# HG changeset patch
# User rnateam
# Date 1488910552 18000
# Node ID 368b2ff179fdfe98b2b582af39821253eb9e64d0

planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/rna_tools/rnalien commit 5385435d8f4339d609f69076cc755e0dc2e7bc72

diff -r 000000000000 -r 368b2ff179fd rnalien.xml
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/rnalien.xml	Tue Mar 07 13:15:52 2017 -0500
@@ -0,0 +1,112 @@
+<tool id="RNAlien" name="RNAlien" version="1.3.5">
+  <description>
+    Unsupervised covariance model construction from a single input sequence
+  </description>
+  <requirements>
+    <requirement type="package" version="1.3.5">rnalien</requirement>
+  </requirements>
+  <command detect_errors="aggressive"><![CDATA[
+    RNAlien 
+      -i '$input_sequence'
+      #if $t
+          -t $t
+      #end if 
+      -o `pwd`
+      -d outdir
+      -c "\${GALAXY_SLOTS:-4}"
+      -z $z
+      -e $e
+      -b $blast_database
+      $s
+      $f
+      $a
+      > 'warnings'          
+    ]]>
+  </command>
+  <inputs>
+    <param name="input_sequence" type="data" format="fasta" label="Input sequence"/>
+    <param argument="-t" type="integer" value=""
+           label="NCBI taxonomy id of input organism" optional="true" help="-t"/>
+    <param argument="-z" type="float" value="1.0" min="0.1"
+           label="Only candidate sequences with a nSCI higher than this value are accepted." help=""/>
+    <param argument="-e" type="float" value="0.001" min="0.000000000001"
+           label="Evalue cutoff for cmsearch filtering" help=""/>
+    <param name="blast_database" type="select" label="Specify name of blast database to use."
+           help="Blast databases, e.g. nt, refseq_genomic,..">
+            <option value="nt">nt</option>
+            <option value="refseq_genomic">refseq_genomic</option>
+            <option value="refseq_rna">refseq_rna</option>
+            <option value="refseq_representative_genomes">refseq_representative_genomes</option>
+    </param>
+    <param argument="-a" truevalue="-a" falsevalue="" checked="True" type="boolean"
+           label="Filter blast hits by coverage of at least 80%." help=""/>
+    <param argument="-s" truevalue="-s" falsevalue="" checked="False" type="boolean"
+           label="Only the best blast hit per taxonomic entry is considered." help=""/>
+    <param argument="-f" truevalue="-f" falsevalue="" checked="True" type="boolean"
+           label="Toggles blast softmasking, meaning exclusion of low complexity (repetative) regions in lookup table." help=""/>
+  </inputs>
+  <outputs>
+    <data format="txt" name="log" from_work_dir="./outdir/Log" label="RNAlien construction summary"/>
+    <data format="cm" name="cm" from_work_dir="./outdir/result.cm" label="RNAlien result covariance model"/>
+    <data format="stockholm" name="stockholm" from_work_dir="./outdir/result.stockholm" label="RNAlien result stockholm alignment"/>
+    <data format="fasta" name="sequences" from_work_dir="./outdir/result.fa" label="RNAlien result sequences"/>
+    <data format="txt" name="warnings" from_work_dir="warnings" label="Warnings from tool dependencies"/>
+  </outputs>
+  <tests>
+    <test>
+      <param name="input_sequence" value="tcvh4.fa"/>
+      <param name="taxonomy_id" value="10239"/>
+      <output name="warnings" file="warnings"/>
+    </test>
+  </tests>
+  <help>
+    
+<![CDATA[
+             
+**What it does**
+
+RNAlien is a tool for automatic construction of RNAfamily models from a single sequence.
+
+**Input**
+
+Example:
+
+>AJ243001.2
+
+ATACTTACCTGGCACAGGGGATACCACGATCACCAAGGTGGTTCCCCCAAGACGAGGCTC
+
+ACCATTGCACTCCGGTGGCGCTGACCCTTGCAATGACCCCAAATGTGGGTTACTCGGGTG
+
+TGTAATTTCTGTTAGCTGGGGACTGCGTTCGCGCTTTCCCCTT
+
+**Options**
+-i 	Path to input fasta file 	
+-o 	Path to output directory 	
+-t 	NCBI taxonomy ID number of input RNA organism 	
+-z  	Only candidate sequences with a nSCI higher than this value are accepted. 	1.0
+-e 	Evalue cutoff for cmsearch filtering. 	0.001
+-b 	Specify name of blast database to use. 	nt
+-a 	Filter blast hits by coverage of at least 80%. 	True
+-s 	Only the best blast hit per taxonomic entry is considered. 	False
+-f  	Toggles blast softmasking, meaning exclusion of low complexity (repetative) regions in lookup table. 	True
+-r 	Restrict search space to taxonomic kingdom (bacteria,archea,eukaryia). 	
+
+**Output**
+
+RNAlien collects potential family members in multiple iterations.
+
+The output of RNAlien consists of a stockholm alignment, a covariance
+
+model and a Log file.
+
+For further questions please refer to the RNAlien Help page.
+
+.. _Userguide: http://nibiru.tbi.univie.ac.at/rnalien/help _.
+
+    ]]>
+
+  </help>
+  <citations>
+    <citation type="doi">10.1093/nar/gkw558</citation>
+  </citations>
+</tool>
diff -r 000000000000 -r 368b2ff179fd test-data/tcvh4.fa
diff -r 000000000000 -r 368b2ff179fd test-data/warnings
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/warnings	Tue Mar 07 13:15:52 2017 -0500
@@ -0,0 +1,1 @@
+Error: Input fasta file is empty.