Mercurial > repos > rnateam > mirdeep2
view test-data/result.csv @ 3:5cecae70d439 draft
planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mirdeep2/mirdeep2 commit 3103ebed1a420c7d3415b67ef532ea579edf9faa
author | rnateam |
---|---|
date | Wed, 12 Jul 2017 14:37:54 -0400 |
parents | eaac585f172a |
children | 6a17e1229b9f |
line wrap: on
line source
miRDeep2 score novel miRNAs reported by miRDeep2 novel miRNAs, estimated false positives novel miRNAs, estimated true positives known miRNAs in species known miRNAs in data known miRNAs detected by miRDeep2 estimated signal-to-noise excision gearing 10 1 0 +/- 0 1 +/- 0 (83 +/- 38%) 7 6 5 (83%) 6.7 1 9 1 0 +/- 0 1 +/- 0 (83 +/- 38%) 7 6 5 (83%) 6.7 1 8 1 0 +/- 0 1 +/- 0 (83 +/- 38%) 7 6 5 (83%) 6.7 1 7 1 0 +/- 0 1 +/- 0 (83 +/- 38%) 7 6 5 (83%) 6.7 1 6 1 0 +/- 0 1 +/- 0 (83 +/- 38%) 7 6 5 (83%) 6.7 1 5 1 0 +/- 0 1 +/- 0 (71 +/- 46%) 7 6 6 (100%) 4.5 1 4 1 0 +/- 0 1 +/- 0 (71 +/- 46%) 7 6 6 (100%) 4.5 1 3 1 0 +/- 0 1 +/- 0 (71 +/- 46%) 7 6 6 (100%) 4.5 1 2 1 0 +/- 0 1 +/- 0 (71 +/- 46%) 7 6 6 (100%) 4.5 1 1 1 0 +/- 0 1 +/- 0 (68 +/- 47%) 7 6 6 (100%) 4 1 0 1 1 +/- 1 1 +/- 1 (52 +/- 50%) 7 6 6 (100%) 2.2 1 -1 1 1 +/- 1 1 +/- 1 (52 +/- 50%) 7 6 6 (100%) 2.5 1 -2 1 1 +/- 1 0 +/- 0 (15 +/- 36%) 7 6 6 (100%) 1.9 1 -3 1 1 +/- 1 0 +/- 0 (15 +/- 36%) 7 6 6 (100%) 1.9 1 -4 1 1 +/- 1 0 +/- 0 (13 +/- 34%) 7 6 6 (100%) 1.8 1 -5 1 2 +/- 1 0 +/- 0 (6 +/- 24%) 7 6 6 (100%) 1.7 1 -6 1 3 +/- 1 0 +/- 0 (0 +/- 0%) 7 6 6 (100%) 1.5 1 -7 1 3 +/- 1 0 +/- 0 (0 +/- 0%) 7 6 6 (100%) 1.5 1 -8 1 3 +/- 1 0 +/- 0 (0 +/- 0%) 7 6 6 (100%) 1.5 1 -9 1 3 +/- 1 0 +/- 0 (0 +/- 0%) 7 6 6 (100%) 1.5 1 -10 1 3 +/- 1 0 +/- 0 (0 +/- 0%) 7 6 6 (100%) 1.5 1 novel miRNAs predicted by miRDeep2 provisional id miRDeep2 score estimated probability that the miRNA candidate is a true positive rfam alert total read count mature read count loop read count star read count significant randfold p-value miRBase miRNA example miRBase miRNA with the same seed UCSC browser NCBI blastn consensus mature sequence consensus star sequence consensus precursor sequence precursor coordinate chrII:11534525-11540624_7 102170.8 83 +/- 38% - 200394 200381 0 13 yes - cbr-miR-35 - - ucaccggguggaaacuagcagu ugcugguuucuuccacaguggua ugcugguuucuuccacagugguacuuuccauuagaacuaucaccggguggaaacuagcagu chrII:11534525-11540624:3020..3081:+ mature miRBase miRNAs detected by miRDeep2 tag id miRDeep2 score estimated probability that the miRNA is a true positive rfam alert total read count mature read count loop read count star read count significant randfold p-value mature miRBase miRNA example miRBase miRNA with the same seed UCSC browser NCBI blastn consensus mature sequence consensus star sequence consensus precursor sequence precursor coordinate chrII:11534525-11540624_11 61011.7 83 +/- 38% - 119663 119545 0 118 yes cel-miR-37 cbr-miR-35 - - ucaccgggugaacacuugcagu uguggguguccguugcggugcua uguggguguccguugcggugcuacauucucuaaucuguaucaccgggugaacacuugcagu chrII:11534525-11540624:3245..3306:+ chrII:11534525-11540624_17 17007.3 83 +/- 38% - 33350 33300 0 50 yes cel-miR-40 cbr-miR-35 - - ucaccggguguacaucagcuaa aguggauguaugccaugaugaua aguggauguaugccaugaugauaagauaucagaaauccuaucaccggguguacaucagcuaa chrII:11534525-11540624:3590..3652:+ chrII:11534525-11540624_9 7482.8 83 +/- 38% - 14668 14617 0 51 yes cel-miR-36 cbr-miR-35 - - ucaccgggugaaaauucgcaug cgccaauuuucgcuucagugcua cgccaauuuucgcuucagugcuagaccauccaaagugucuaucaccgggugaaaauucgcaug chrII:11534525-11540624:3123..3186:+ chrII:11534525-11540624_15 1978.6 83 +/- 38% - 3872 3014 1 857 yes cel-miR-39 cbr-miR-35 - - ucaccggguguaaaucagcuug agcugauuucgucuugguaaua agcugauuucgucuugguaauaagcucgucauugagauuaucaccggguguaaaucagcuug chrII:11534525-11540624:3494..3556:+ chrII:11534525-11540624_19 84.4 83 +/- 38% - 164 68 9 87 yes cel-miR-41 - - - ggugguuuuucucugcagugaua ucaccgggugaaaaaucaccua ggugguuuuucucugcagugauagauacuucuaacaacucgcuaucaccgggugaaaaaucaccua chrII:11534525-11540624:3715..3781:+ chrII:11534525-11540624_13 5.5 71 +/- 46% - 2140 2132 8 0 yes cel-miR-38 cbr-miR-35 - - ucaccgggagaaaaacuggagu uccgguuuuuuccguggugaua uccgguuuuuuccguggugauaacgcauccaaaagucucuaucaccgggagaaaaacuggagu chrII:11534525-11540624:3340..3403:+ chrII:11534525-11540624_12 -0.2 52 +/- 50% - 119546 119545 1 0 no cel-miR-37 cbr-miR-35 - - ucaccgggugaacacuugcagu uguuccgguuuuuuccguggugaua ucaccgggugaacacuugcagugguccucgugguuucucugugagccagguccuguuccgguuuuuuccguggugaua chrII:11534525-11540624:3284..3362:+ #miRBase miRNAs not detected by miRDeep2 miRBase precursor id total read count mature read count(s) star read count remaining reads UCSC browser NCBI blastn miRBase mature sequence(s) miRBase star sequence(s) miRBase precursor sequence 4000 4000 0 0 - - aaugacacugguuaucuuuuccaucg - cgccggcaaugacacugguuaucuuuuccaucguggaaugccccccauugauuuuuuccccuuuucggggggaaaaaauuggaaacgagaaagguaucgggugucauagccggcg