# HG changeset patch
# User rnateam
# Date 1438604306 14400
# Node ID a8ac09e937f3f25089a849dea24a94fd850119ef

planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/rna_tools/sortmerna commit 04cfb5475292e4fd1f7c0ca86d8d0d5e5f886c3d-dirty

diff -r 000000000000 -r a8ac09e937f3 readme.md
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/readme.md	Mon Aug 03 08:18:26 2015 -0400
@@ -0,0 +1,46 @@
+=========
+SortMeRNA
+=========
+
+SortMeRNA, a fast and accurate filtering of ribosomal RNAs in metatranscriptomic data.
+
+For more information, please see http://bioinfo.lifl.fr/RNA/sortmerna/.
+
+
+============
+Installation
+============
+
+It is recommended to install this wrapper via the `Galaxy Tool Shed`.
+
+.. _`Galaxy Tool Shed`:  https://testtoolshed.g2.bx.psu.edu/view/bgruening/sortmerna
+
+
+=======
+History
+=======
+- 0.1: First version of the wrapper from Jean-Frédéric
+- 1.9.0: First version with data tables, new dependency definition, generall restructuring
+
+
+===============================
+Wrapper Licence (MIT/BSD style)
+===============================
+
+Permission to use, copy, modify, and distribute this software and its
+documentation with or without modifications and for any purpose and
+without fee is hereby granted, provided that any copyright notices
+appear in all copies and that both those copyright notices and this
+permission notice appear in supporting documentation, and that the
+names of the contributors or copyright holders not be used in
+advertising or publicity pertaining to distribution of the software
+without specific prior permission.
+
+THE CONTRIBUTORS AND COPYRIGHT HOLDERS OF THIS SOFTWARE DISCLAIM ALL
+WARRANTIES WITH REGARD TO THIS SOFTWARE, INCLUDING ALL IMPLIED
+WARRANTIES OF MERCHANTABILITY AND FITNESS, IN NO EVENT SHALL THE
+CONTRIBUTORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY SPECIAL, INDIRECT
+OR CONSEQUENTIAL DAMAGES OR ANY DAMAGES WHATSOEVER RESULTING FROM LOSS
+OF USE, DATA OR PROFITS, WHETHER IN AN ACTION OF CONTRACT, NEGLIGENCE
+OR OTHER TORTIOUS ACTION, ARISING OUT OF OR IN CONNECTION WITH THE USE
+OR PERFORMANCE OF THIS SOFTWARE.
diff -r 000000000000 -r a8ac09e937f3 sortmerna.py
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/sortmerna.py	Mon Aug 03 08:18:26 2015 -0400
@@ -0,0 +1,72 @@
+#!/usr/bin/env python
+
+"""
+Runs SortMeRNA
+"""
+
+import subprocess
+import optparse
+import shlex
+
+
+def main():
+    """Parse the command line, exectutes SortMeRNA and buildtrie if neeeded."""
+    #TODO: Put all SortMeRNA options in the command-line parser
+    parser = optparse.OptionParser()
+    parser.add_option('--sortmerna', dest='sortmerna_cmd', help='')
+    parser.add_option('--buildtrie', dest='buildtrie',
+                      default=False, action='store_true', help='')
+    (options, args) = parser.parse_args()
+    if not args:
+        raise Exception('Please provide at least one database')
+
+    if options.buildtrie:
+        buildtrie = 'buildtrie'
+        for database in args:
+            run_buildtrie([buildtrie, '--db', database])
+
+    if options.sortmerna_cmd:
+        sortmerna = 'sortmerna'
+        run_sortmerna([sortmerna] +
+                      shlex.split(options.sortmerna_cmd) +
+                      ['-m', '262144', '-n', str(len(args)), '--db'] +
+                      args)
+
+
+def run_buildtrie(cmd):
+    """Run the BuildTrie program."""
+    try:
+        stdout_arg = subprocess.PIPE
+        stderr_arg = subprocess.PIPE
+        child_process = subprocess.Popen(args=" ".join(cmd), shell=True,
+                                         stdin=None, stdout=stdout_arg,
+                                         stderr=stderr_arg)
+        stdout_str, stderr_str = child_process.communicate()
+        return_code = child_process.returncode
+        if return_code is not 0:
+            raise Exception(stderr_str)
+
+    except Exception, error:
+        raise Exception('Error while running Buildtrie:\n' +
+                        '\n'.join([str(error), stdout_str, stderr_str]))
+
+
+def run_sortmerna(cmd):
+    """Run the SortMeRNA program."""
+    try:
+        stdout_arg = subprocess.PIPE
+        stderr_arg = subprocess.PIPE
+        child_process = subprocess.Popen(args=" ".join(cmd), shell=True,
+                                         stdin=None, stdout=stdout_arg,
+                                         stderr=stderr_arg)
+        stdout_str, stderr_str = child_process.communicate()
+        return_code = child_process.returncode
+        if return_code is not 0:
+            raise Exception(stderr_str)
+    except Exception, error:
+        raise Exception('Error while running SortMeRNA:\n' +
+                        '\n'.join([str(error), stdout_str, stderr_str]))
+
+
+if __name__ == "__main__":
+    main()
diff -r 000000000000 -r a8ac09e937f3 sortmerna.xml
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/sortmerna.xml	Mon Aug 03 08:18:26 2015 -0400
@@ -0,0 +1,238 @@
+<tool id="bg_sortmerna" name="Filter with SortMeRNA" version="1.9.0">
+    <description>Fast and accurate filtering of ribosomal RNAs in metatranscriptomic data</description>
+    <requirements>
+        <requirement type='package' version="1.9">sortmerna</requirement>
+    </requirements>
+    <stdio>
+        <regex match="This program builds a Burst trie on an input rRNA database"
+            source="both"
+            level="fatal"
+            description="Buildtrie program failed to execute." />
+        <regex match="The database name"
+            source="both"
+            level="fatal"
+            description="The database ${databases} has not been preprocessed using buildtrie before using SortMeRNA." />
+    </stdio>
+    <version_command>
+<![CDATA[
+sortmerna --version 2>&1|grep 'SortMeRNA version'
+]]>
+    </version_command>
+    <command interpreter="python">
+<![CDATA[
+    sortmerna.py
+    --sortmerna "
+        $strand_search
+        #if str( $read_family.read_family_selector ) == 'other':
+            --I $input_reads -r $read_family.ratio_parameter
+        #else:
+            $read_family.read_family_selector $input_reads
+        #end if
+
+        #if str( $sequencing_type.sequencing_type_selector ) == 'paired':
+            $sequencing_type.paired_type
+        #end if
+
+        #if $outputs_selected:
+            #if 'accept' in $outputs_selected.value:
+                --accept accept_file
+            #end if
+            #if 'other' in $outputs_selected.value:
+                --other other_file
+            #end if
+        #end if
+
+        $log
+        -a \${GALAXY_SLOTS:-4}
+        "
+        #if str( $databases_type.databases_selector ) == 'history':
+            --buildtrie
+            #for $db in $databases_type.input_databases
+                $db.database_name
+            #end for
+        #else:
+            ## databases path is not directly accessible, must match by hand with LOC file contents
+            ${' '.join([dict([(x[0], x[2]) for x in $databases_type.input_databases.input.options.tool_data_table.data])[y]
+                       for y in $databases_type.input_databases.value])}
+        #end if
+]]>
+    </command>
+    <inputs>
+    <conditional name="read_family">
+        <param name="read_family_selector" type="select" format="text" label="Sequencing technology of querying sequences (reads)"
+            help="The Illumina platform is more common for large scale metatranscriptomic projects requiring a high throughput.">
+            <option value="--I">Illumina Solexa</option>
+            <option value="--454">454 Roche</option>
+            <option value="other">Other</option>
+        </param>
+        <when value="other">
+            <param name="ratio_parameter" type="float" value="1" min="0" max="1"
+                label="Ratio parameter (the number of hits on the read / read length)"
+                help="The ratio parameter for SortMeRNA has been set to r=0.25 for Illumina Solexa reads and to r=0.15 for 454 Roche reads.
+                    For other read types, if the sequencing technology produces high quality reads with a low substitution error rate
+                    (0.1 substitutions per 100 bases, such as Illumina), then the ratio parameter can be set to r=[0.23,0.27].
+                    If the sequencing technology has a high indel error rate (1-2 indels per 100 bases, such as 454 or Ion Torrent),
+                    then the ratio parameter can be set to r=[0.13,0.17] (-r)."/>
+        </when>
+    </conditional>
+    <param format="fasta,fastq" name="input_reads" type="data" label="Querying sequences (reads)" help=""/>
+    <conditional name="sequencing_type">
+        <param name="sequencing_type_selector" type="select" label="Sequencing type">
+            <option value="not_paired">Reads are not paired</option>
+            <option value="paired">Reads are paired</option>
+        </param>
+        <when value="paired">
+            <param name="paired_type" type="select" display="radio" label="If one read of a pair is accepted and the other not, output both reads"
+                help="SortMeRNA does not use the pairing information for filtering RNA,
+                    however if one read of a pair is accepted and the other is not,
+                    the resulting output may break apart the pair into two separate files.
+                    The purpose of 'Reads are paired' option is to preserve the pairing of the reads.">
+                <option value="--paired-in">to accepted file (--paired-in)</option>
+                <option value="--paired-out">to rejected file (--paired-out)</option>
+            </param>
+        </when>
+    </conditional>
+
+    <param name="strand_search" type="select" label="Which strands to search" display="radio">
+        <option value="">Search both strands</option>
+        <option value="-F">Search only the forward strand (-F)</option>
+        <option value="-R">Search only the reverse-complementary strand (-R)</option>
+    </param>
+
+    <conditional name="databases_type">
+        <param name="databases_selector" type="select" label="Databases to query"
+            help="Public rRNA databases provided with SortMeRNA have been indexed.
+                On the contrary, personal databases must be indexed each time SortMeRNA is launched.
+                Please be patient, this may take some time depending on the size of the given database.">
+            <option value="cached" selected="true">Public ribosomal databases</option>
+            <option value="history">Databases from your history</option>
+        </param>
+        <when value="cached">
+            <param name="input_databases" label="rRNA database" type="select" display="checkboxes" multiple="true">
+                <options from_data_table="rRNA_databases" />
+                <validator type="no_options" message="Select at least one database"/>
+            </param>
+        </when>
+        <when value="history">
+            <repeat name="input_databases" title="Database" min="1">
+                <param name="database_name" type="data" format="fasta" label="rRNA database"
+                    help="Your database will be indexed first, which may take up to several minutes."/>
+            </repeat>
+        </when>
+    </conditional>
+
+    <!-- Outputs -->
+    <param name="outputs_selected" type="select" display="checkboxes" multiple="true" label="Output options">
+        <option value="accept" selected="True">Reads matching to at least one database</option>
+        <option value="other">Reads not found in any database</option>
+    </param>
+    <param name="log" type="boolean" checked="False" truevalue="--log log_file" falsevalue="" label="Statistics file"
+           help="Generates statistics for the rRNA content of reads, as well as rRNA subunit distribution. (--log)">
+    </param>
+
+    </inputs>
+    <outputs>
+        <data format_source="input_reads" name="output_accept" from_work_dir="accept_file.dat"
+            label="Matching reads on ${on_string} (${input_reads.datatype.file_ext})">
+            <filter>outputs_selected and 'accept' in outputs_selected</filter>
+        </data>
+        <data format_source="input_reads" name="output_other" from_work_dir="other_file.dat"
+            label="Reads not found on ${on_string} (${input_reads.datatype.file_ext})">
+            <filter>outputs_selected and 'other' in outputs_selected</filter>
+        </data>
+        <data format="txt" name="output_log" label="${tool.name} statistics (txt)" from_work_dir="log_file.log">
+            <filter>log</filter>
+        </data>
+    </outputs>
+    <tests>
+        <test>
+            <param name="read_family_selector" value="I" />
+            <param name="input_reads" value="sortmerna_wrapper_in1.fastq" />
+            <param name="sequencing_type_selector" value="not_paired" />
+            <param name="strand_search" value="" />
+            <param name="databases_selector" value="cached" />
+            <param name="input_databases" value="rfam-5.8s,rfam-5s" />
+            <param name="outputs_selected" value="accept,other" />
+            <param name="log" value="" />
+            <param name="options_type_selector" value="less" />
+            <output name="output_accept" file="sortmerna_wrapper_accept1.fastq" />
+            <output name="output_other" file="sortmerna_wrapper_other1.fastq" />
+        </test>
+    </tests>
+    <help>
+<![CDATA[
+**What it does**
+
+SortMeRNA_ is a software designed to rapidly filter ribosomal RNA fragments
+from metatransriptomic data produced by next-generation sequencers.
+It is capable of handling large RNA databases and sorting out all fragments
+matching to the database with high accuracy and specificity.
+
+.. _SortMeRNA: http://bioinfo.lifl.fr/RNA/sortmerna/
+
+
+**Input**
+
+The input is one file of reads in FASTA or FASTQ format and any number of rRNA databases to search against.
+If the user has two foward-reverse paired-sequencing reads files, they may use
+the script "merge_paired_reads.sh" to interleave the reads into one file, preserving their order.
+
+If the sequencing type for the reads is paired-ended, the user has two options under
+"Sequencing type" to filter the reads and preserve their order in the file.
+For a further example of each option, please refer to Section 4.2.3 in the `SortMeRNA User Manual`_.
+
+.. _sortmerna user manual: http://bioinfo.lifl.fr/RNA/sortmerna/code/SortMeRNA-user-manual-v1.7.pdf
+
+
+**Output**
+
+The output will follow the same format (FASTA or FASTQ) as the reads. Optionally, a statistic file for the rRNA content of reads, as well as rRNA subunit distribution can be generated.
+
+
+**rRNA databases**
+
+SortMeRNA is distributed with 8 representative rRNA databases, which were
+all constructed from the SILVA SSU,LSU (version 111) and the RFAM 5/5.8S
+(version 11.0) databases using the tool UCLUST.
+
++--------------------------+------+-------------+-------------------+------------------------+-------------------+
+| Representative database  | id % | average id% | # seq (clustered) | Origin                 |  # seq (original) |
++==========================+======+=============+===================+========================+===================+
+| SILVA 16S bacteria       |   85 |        91.6 |              8174 | SILVA SSU Ref NR v.111 |            244077 |
++--------------------------+------+-------------+-------------------+------------------------+-------------------+
+| SILVA 16S archaea        |   95 |        96.7 |              3845 | SILVA SSU Ref NR v.111 |             10919 |
++--------------------------+------+-------------+-------------------+------------------------+-------------------+
+| SILVA 18S eukarya        |   95 |        96.7 |              4512 | SILVA SSU Ref NR v.111 |             31862 |
++--------------------------+------+-------------+-------------------+------------------------+-------------------+
+| SILVA 23S bacteria       |   98 |        99.4 |              3055 | SILVA LSU Ref v.111    |             19580 |
++--------------------------+------+-------------+-------------------+------------------------+-------------------+
+| SILVA 23s archaea        |   98 |        99.5 |               164 | SILVA LSU Ref v.111    |               405 |
++--------------------------+------+-------------+-------------------+------------------------+-------------------+
+| SILVA 28S eukarya        |   98 |        99.1 |              4578 | SILVA LSU Ref v.111    |              9321 |
++--------------------------+------+-------------+-------------------+------------------------+-------------------+
+| Rfam 5S archaea/bacteria |   98 |        99.2 |             59513 | RFAM                   |            116760 |
++--------------------------+------+-------------+-------------------+------------------------+-------------------+
+| Rfam 5.8S eukarya        |   98 |        98.9 |             13034 | RFAM                   |            225185 |
++--------------------------+------+-------------+-------------------+------------------------+-------------------+
+
+id %: members of the cluster must have identity at least 'id %' identity with the representative sequence
+
+average id %: average identity of a cluster member to the representative sequence
+
+The user may also choose to use their own rRNA databases.
+
+.. class:: warningmark
+
+Note that your personal databases are indexed each time, and that
+this may take some time depending on the size of the given database.
+]]>
+    </help>
+
+    <citations>
+        <citation type="doi">10.1093/bioinformatics/bts611</citation>
+        <citation type="doi">10.1093/nar/gks1219</citation>
+        <citation type="doi">10.1093/nar/gks1005</citation>
+        <citation type="doi">10.1093/bioinformatics/btq461</citation>
+        <citation type="doi">10.1038/nbt.2198</citation>
+    </citations>
+</tool>
diff -r 000000000000 -r a8ac09e937f3 test-data/merged-paired-reads_output.fastq
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/merged-paired-reads_output.fastq	Mon Aug 03 08:18:26 2015 -0400
@@ -0,0 +1,50 @@
+@PHOSPHORE_0118:4:1101:5073:2473#ATCACG/1
+CTCGCGCCACTGGCTGGCTCTCCCCTCTCTCTCTCTCTCTCCCCTCTCTCTCCCCGAGTACACCCGCGCGGGC
++PHOSPHORE_0118:4:1101:5073:2473#ATCACG/1
+___cccccggggghhhhf_YbcgecZYa^Y^ceXccacXIXaafX`_]VMHVbdhSTFKU_Z]b]WFW_aZ__
+@PHOSPHORE_0118:4:1101:1143:2236#ATCACG/1
+CGCGCGCACCATGCCCGTGCTCGACTGCTCGCCGCCCGCGCCGCGCCACGCCTCGCCGTTCACCTTGACCTCCACGCGCAGGCC
++PHOSPHORE_0118:4:1101:1143:2236#ATCACG/1
+__beeeecggcgfhhhhhhhhhhfhhhhhhhhhhhgececcccccccacaccccaccccac`bbbcbbbcbbc[`_a[aLT[aa
+@PHOSPHORE_0118:4:1101:17780:2432#ATCACG/1
+GCGGTCTGGAACCACCTGATCCCATCCCGAACTCAGCCGTGAAACAGACCAGCGCCGATGGTAGTGTGGCTTCTGCCCGT
++PHOSPHORE_0118:4:1101:17780:2432#ATCACG/1
+bbbeeeeegggggiiiiiiihiiihiiiiiiihiidhhigfhihiihgiiiiiggeccaccbbb_b`baccab`]_ba[T
+@PHOSPHORE_0118:4:1101:1397:2156#ATCACG/1
+ATGCGCTTGAGGTAGCCAAGGGCACGCAGTTCACACCGTATGGCGGCGATGCGAGGCGGCGGCAGGAGG
++PHOSPHORE_0118:4:1101:1397:2156#ATCACG/1
+bbbeeeeegggggiiiiiiiiihfhiheghihgihiiihiiiiihifc^acac^_cEHVZaccaac^__
+@PHOSPHORE_0118:4:1101:7859:3729#ATCACG/1
+GCATCGCCGCCCTCGCCCTCGCCCCCGCCGCCCTCGCCCT
++PHOSPHORE_0118:4:1101:7859:3729#ATCACG/1
+___c`cc`Yeee[ePY_`UY^_eGL_F_`dUU\F\^Q\a_
+@PHOSPHORE_0118:4:1101:1633:2146#ATCACG/1
+TGACCAATGTTCTTCATAACGTCCCCGATAGACATGCCAACATTCGGTCCGTTGCGAAGATAGTCATCGCCGTCATAGTC
++PHOSPHORE_0118:4:1101:1633:2146#ATCACG/1
+_bbecdecgggggihhiiiihghhhiihiichdfghiffghfghiifiifhhhiiggaaaddddbdd`bccaQ\a`bc_b
+@PHOSPHORE_0118:4:1101:7007:4197#ATCACG/1
+CCCCACTCACCACGCACGGCACCGCACGGCACTCTCACGGTTTCTCTCTCTCTCTCCCATCCTTCTCACTCCTTTCTCTCTCTCCCTATCTCTCTCTCTC
++PHOSPHORE_0118:4:1101:7007:4197#ATCACG/1
+bbbeeeeeggggghiiiiihfhifhhiihiagfhiiiiig^dceeeedcddddcccccRZ``bbcbcbbR_bb`b`bb`bbb`bbcbR]b_]]`bb_b_b
+@PHOSPHORE_0118:4:1101:1719:2154#ATCACG/1
+GCATGCCAAACGTGGAGGCGGTGGGCGCGACGCCGGTGGGGAACTTGGACTTGTACATGGCCGGCCGCTGCGTCACCATCGA
++PHOSPHORE_0118:4:1101:1719:2154#ATCACG/1
+bbbeeeeeggggegifhiiii^fgh\edgffeeccc\acccWV_ccccbccccbbdccccccccaaacaZ]acaa^bccccb
+@PHOSPHORE_0118:4:1101:7113:4916#ATCACG/1
+AGCCTGACGATAACCTACTTTCACACTGGTTGCAGCACTATCATCGGCGCAAAGTCGTTTCACGGTCCTGTTCGGGATGGGAAGGGGTGGGACCGACTTGC
++PHOSPHORE_0118:4:1101:7113:4916#ATCACG/1
+bbbeeeeegggggiiiiiiiiiihiiiiigiiiiiiiiiiiiiiiiiiiihiiggggeeeeddccccccccccccccccccbbccccHXaacccc]acacb
+@PHOSPHORE_0118:4:1101:1730:2193#ATCACG/1
+GTTCGATTAGTCTTTCGCCCCTATACCCAAATTTGACGATCGATTTGCACGTCAGAATCGCTAC
++PHOSPHORE_0118:4:1101:1730:2193#ATCACG/1
+baaeeeeeggggghhifhiiihfgbghhhiihihfhihfhihdfghhiiifhiihdbfgddged
+@PHOSPHORE_0118:4:1101:11597:5204#ATCACG/1
+GCCGAAGAAGGACGTGGGAATCTGCGATAAGCCTGGTGGAGTCGATAACCGGACGTTGAGACCAGGATTTCCGAATGGGGAAACCCCGCACGACGTGTCGT
++PHOSPHORE_0118:4:1101:11597:5204#ATCACG/1
+bbbeeeeegggggifgiiiiiiiiiihiihiiiiiicfhgheghiiihihggcecccccccccccccccccccccccccccaacccaccc__[_a[a^[_Q
+
+@PHOSPHORE_0118:4:1101:13427:6518#ATCACG/1
+GCGCTCGAGGAGGACGTGGCGCCCGAGGCTGCCGAGGCTG
++PHOSPHORE_0118:4:1101:13427:6518#ATCACG/1
+Z__cccc`ecg^_fe^[^^^Y_ffc]_`[eZ_c_W\]]b`
+
diff -r 000000000000 -r a8ac09e937f3 test-data/sortmerna_wrapper_accept1.fastq
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/sortmerna_wrapper_accept1.fastq	Mon Aug 03 08:18:26 2015 -0400
@@ -0,0 +1,28 @@
+@PHOSPHORE_0118:4:1101:5073:2473#ATCACG/1
+CTCGCGCCACTGGCTGGCTCTCCCCTCTCTCTCTCTCTCTCCCCTCTCTCTCCCCGAGTACACCCGCGCGGGC
++PHOSPHORE_0118:4:1101:5073:2473#ATCACG/1
+___cccccggggghhhhf_YbcgecZYa^Y^ceXccacXIXaafX`_]VMHVbdhSTFKU_Z]b]WFW_aZ__
+@PHOSPHORE_0118:4:1101:17780:2432#ATCACG/1
+GCGGTCTGGAACCACCTGATCCCATCCCGAACTCAGCCGTGAAACAGACCAGCGCCGATGGTAGTGTGGCTTCTGCCCGT
++PHOSPHORE_0118:4:1101:17780:2432#ATCACG/1
+bbbeeeeegggggiiiiiiihiiihiiiiiiihiidhhigfhihiihgiiiiiggeccaccbbb_b`baccab`]_ba[T
+@PHOSPHORE_0118:4:1101:7859:3729#ATCACG/1
+GCATCGCCGCCCTCGCCCTCGCCCCCGCCGCCCTCGCCCT
++PHOSPHORE_0118:4:1101:7859:3729#ATCACG/1
+___c`cc`Yeee[ePY_`UY^_eGL_F_`dUU\F\^Q\a_
+@PHOSPHORE_0118:4:1101:7007:4197#ATCACG/1
+CCCCACTCACCACGCACGGCACCGCACGGCACTCTCACGGTTTCTCTCTCTCTCTCCCATCCTTCTCACTCCTTTCTCTCTCTCCCTATCTCTCTCTCTC
++PHOSPHORE_0118:4:1101:7007:4197#ATCACG/1
+bbbeeeeeggggghiiiiihfhifhhiihiagfhiiiiig^dceeeedcddddcccccRZ``bbcbcbbR_bb`b`bb`bbb`bbcbR]b_]]`bb_b_b
+@PHOSPHORE_0118:4:1101:7113:4916#ATCACG/1
+AGCCTGACGATAACCTACTTTCACACTGGTTGCAGCACTATCATCGGCGCAAAGTCGTTTCACGGTCCTGTTCGGGATGGGAAGGGGTGGGACCGACTTGC
++PHOSPHORE_0118:4:1101:7113:4916#ATCACG/1
+bbbeeeeegggggiiiiiiiiiihiiiiigiiiiiiiiiiiiiiiiiiiihiiggggeeeeddccccccccccccccccccbbccccHXaacccc]acacb
+@PHOSPHORE_0118:4:1101:11597:5204#ATCACG/1
+GCCGAAGAAGGACGTGGGAATCTGCGATAAGCCTGGTGGAGTCGATAACCGGACGTTGAGACCAGGATTTCCGAATGGGGAAACCCCGCACGACGTGTCGT
++PHOSPHORE_0118:4:1101:11597:5204#ATCACG/1
+bbbeeeeegggggifgiiiiiiiiiihiihiiiiiicfhgheghiiihihggcecccccccccccccccccccccccccccaacccaccc__[_a[a^[_Q
+@PHOSPHORE_0118:4:1101:13427:6518#ATCACG/1
+GCGCTCGAGGAGGACGTGGCGCCCGAGGCTGCCGAGGCTG
++PHOSPHORE_0118:4:1101:13427:6518#ATCACG/1
+Z__cccc`ecg^_fe^[^^^Y_ffc]_`[eZ_c_W\]]b`
diff -r 000000000000 -r a8ac09e937f3 test-data/sortmerna_wrapper_in1.fastq
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/sortmerna_wrapper_in1.fastq	Mon Aug 03 08:18:26 2015 -0400
@@ -0,0 +1,48 @@
+@PHOSPHORE_0118:4:1101:1143:2236#ATCACG/1
+CGCGCGCACCATGCCCGTGCTCGACTGCTCGCCGCCCGCGCCGCGCCACGCCTCGCCGTTCACCTTGACCTCCACGCGCAGGCC
++PHOSPHORE_0118:4:1101:1143:2236#ATCACG/1
+__beeeecggcgfhhhhhhhhhhfhhhhhhhhhhhgececcccccccacaccccaccccac`bbbcbbbcbbc[`_a[aLT[aa
+@PHOSPHORE_0118:4:1101:1397:2156#ATCACG/1
+ATGCGCTTGAGGTAGCCAAGGGCACGCAGTTCACACCGTATGGCGGCGATGCGAGGCGGCGGCAGGAGG
++PHOSPHORE_0118:4:1101:1397:2156#ATCACG/1
+bbbeeeeegggggiiiiiiiiihfhiheghihgihiiihiiiiihifc^acac^_cEHVZaccaac^__
+@PHOSPHORE_0118:4:1101:5073:2473#ATCACG/1
+CTCGCGCCACTGGCTGGCTCTCCCCTCTCTCTCTCTCTCTCCCCTCTCTCTCCCCGAGTACACCCGCGCGGGC
++PHOSPHORE_0118:4:1101:5073:2473#ATCACG/1
+___cccccggggghhhhf_YbcgecZYa^Y^ceXccacXIXaafX`_]VMHVbdhSTFKU_Z]b]WFW_aZ__
+@PHOSPHORE_0118:4:1101:17780:2432#ATCACG/1
+GCGGTCTGGAACCACCTGATCCCATCCCGAACTCAGCCGTGAAACAGACCAGCGCCGATGGTAGTGTGGCTTCTGCCCGT
++PHOSPHORE_0118:4:1101:17780:2432#ATCACG/1
+bbbeeeeegggggiiiiiiihiiihiiiiiiihiidhhigfhihiihgiiiiiggeccaccbbb_b`baccab`]_ba[T
+@PHOSPHORE_0118:4:1101:7859:3729#ATCACG/1
+GCATCGCCGCCCTCGCCCTCGCCCCCGCCGCCCTCGCCCT
++PHOSPHORE_0118:4:1101:7859:3729#ATCACG/1
+___c`cc`Yeee[ePY_`UY^_eGL_F_`dUU\F\^Q\a_
+@PHOSPHORE_0118:4:1101:1633:2146#ATCACG/1
+TGACCAATGTTCTTCATAACGTCCCCGATAGACATGCCAACATTCGGTCCGTTGCGAAGATAGTCATCGCCGTCATAGTC
++PHOSPHORE_0118:4:1101:1633:2146#ATCACG/1
+_bbecdecgggggihhiiiihghhhiihiichdfghiffghfghiifiifhhhiiggaaaddddbdd`bccaQ\a`bc_b
+@PHOSPHORE_0118:4:1101:1719:2154#ATCACG/1
+GCATGCCAAACGTGGAGGCGGTGGGCGCGACGCCGGTGGGGAACTTGGACTTGTACATGGCCGGCCGCTGCGTCACCATCGA
++PHOSPHORE_0118:4:1101:1719:2154#ATCACG/1
+bbbeeeeeggggegifhiiii^fgh\edgffeeccc\acccWV_ccccbccccbbdccccccccaaacaZ]acaa^bccccb
+@PHOSPHORE_0118:4:1101:7007:4197#ATCACG/1
+CCCCACTCACCACGCACGGCACCGCACGGCACTCTCACGGTTTCTCTCTCTCTCTCCCATCCTTCTCACTCCTTTCTCTCTCTCCCTATCTCTCTCTCTC
++PHOSPHORE_0118:4:1101:7007:4197#ATCACG/1
+bbbeeeeeggggghiiiiihfhifhhiihiagfhiiiiig^dceeeedcddddcccccRZ``bbcbcbbR_bb`b`bb`bbb`bbcbR]b_]]`bb_b_b
+@PHOSPHORE_0118:4:1101:7113:4916#ATCACG/1
+AGCCTGACGATAACCTACTTTCACACTGGTTGCAGCACTATCATCGGCGCAAAGTCGTTTCACGGTCCTGTTCGGGATGGGAAGGGGTGGGACCGACTTGC
++PHOSPHORE_0118:4:1101:7113:4916#ATCACG/1
+bbbeeeeegggggiiiiiiiiiihiiiiigiiiiiiiiiiiiiiiiiiiihiiggggeeeeddccccccccccccccccccbbccccHXaacccc]acacb
+@PHOSPHORE_0118:4:1101:11597:5204#ATCACG/1
+GCCGAAGAAGGACGTGGGAATCTGCGATAAGCCTGGTGGAGTCGATAACCGGACGTTGAGACCAGGATTTCCGAATGGGGAAACCCCGCACGACGTGTCGT
++PHOSPHORE_0118:4:1101:11597:5204#ATCACG/1
+bbbeeeeegggggifgiiiiiiiiiihiihiiiiiicfhgheghiiihihggcecccccccccccccccccccccccccccaacccaccc__[_a[a^[_Q
+@PHOSPHORE_0118:4:1101:1730:2193#ATCACG/1
+GTTCGATTAGTCTTTCGCCCCTATACCCAAATTTGACGATCGATTTGCACGTCAGAATCGCTAC
++PHOSPHORE_0118:4:1101:1730:2193#ATCACG/1
+baaeeeeeggggghhifhiiihfgbghhhiihihfhihfhihdfghhiiifhiihdbfgddged
+@PHOSPHORE_0118:4:1101:13427:6518#ATCACG/1
+GCGCTCGAGGAGGACGTGGCGCCCGAGGCTGCCGAGGCTG
++PHOSPHORE_0118:4:1101:13427:6518#ATCACG/1
+Z__cccc`ecg^_fe^[^^^Y_ffc]_`[eZ_c_W\]]b`
diff -r 000000000000 -r a8ac09e937f3 test-data/sortmerna_wrapper_other1.fastq
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/sortmerna_wrapper_other1.fastq	Mon Aug 03 08:18:26 2015 -0400
@@ -0,0 +1,20 @@
+@PHOSPHORE_0118:4:1101:1143:2236#ATCACG/1
+CGCGCGCACCATGCCCGTGCTCGACTGCTCGCCGCCCGCGCCGCGCCACGCCTCGCCGTTCACCTTGACCTCCACGCGCAGGCC
++PHOSPHORE_0118:4:1101:1143:2236#ATCACG/1
+__beeeecggcgfhhhhhhhhhhfhhhhhhhhhhhgececcccccccacaccccaccccac`bbbcbbbcbbc[`_a[aLT[aa
+@PHOSPHORE_0118:4:1101:1397:2156#ATCACG/1
+ATGCGCTTGAGGTAGCCAAGGGCACGCAGTTCACACCGTATGGCGGCGATGCGAGGCGGCGGCAGGAGG
++PHOSPHORE_0118:4:1101:1397:2156#ATCACG/1
+bbbeeeeegggggiiiiiiiiihfhiheghihgihiiihiiiiihifc^acac^_cEHVZaccaac^__
+@PHOSPHORE_0118:4:1101:1633:2146#ATCACG/1
+TGACCAATGTTCTTCATAACGTCCCCGATAGACATGCCAACATTCGGTCCGTTGCGAAGATAGTCATCGCCGTCATAGTC
++PHOSPHORE_0118:4:1101:1633:2146#ATCACG/1
+_bbecdecgggggihhiiiihghhhiihiichdfghiffghfghiifiifhhhiiggaaaddddbdd`bccaQ\a`bc_b
+@PHOSPHORE_0118:4:1101:1719:2154#ATCACG/1
+GCATGCCAAACGTGGAGGCGGTGGGCGCGACGCCGGTGGGGAACTTGGACTTGTACATGGCCGGCCGCTGCGTCACCATCGA
++PHOSPHORE_0118:4:1101:1719:2154#ATCACG/1
+bbbeeeeeggggegifhiiii^fgh\edgffeeccc\acccWV_ccccbccccbbdccccccccaaacaZ]acaa^bccccb
+@PHOSPHORE_0118:4:1101:1730:2193#ATCACG/1
+GTTCGATTAGTCTTTCGCCCCTATACCCAAATTTGACGATCGATTTGCACGTCAGAATCGCTAC
++PHOSPHORE_0118:4:1101:1730:2193#ATCACG/1
+baaeeeeeggggghhifhiiihfgbghhhiihihfhihfhihdfghhiiifhiihdbfgddged
diff -r 000000000000 -r a8ac09e937f3 tool-data/rRNA_databases.loc
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/tool-data/rRNA_databases.loc	Mon Aug 03 08:18:26 2015 -0400
@@ -0,0 +1,8 @@
+rfam-5.8s	Database Rfam 5.8s	$SORTMERNADIR/rRNA_databases/rfam-5.8s-database-id98.fasta
+rfam-5s	Database Rfam 5s	$SORTMERNADIR/rRNA_databases/rfam-5s-database-id98.fasta
+silva-arc-16s	Database Silva-Arc 16s	$SORTMERNADIR/rRNA_databases/silva-arc-16s-database-id95.fasta
+silva-arc-23s	Database Silva-Arc 23s	$SORTMERNADIR/rRNA_databases/silva-arc-23s-database-id98.fasta
+silva-bac-16s	Database Silva-Bac 16s	$SORTMERNADIR/rRNA_databases/silva-bac-16s-database-id85.fasta
+silva-bac-23s	Database Silva-Bac 23s	$SORTMERNADIR/rRNA_databases/silva-bac-23s-database-id98.fasta
+silva-euk-18s	Databse Silva-Euk 18s	$SORTMERNADIR/rRNA_databases/silva-euk-18s-database-id95.fasta
+silva-euk-28s	Database Silva-Euk 28s	$SORTMERNADIR/rRNA_databases/silva-euk-28s-database-id98.fasta
diff -r 000000000000 -r a8ac09e937f3 tool-data/rRNA_databases.loc.sample
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/tool-data/rRNA_databases.loc.sample	Mon Aug 03 08:18:26 2015 -0400
@@ -0,0 +1,26 @@
+#This is a sample file distributed with Galaxy that is used to define a
+#list of public ribosomal databases, using three columns tab separated
+#(longer whitespace are TAB characters):
+#
+#<unique_id>    <database_caption>      <base_name_path>
+#
+#It is important that the actual database name does not have a space in it,
+#and that the first tab that appears in the line is right before the path.
+#
+#So, for example, if your database is rfam-5.8s and the path to your base name
+#is /data/rRNA_databases/rfam-5.8s, then the rRNA_databases.loc entry would look like this:
+#
+#rfam-5.8s          Rfam 5.8S eukarya            /data/rRNA_databases/rfam-5.8s
+#
+#Since SortMeRNA comes bundled with eight ribosomal databases, which are ready
+#for use after the tool installation, this sample file is in fact an actual file
+#to save the user the trouble of setting it.
+#
+rfam-5.8s	Rfam 5.8S eukarya	$SORTMERNADIR/rRNA_databases/rfam-5.8s-database-id98.fasta
+rfam-5s	Rfam 5S archaea/bacteria	$SORTMERNADIR/rRNA_databases/rfam-5s-database-id98.fasta
+silva-arc-16s	SILVA 16S archaea	$SORTMERNADIR/rRNA_databases/silva-arc-16s-database-id95.fasta
+silva-arc-23s	SILVA 16S bacteria	$SORTMERNADIR/rRNA_databases/silva-arc-23s-database-id98.fasta
+silva-bac-16s	SILVA 16S bacteria	$SORTMERNADIR/rRNA_databases/silva-bac-16s-database-id85.fasta
+silva-bac-23s	SILVA 23S bacteria	$SORTMERNADIR/rRNA_databases/silva-bac-23s-database-id98.fasta
+silva-euk-18s	SILVA 18S eukarya	$SORTMERNADIR/rRNA_databases/silva-euk-18s-database-id95.fasta
+silva-euk-28s	SILVA 28S eukarya	$SORTMERNADIR/rRNA_databases/silva-euk-28s-database-id98.fasta
diff -r 000000000000 -r a8ac09e937f3 tool_data_table_conf.xml.sample
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/tool_data_table_conf.xml.sample	Mon Aug 03 08:18:26 2015 -0400
@@ -0,0 +1,7 @@
+<tables>
+    <!-- Locations of public ribosomal databases -->
+    <table name="rRNA_databases" comment_char="#">
+        <columns>value, name, path</columns>
+        <file path="tool-data/rRNA_databases.loc" />
+    </table>
+</tables>
diff -r 000000000000 -r a8ac09e937f3 tool_dependencies.xml
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/tool_dependencies.xml	Mon Aug 03 08:18:26 2015 -0400
@@ -0,0 +1,18 @@
+<?xml version="1.0"?>
+<tool_dependency>
+    <package name="sortmerna" version="1.9">
+        <install version="1.0">
+            <actions>
+                <action type="download_by_url">http://bioinfo.lifl.fr/RNA/sortmerna/code/sortmerna-1.9.tar.gz</action>
+                <action type="autoconf"/>
+                <action type="set_environment">
+                    <environment_variable name="SORTMERNADIR" action="set_to">$INSTALL_DIR</environment_variable>
+                    <environment_variable name="PATH" action="prepend_to">$INSTALL_DIR/bin</environment_variable>
+                </action>
+            </actions>
+        </install>
+        <readme>
+        SortMeRNA requires g++ 4.3 or later. Installation may take a moment since ribosomal databases have to be indexed.
+        </readme>
+    </package>
+</tool_dependency>