<tool id="RNAlien" name="RNAlien" version="1.3.6">
  <description>
    Unsupervised covariance model construction from a single input sequence
  </description>
  <requirements>
    <requirement type="package" version="1.3.6">rnalien</requirement>
  </requirements>
  <command detect_errors="aggressive"><![CDATA[
    RNAlien 
      -i '$input_sequence'
      #if $t
          -t $t
      #end if 
      -o `pwd`
      -d outdir
      -c "\${GALAXY_SLOTS:-4}"
      -z $z
      -e $e
      -b $blast_database
      -x=False
      $s
      $f
      $a
      > 'warnings'          
    ]]>
  </command>
  <inputs>
    <param name="input_sequence" type="data" format="fasta" label="Input sequence"/>
    <param argument="-t" type="integer" value=""
           label="NCBI taxonomy id of input organism" optional="true" help="-t"/>
    <param argument="-z" type="float" value="1.0" min="0.1"
           label="Only candidate sequences with a nSCI higher than this value are accepted." help=""/>
    <param argument="-e" type="float" value="0.001" min="0.000000000001"
           label="Evalue cutoff for cmsearch filtering" help=""/>
    <param name="blast_database" type="select" label="Specify name of blast database to use."
           help="Blast databases, e.g. nt, refseq_genomic,..">
            <option value="nt">nt</option>
            <option value="refseq_genomic">refseq_genomic</option>
            <option value="refseq_rna">refseq_rna</option>
            <option value="refseq_representative_genomes">refseq_representative_genomes</option>
    </param>
    <param argument="-a" truevalue="-a" falsevalue="" checked="True" type="boolean"
           label="Filter blast hits by coverage of at least 80%." help=""/>
    <param argument="-s" truevalue="-s" falsevalue="" checked="False" type="boolean"
           label="Only the best blast hit per taxonomic entry is considered." help=""/>
    <param argument="-f" truevalue="-f" falsevalue="" checked="True" type="boolean"
           label="Toggles blast softmasking, meaning exclusion of low complexity (repetative) regions in lookup table." help=""/>
  </inputs>
  <outputs>
    <data format="txt" name="log" from_work_dir="./outdir/Log" label="RNAlien construction summary"/>
    <data format="cm" name="cm" from_work_dir="./outdir/result.cm" label="RNAlien result covariance model"/>
    <data format="stockholm" name="stockholm" from_work_dir="./outdir/result.stockholm" label="RNAlien result stockholm alignment"/>
    <data format="clustal" name="clustal" from_work_dir="./outdir/result.clustal" label="RNAlien result clustal alignment"/>
    <data format="fasta" name="sequences" from_work_dir="./outdir/result.fa" label="RNAlien result sequences"/>
    <data format="txt" name="warnings" from_work_dir="warnings" label="Warnings from tool dependencies"/>
  </outputs>
  <tests>
    <test>
      <param name="input_sequence" value="tcvh4.fa"/>
      <param name="taxonomy_id" value="10239"/>
      <output name="warnings" file="warnings"/>
    </test>
  </tests>
  <help>
    
<![CDATA[
             
**What it does**

RNAlien is a tool for automatic construction of RNAfamily models from a single sequence.

**Input**

Example:

>AJ243001.2

ATACTTACCTGGCACAGGGGATACCACGATCACCAAGGTGGTTCCCCCAAGACGAGGCTC

ACCATTGCACTCCGGTGGCGCTGACCCTTGCAATGACCCCAAATGTGGGTTACTCGGGTG

TGTAATTTCTGTTAGCTGGGGACTGCGTTCGCGCTTTCCCCTT

**Options**
-i 	Path to input fasta file 	
-o 	Path to output directory 	
-t 	NCBI taxonomy ID number of input RNA organism 	
-z  	Only candidate sequences with a nSCI higher than this value are accepted. 	1.0
-e 	Evalue cutoff for cmsearch filtering. 	0.001
-b 	Specify name of blast database to use. 	nt
-a 	Filter blast hits by coverage of at least 80%. 	True
-s 	Only the best blast hit per taxonomic entry is considered. 	False
-f  	Toggles blast softmasking, meaning exclusion of low complexity (repetative) regions in lookup table. 	True
-r 	Restrict search space to taxonomic kingdom (bacteria,archea,eukaryia). 	

**Output**

RNAlien collects potential family members in multiple iterations.

The output of RNAlien consists of a stockholm alignment, a covariance

model and a Log file.

For further questions please refer to the RNAlien Help page.

.. _Userguide: http://nibiru.tbi.univie.ac.at/rnalien/help _.

    ]]>

  </help>
  <citations>
    <citation type="doi">10.1093/nar/gkw558</citation>
  </citations>
</tool>