miRDeep2

miRBase precursor idClicking this field will display a pdf of the structure and read signature of the miRNA.	total read countthis is the sum of read counts for the mature and star miRNAs.	mature read count(s)this is the number of reads that map to the miRNA hairpin and are contained in the sequence covered by the mature miRNA, including 2 nts upstream and 5 nts downstream. If more than one mature sequence is given this will be a comma separated list. In parenthesis are normalized read counts shown.	star read countthis is the number of reads that map to the miRNA hairpin and are contained in the sequence covered by the star miRNA, including 2 nts upstream and 5 nts downstream. This field is empty unless a reference star miRNA was given as input to quantifier.pl. If more than one mature sequence is given this will be a comman separated list	remaining readsthis is the number of reads that did not map to any of the mature and star sequences	UCSC browserif a species name was input to miRDeep2, then clicking this field will initiate a UCSC blat search of the miRNA precursor sequence against the reference genome.	NCBI blastnclicking this field will initiate a NCBI blastn search of the miRNA precursor sequence against the nr/nt database (non-redundant collection of all NCBI nucleotide sequences).	miRBase mature sequence(s)this is/are the mature miRNA sequence(s) input to quantifier.pl.	miRBase star sequence(s)this is/are the star miRNA sequence(s) input to quantifier.pl. This field is empty unless a reference star miRNA was given as input to quantifier.pl.	miRBase precursor sequencethis is the precursor miRNA sequence input to quantifier.pl.
cel-mir-37	118250	id seq seq(norm) cel-miR-37 118131.00 676208.96	id seq seq(norm) na 0 0	119	-	blast	ucaccgggugaacacuugcagu	-	uucuagaaacccuuggaccaguguggguguccguugcggugcuacauucucuaaucuguaucaccgggugaacacuugcagugguccucgugguuucu
cel-mir-40	32947	id seq seq(norm) cel-miR-40 32878.00 188201.22	id seq seq(norm) na 0 0	69	-	blast	ucaccggguguacaucagcuaa	-	uccuguccgcaccucaguggauguaugccaugaugauaagauaucagaaauccuaucaccggguguacaucagcuaaggugcggguacaggu
cel-mir-36	14535	id seq seq(norm) cel-miR-36 14483.00 82904.02	id seq seq(norm) na 0 0	52	-	blast	ucaccgggugaaaauucgcaug	-	caccgcugucggggaaccgcgccaauuuucgcuucagugcuagaccauccaaagugucuaucaccgggugaaaauucgcauggguccccgacgcgga
cel-mir-229	4000	id seq seq(norm) cel-miR-229 4000.00 22896.92	id seq seq(norm) na 0 0	0	-	blast	aaugacacugguuaucuuuuccaucg	-	cgccggcaaugacacugguuaucuuuuccaucguggaaugccccccauugauuuuuuccccuuuucggggggaaaaaauuggaaacgagaaagguaucgggugucauagccggcg
cel-mir-39	3852	id seq seq(norm) cel-miR-39 2994.00 17138.34	id seq seq(norm) na 0 0	858	-	blast	ucaccggguguaaaucagcuug	-	uauaccgagagcccagcugauuucgucuugguaauaagcucgucauugagauuaucaccggguguaaaucagcuuggcucugguguc
cel-mir-38	2131	id seq seq(norm) cel-miR-38 2123.00 12152.54	id seq seq(norm) na 0 0	8	-	blast	ucaccgggagaaaaacuggagu	-	ucugugagccagguccuguuccgguuuuuuccguggugauaacgcauccaaaagucucuaucaccgggagaaaaacuggaguaggaccugugacucau
cel-mir-41	164	id seq seq(norm) cel-miR-41 87.00 498.01	id seq seq(norm) na 0 0	77	-	blast	ucaccgggugaaaaaucaccua	-	gggucccagagaccuuggugguuuuucucugcagugauagauacuucuaacaacucgcuaucaccgggugaaaaaucaccuaggucuggagccuccu