<tool id="rbc_mirdeep2_mapper" name="MiRDeep2 Mapper" version="2.0.0">
    <macros>
        <macro name="map_params">
            <conditional name="refGenomeSource">
                <param name="genomeSource" type="select" label="Will you select a reference genome from your history or use a built-in index?" help="Map to genome. (-p)">
                    <option value="indexed">Use a built-in index</option>
                    <option value="history">Use one from the history</option>
                </param>
                <when value="indexed">
                    <param name="index" type="select" label="Select a reference genome" help="If your genome of interest is not listed, contact your Galaxy admin.">
                        <options from_data_table="bowtie_indexes">
                        <filter type="sort_by" column="2"/>
                            <validator type="no_options" message="No indexes are available for the selected input dataset"/>
                        </options>
                    </param>
                </when> <!-- build-in -->
                <when value="history">
                    <param name="ownFile" type="data" format="fasta" metadata_name="dbkey" label="Select the reference genome" />
                </when> <!-- history -->
            </conditional> <!-- refGenomeSource -->
            <param name="map_mismatch" type="boolean" truevalue="-q" falsevalue="" checked="false" label="Map with one mismatch in the seed (mapping takes longer)" help="(-q)"/>
            <param name="map_threshold" value="5" type="integer" optional="false" label="A read is allowed to map up to this number of positions in the genome" help="Map threshold. (-r)">
                <validator type="in_range" min="1" message="Minimum value is 1"/>
            </param>
        </macro>
    </macros>
    <description>
<![CDATA[
process and map reads to a reference genome
]]>
    </description>
    <requirements>
        <requirement type="package" version="2.0">mirdeep2_mapper</requirement>
        <requirement type="package" version="0.12.7">bowtie</requirement>
        <requirement type="package" version="5.18.1">perl</requirement>
    </requirements>

    <command>
<![CDATA[

        #if $operation.collapse_map == "collapse_and_map" or $operation.collapse_map == "only_map"
            #if $operation.refGenomeSource.genomeSource == "history"
                bowtie-build $operation.refGenomeSource.ownFile custom_bowtie_indices &&
            #end if
        #end if
        mapper.pl 
    
        $reads
        
        #if $reads.extension.startswith("fasta")
            -c
        #else if $reads.extension.startswith("fastq")
            -e -h
        #end if

        $remove_non_canon
        
        $convert_rna_dna

        #if $clip_adapter.clip == "true"
            -k $clip_adapter.adapter_seq
        #end if

        -l $discard_short_reads

        #if $operation.collapse_map == "collapse_and_map" or $operation.collapse_map == "only_collapse"
            -m -s $output_reads_collapsed
        #end if
        
        #if $operation.collapse_map == "collapse_and_map" or $operation.collapse_map == "only_map"
            -p 
            
            #if $operation.refGenomeSource.genomeSource == "history"
                custom_bowtie_indices
            #else
                $operation.refGenomeSource.index
            #end if

            $operation.map_mismatch

            -r $operation.map_threshold
            
            -t $output_mapping
        #end if

        -v -n
]]>
    </command>
    <stdio>
        <!-- Anything other than zero is an error -->
        <exit_code range="1:" />
        <exit_code range=":-1" />
        <!-- In case the return code has not been set propery check stderr too -->
        <regex match="Error:" />
        <regex match="Exception:" />
    </stdio>
    <inputs>
        <param format="fastq, fasta" name="reads" type="data" optional="false" label="Deep sequencing reads" help="Reads in fastq or fasta format"/>
        <param name="remove_non_canon" type="boolean" truevalue="-j" falsevalue="" checked="false" label="Remove reads with non-standard nucleotides" help="Remove all entries that have a sequence that contains letters other than a,c,g,t,u,n,A,C,G,T,U,N. (-j)"/>
        <param name="convert_rna_dna" type="boolean" truevalue="-i" falsevalue="" checked="false" label="Convert RNA to DNA alphabet (to map against genome)" help="(-i)"/>

        <conditional name="clip_adapter">
            <param name="clip" type="select" label="Clip 3' Adapter Sequence" help="(-k)">
                <option value="false">Don't Clip</option>
                <option value="true">Clip Sequence</option>
            </param>
            <when value="true">
                <param name="adapter_seq" value="" type="text" optional="false" label="Sequence to clip" help="Adapter Sequence can only contain a,c,g,t,u,n,A,C,G,T,U,N">
                    <validator type="regex" message="Adapter can ONLY contain a,c,g,t,u,n,A,C,G,T,U,N">^[ACGTUacgtu]+$</validator>
                </param>
            </when>
            <when value="false"/>
        </conditional>
        
        <param name="discard_short_reads" value="18" type="integer" optional="false" label="Discard reads shorter than this length" help="Set to 0 to keep all reads. (-l)">
            <validator type="in_range" min="0" message="Minimum value is 0"/>
        </param>
        
        <conditional name="operation">
            <param name="collapse_map" type="select" label="Collapse reads and/or Map" help="(-m) and/or (-p)">
                <option value="collapse_and_map">Collapse reads and Map</option>
                <option value="only_map">Map</option>
                <option value="only_collapse">Collapse</option>
            </param>
            <when value="collapse_and_map">
                <expand macro="map_params"/>
            </when>
            <when value="only_map">
                <expand macro="map_params"/>
            </when>
            <when value="only_collapse"/>
        </conditional>
    </inputs>
    <outputs>
        <data format="fasta" name="output_reads_collapsed" label="Collapsed reads of ${tool.name} on ${on_string}">
            <filter>
            (
            operation['collapse_map'] == "collapse_and_map" or
            operation['collapse_map'] == "only_collapse"
            )
            </filter>
        </data>
        <data format="tabular" name="output_mapping" label="Mapping output of ${tool.name} on ${on_string} in ARF format">
            <filter>
            (
            operation['collapse_map'] == "collapse_and_map" or
            operation['collapse_map'] == "only_map"
            )
            </filter>
        </data>
    </outputs>
    <tests>
        <test>
            <param name="reads" value="reads.fa"/>
            <param name="remove_non_canon" value="True"/>
            <param name="clip" value="true"/>
            <param name="adapter_seq" value="TCGTATGCCGTCTTCTGCTTGT"/>
            <param name="discard_short_reads" value="18"/>
            <param name="collapse_map" value="collapse_and_map"/>
            <param name="genomeSource" value="history"/>
            <param name="ownFile" value="cel_cluster.fa"/>
            <output name="output_reads_collapsed">
                <assert_contents>
                    <has_text text=">seq_349713_x268"/>
                    <has_text text="TCACCGGGTGTANATCAGCTAA"/>
                    <has_text text=">seq_354255_x214"/>
                    <has_text text="TAACCGGGTGAACACTTGCAGT"/>
                    <has_text text=">seq_357284_x187"/>
                </assert_contents>
            </output>
            <output name="output_mapping">
                <assert_contents>
                    <has_line_matching expression="^.*22\t1\t22\ttcaccgggtggaaactagcagt\tchrII:11534525-11540624\t22\t3060\t3081.*$"/>
                    <has_line_matching expression="^.*22\t1\t22\ttcaccgggtggaaactagtagt\tchrII:11534525-11540624\t22\t3060\t3081.*$"/>
                    <has_line_matching expression="^.*22\t1\t22\ttcaccgggtgtacatcagcgaa\tchrII:11534525-11540624\t22\t3631\t3652.*$"/>
                    <has_line_matching expression="^.*22\t1\t22\ttcaccgggagaaaaactggtgt\tchrII:11534525-11540624\t22\t3382\t3403.*$"/>
                    <has_line_matching expression="^.*25\t1\t25\ttcaccgggtggaaactagcagtggc\tchrII:11534525-11540624\t25\t3060\t3084.*$"/>
                </assert_contents>
            </output>
        </test>
    </tests>
    <help>
<![CDATA[
**What MiRDeep2 Mapper does**

The mapper module is designed as a tool to process deep sequencing reads and/or map them to the reference genome. 
The module works in sequence space, and can process or map data that is in sequence fasta format. 
A number of the functions of the mapper module are implemented specifically with Solexa/Illumina data in mind.

**Example**

Processing reads and mapping them to a genome.

The -c option designates that the input file is a fasta file. The -j options removes entries with
non-canonical letters (letters other than a,c,g,t,u,n,A,C,G,T,U,N). The -k option clips adapters. The -l option discards reads shorter than 18 nts.
The -m option collapses the reads. The -p option maps the processed reads against the previously indexed genome (cel_cluster). The -s option
designates the name of the output file of processed reads and the -t option designates the name of the output file of the genome mappings. Last,
-v gives verbose output to the screen.

    ``mapper.pl reads.fa -c -j -k TCGTATGCCGTCTTCTGCTTGT  -l 18 -m -p cel_cluster -s reads_collapsed.fa -t reads_collapsed_vs_genome.arf -v``

]]>
    </help>
    <citations>
        <citation type="doi">10.1093/nar/gkr688</citation>
        <citation type="doi">10.1002/0471250953.bi1210s36</citation>
    </citations>
</tool>