comparison test-data/rnaplfold_result1.ps @ 0:4d663689cd7f draft

planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/rna_tools/vienna_rna commit 0065dafe7bbd382bb995b28cc4089c9e4f4eeeb9
author rnateam
date Tue, 06 Dec 2016 12:35:17 -0500
parents
children
comparison
equal deleted inserted replaced
-1:000000000000 0:4d663689cd7f
1 %!PS-Adobe-3.0 EPSF-3.0
2 %%Title: RNA Dot Plot
3 %%Creator: ViennaRNA-2.2.10
4 %%CreationDate: Tue Oct 4 14:45:55 2016
5 %%BoundingBox: 66 530 520 650
6 %%DocumentFonts: Helvetica
7 %%Pages: 1
8 %%EndComments
9
10 %Options:
11 %This file contains the square roots of the base pair probabilities in the form
12 % i j sqrt(p(i,j)) ubox
13
14 %%BeginProlog
15 /DPdict 100 dict def
16 DPdict begin
17 /logscale false def
18 /lpmin 1e-05 log def
19
20 /box { %size x y box - draws box centered on x,y
21 2 index 0.5 mul sub % x -= 0.5
22 exch 2 index 0.5 mul sub exch % y -= 0.5
23 3 -1 roll dup rectfill
24 } bind def
25
26 /ubox {
27 logscale {
28 log dup add lpmin div 1 exch sub dup 0 lt { pop 0 } if
29 } if
30 3 1 roll
31 exch len exch sub 1 add box
32 } bind def
33
34 /lbox {
35 3 1 roll
36 len exch sub 1 add box
37 } bind def
38
39 /drawseq {
40 % print sequence along all 4 sides
41 [ [0.7 -0.3 0 ]
42 [0.7 0.7 len add 0]
43 [-0.3 len sub -0.4 -90]
44 [-0.3 len sub 0.7 len add -90]
45 ] {
46 gsave
47 aload pop rotate translate
48 0 1 len 1 sub {
49 dup 0 moveto
50 sequence exch 1 getinterval
51 show
52 } for
53 grestore
54 } forall
55 } bind def
56
57 /drawgrid{
58 0.01 setlinewidth
59 len log 0.9 sub cvi 10 exch exp % grid spacing
60 dup 1 gt {
61 dup dup 20 div dup 2 array astore exch 40 div setdash
62 } { [0.3 0.7] 0.1 setdash } ifelse
63 0 exch len {
64 dup dup
65 0 moveto
66 len lineto
67 dup
68 len exch sub 0 exch moveto
69 len exch len exch sub lineto
70 stroke
71 } for
72 [] 0 setdash
73 0.04 setlinewidth
74 currentdict /cutpoint known {
75 cutpoint 1 sub
76 dup dup -1 moveto len 1 add lineto
77 len exch sub dup
78 -1 exch moveto len 1 add exch lineto
79 stroke
80 } if
81 0.5 neg dup translate
82 } bind def
83
84 end
85 %%EndProlog
86 DPdict begin
87 %delete next line to get rid of title
88 270 665 moveto /Helvetica findfont 14 scalefont setfont (Anolis_carolinensis_chrUn_GL343590.trna2-A) show
89
90 /sequence { (\
91 UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA\
92 ) } def
93 /winSize 70 def
94 /len { sequence length } bind def
95
96 292 416 translate
97 72 6 mul len 1 add winSize add 2 sqrt mul div dup scale
98 /Helvetica findfont 0.95 scalefont setfont
99
100 /drawseq_turn {% print sequence at bottom
101 gsave
102 len 2 sqrt div dup neg 0.28 add exch 0.78 sub translate
103 0 1 len 1 sub {
104 dup dup 2 sqrt mul 0 moveto
105 sequence exch 1 getinterval
106 show
107 } for
108 grestore
109 } bind def
110 /drawgrid_turn{
111 0.01 setlinewidth
112 len log 0.9 sub cvi 10 exch exp % grid spacing
113 dup 1 gt {
114 dup dup 20 div dup 2 array astore exch 40 div setdash
115 } { [0.3 0.7] 0.1 setdash } ifelse
116 0 exch len { %for (0, gridspacing, len)
117 dup dup %duplicate what - gridspacing??
118 dup len exch sub moveto %moveto diagonal?
119 dup winSize gt
120 {dup dup len exch sub winSize add lineto}
121 {dup len lineto}ifelse
122 dup len exch sub moveto %moveto diagonal?
123 dup len winSize sub le
124 {dup dup len exch sub dup winSize exch sub len add exch lineto}
125 {dup dup len exch sub len exch lineto}ifelse stroke pop pop
126 } for
127 len log 0.9 sub cvi 10 exch exp % grid spacing
128 dup 1 gt {
129 dup dup 20 div dup 2 array astore exch 40 div setdash
130 } { [0.3 0.7] 0.1 setdash } ifelse
131 0 exch len { %for (0, gridspacing, len)
132 dup dup %duplicate what - gridspacing??
133 dup len exch sub moveto %moveto diagonal?
134 len exch sub 0.7 sub exch 0.7 sub exch lineto
135 stroke
136 }for
137 winSize len moveto len winSize lineto stroke
138 [] 0 setdash
139 0.04 setlinewidth
140 currentdict /cutpoint known {
141 cutpoint 1 sub
142 dup dup -1 moveto len 1 add lineto
143 len exch sub dup
144 -1 exch moveto len 1 add exch lineto
145 stroke
146 } if
147 0.5 neg dup translate
148 } bind def
149
150 0.5 dup translate
151 drawseq_turn
152 45 rotate
153
154
155 %draw the grid
156 drawgrid_turn
157
158 %start of base pair probability data
159 2 70 0.1568 ubox
160 2 71 0.9619 ubox
161 3 69 0.1395 ubox
162 3 70 0.7414 ubox
163 3 72 0.8060 ubox
164 4 68 0.1157 ubox
165 4 69 0.6748 ubox
166 4 71 0.4682 ubox
167 5 67 0.1065 ubox
168 5 68 0.6724 ubox
169 5 70 0.3765 ubox
170 6 47 0.1250 ubox
171 6 67 0.6497 ubox
172 7 46 0.1273 ubox
173 7 66 0.6008 ubox
174 8 45 0.1294 ubox
175 8 48 0.2252 ubox
176 9 47 0.2335 ubox
177 10 25 0.7863 ubox
178 11 24 0.7884 ubox
179 11 43 0.5215 ubox
180 11 45 0.2330 ubox
181 12 23 0.7883 ubox
182 12 42 0.5493 ubox
183 12 44 0.2317 ubox
184 13 22 0.7882 ubox
185 13 41 0.5528 ubox
186 13 43 0.2306 ubox
187 14 40 0.5338 ubox
188 15 20 0.1027 ubox
189 16 38 0.5325 ubox
190 16 40 0.1646 ubox
191 17 37 0.5639 ubox
192 17 39 0.1633 ubox
193 18 36 0.5591 ubox
194 18 38 0.1125 ubox
195 19 36 0.2406 ubox
196 20 34 0.5341 ubox
197 20 35 0.2514 ubox
198 21 33 0.4064 ubox
199 22 32 0.2491 ubox
200 22 33 0.4413 ubox
201 23 32 0.5541 ubox
202 24 31 0.6100 ubox
203 25 30 0.6092 ubox
204 26 36 0.2144 ubox
205 27 35 0.2146 ubox
206 27 43 0.7269 ubox
207 28 34 0.2043 ubox
208 28 42 0.7445 ubox
209 29 41 0.7467 ubox
210 30 40 0.7468 ubox
211 31 39 0.7470 ubox
212 38 73 0.3242 ubox
213 39 72 0.3055 ubox
214 40 73 0.1211 ubox
215 41 71 0.2953 ubox
216 41 72 0.1146 ubox
217 42 70 0.2588 ubox
218 43 69 0.2613 ubox
219 43 71 0.2848 ubox
220 44 68 0.2587 ubox
221 44 70 0.3418 ubox
222 45 67 0.2339 ubox
223 45 68 0.1772 ubox
224 45 69 0.3617 ubox
225 45 70 0.1014 ubox
226 45 72 0.3111 ubox
227 46 67 0.2550 ubox
228 46 68 0.3039 ubox
229 46 69 0.1150 ubox
230 46 71 0.2540 ubox
231 47 66 0.2925 ubox
232 48 67 0.1378 ubox
233 49 65 0.9938 ubox
234 50 64 0.9971 ubox
235 51 63 0.9980 ubox
236 52 62 0.9980 ubox
237 53 61 0.9963 ubox
238 54 59 0.1628 ubox
239 55 60 0.1625 ubox
240 showpage
241 end
242 %%EOF