018 219.81752014]
+[110.17218018 204.81752014]
+[99.49130249 194.49984741]
+[99.27762604 179.28770447]
+[110.17218018 168.15458679]
+[110.17218018 153.15458679]
+[110.17218018 138.15458679]
+[106.02764893 123.73851776]
+[98.06128693 111.02880096]
+[89.89822388 98.44451141]
+[81.54043579 85.98868561]
+[73.18265533 73.53286743]
+[64.63217163 61.20853424]
+[55.89105606 49.01866531]
+[47.14994049 36.82879639]
+[32.82023239 30.12281990]
+[31.69130898 15.27105904]
+[22.95019341 3.08119035]
+[14.20907784 -9.10867786]
+[5.46796179 -21.29854774]
+[-3.27315354 -33.48841476]
+[-12.01426888 -45.67828369]
+[-20.75538445 -57.86815262]
+[-29.49650002 -70.05802155]
+[-40.43203354 -69.10051727]
+[-50.66823959 -72.83345032]
+[-58.30468369 -80.49013519]
+[-61.95487976 -90.58245850]
+[-60.99773407 -101.18975830]
+[-55.68206024 -110.32431030]
+[-63.24930573 -123.27563477]
+[-78.33963013 -128.72189331]
+[-83.35356903 -143.96131897]
+[-74.44485474 -157.30351257]
+[-58.44750214 -158.51351929]
+[-47.63329697 -146.66308594]
+[-50.29797745 -130.84288025]
+[-42.73073578 -117.89155579]
+[-23.69388771 -114.56418610]
+[-12.84335899 -98.21372986]
+[-17.30663109 -78.79914093]
+[-8.56551647 -66.60926819]
+[0.17559953 -54.41939926]
+[8.91671467 -42.22953033]
+[17.65783119 -30.03966331]
+[26.39894676 -17.84979439]
+[35.14006042 -5.65992498]
+[43.88117599 6.52994347]
+[57.58565903 12.36401939]
+[59.33980942 28.08768082]
+[68.08092499 40.27754974]
+[76.82203674 52.46741867]
+[83.39369965 56.13331604]
+[85.63847351 65.17508698]
+[93.99625397 77.63090515]
+[102.35404205 90.08672333]
+[109.22463226 94.59117126]
+[110.77100372 103.06243134]
+[118.73737335 115.77215576]
+[120.40499115 100.86514282]
+[126.48009491 87.15043640]
+[136.39979553 75.89878845]
+[149.24496460 68.15272522]
+[163.82543945 64.62996674]
+[178.79025269 65.65692139]
+[192.75280762 71.13842010]
+[204.41941833 80.56658936]
+[212.70909119 93.06784058]
+[216.85374451 107.48386383]
+[216.46936035 122.47894287]
+[211.59153748 136.66368103]
+[202.67224121 148.72378540]
+[190.53790283 157.54182434]
+[176.31283569 162.30076599]
+[161.31506348 162.55963135]
+[146.93423462 158.29446411]
+[134.50280762 149.90045166]
+[125.17218018 138.15458679]
+[125.17218018 153.15458679]
+[125.17218018 168.15458679]
+[136.06672668 179.28770447]
+[135.85304260 194.49984741]
+[125.17218018 204.81752014]
+[125.17218018 219.81752014]
+[125.17218018 234.81752014]
+[125.17218018 249.81752014]
+[139.10159302 255.97311401]
+[149.31823730 267.26647949]
+[154.05200195 281.74096680]
+[152.48275757 296.88882446]
+[144.88235474 310.08557129]
+[132.56762695 319.04476929]
+] def
+/pairs [
+[7 94]
+[8 93]
+[9 92]
+[10 91]
+[13 88]
+[14 87]
+[15 86]
+[16 67]
+[17 66]
+[18 64]
+[19 63]
+[20 62]
+[21 60]
+[22 59]
+[23 58]
+[25 56]
+[26 55]
+[27 54]
+[28 53]
+[29 52]
+[30 51]
+[31 50]
+[32 49]
+[38 46]
+[39 45]
+] def
+
+init
+
+% Start Annotations
+7 94 0.0 0.6 colorpair
+8 93 0.0 1 colorpair
+9 92 0.0 1 colorpair
+10 91 0.0 1 colorpair
+13 88 0.0 1 colorpair
+14 87 0.0 1 colorpair
+15 86 0.0 1 colorpair
+16 67 0.0 1 colorpair
+17 66 0.16 1 colorpair
+18 64 0.0 1 colorpair
+19 63 0.0 1 colorpair
+20 62 0.0 1 colorpair
+21 60 0.0 1 colorpair
+22 59 0.0 1 colorpair
+23 58 0.16 1 colorpair
+25 56 0.0 1 colorpair
+26 55 0.0 1 colorpair
+27 54 0.0 1 colorpair
+28 53 0.0 1 colorpair
+29 52 0.0 1 colorpair
+30 51 0.0 1 colorpair
+31 50 0.0 1 colorpair
+32 49 0.16 1 colorpair
+38 46 0.0 1 colorpair
+39 45 0.32 1 colorpair
+
+% End Annotations
+% switch off outline pairs or bases by removing these lines
+drawoutline
+drawpairs
+drawbases
+% Start Annotations
+7 94 1 gmark
+66 cmark
+23 cmark
+32 cmark
+39 cmark
+45 cmark
+
+% End Annotations
+% show it
+showpage
+end
+%%EOF