Mercurial > repos > rnateam > viennarna_kinfold

comparison test-data/Anolis_caro_chrUn_GL343590.trna2_AlaAGC_ss.ps @ 7:ef720d386200 draft default tip

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/rna_tools/vienna_rna commit 36681a08c6e44c663169caaefd964781c43d0d29
author rnateam
date Wed, 20 Dec 2017 08:35:35 -0500
parents
children
comparison
equal deleted inserted replaced
6:cbcb91daace8 7:ef720d386200
1 %!PS-Adobe-3.0 EPSF-3.0
2 %%Creator: ViennaRNA-2.2.10
3 %%CreationDate: Tue Dec 19 19:42:58 2017
4 %%Title: RNA Secondary Structure Plot
5 %%BoundingBox: 66 210 518 662
6 %%DocumentFonts: Helvetica
7 %%Pages: 1
8 %%EndComments
9
10 %Options:
11 % to switch off outline pairs of sequence comment or
12 % delete the appropriate line near the end of the file
13
14 %%BeginProlog
15 /RNAplot 100 dict def
16 RNAplot begin
17 /fsize 14 def
18 /outlinecolor {0.2 setgray} bind def
19 /paircolor {0.2 setgray} bind def
20 /seqcolor {0 setgray} bind def
21 /cshow { dup stringwidth pop -2 div fsize -3 div rmoveto show} bind def
22 /min { 2 copy gt { exch } if pop } bind def
23 /max { 2 copy lt { exch } if pop } bind def
24 /arccoords { % i j arccoords
25 % puts optimal x1 y1 x2 y2 coordinates used in bezier curves from i to j
26 % onto the stack
27 dup 3 -1 roll dup 4 -1 roll lt dup dup 5 2 roll {exch} if
28 dup 3 -1 roll dup 3 -1 roll exch sub 1 sub dup
29 4 -2 roll 5 -1 roll {exch} if 4 2 roll
30 sequence length dup 2 div exch 3 1 roll lt
31 {exch 5 -1 roll pop 4 -2 roll exch 4 2 roll}
32 { 4 2 roll 5 -1 roll dup 6 1 roll {exch} if
33 4 -2 roll exch pop dup 3 -1 roll dup 4 1 roll
34 exch add 4 -1 roll dup 5 1 roll sub 1 sub
35 5 -1 roll not {4 -2 roll exch 4 2 roll} if
36 }ifelse
37 % compute the scalingfactor and prepare (1-sf) and sf*r
38 2 mul exch cpr 3 1 roll div dup
39 3 -1 roll mul exch 1 exch sub exch
40 % compute the coordinates
41 3 -1 roll 1 sub coor exch get aload pop % get coord for i
42 4 -1 roll dup 5 1 roll mul 3 -1 roll dup 4 1 roll add exch % calculate y1
43 4 -1 roll dup 5 1 roll mul 3 -1 roll dup 4 1 roll add exch % calculate x1
44 5 -1 roll 1 sub coor exch get aload pop % get coord for j
45 % duplicate j coord
46 dup 3 -1 roll dup 4 1 roll exch 8 2 roll
47 6 -1 roll dup 7 1 roll mul 5 -1 roll dup 6 1 roll add exch % calculate y2
48 6 -1 roll mul 5 -1 roll add exch % calculate x2
49 6 -2 roll % reorder
50 } bind def
51 /drawoutline {
52 gsave outlinecolor newpath
53 coor 0 get aload pop 0.8 0 360 arc % draw 5' circle of 1st sequence
54 currentdict /cutpoint known % check if cutpoint is defined
55 {coor 0 cutpoint getinterval
56 {aload pop lineto} forall % draw outline of 1st sequence
57 coor cutpoint 1 add get aload pop
58 2 copy moveto 0.8 0 360 arc % draw 5' circle of 2nd sequence
59 coor cutpoint 1 add coor length cutpoint 1 add sub getinterval
60 {aload pop lineto} forall} % draw outline of 2nd sequence
61 {coor {aload pop lineto} forall} % draw outline as a whole
62 ifelse
63 stroke grestore
64 } bind def
65 /drawpairs {
66 paircolor
67 0.7 setlinewidth
68 [9 3.01] 9 setdash
69 newpath
70 pairs {aload pop
71 currentdict (cpr) known
72 { exch dup
73 coor exch 1 sub get aload pop moveto
74 exch arccoords curveto
75 }
76 { coor exch 1 sub get aload pop moveto
77 coor exch 1 sub get aload pop lineto
78 }ifelse
79 } forall
80 stroke
81 } bind def
82 % draw bases
83 /drawbases {
84 [] 0 setdash
85 seqcolor
86 0
87 coor {
88 aload pop moveto
89 dup sequence exch 1 getinterval cshow
90 1 add
91 } forall
92 pop
93 } bind def
94
95 /init {
96 /Helvetica findfont fsize scalefont setfont
97 1 setlinejoin
98 1 setlinecap
99 0.8 setlinewidth
100 72 216 translate
101 % find the coordinate range
102 /xmax -1000 def /xmin 10000 def
103 /ymax -1000 def /ymin 10000 def
104 coor {
105 aload pop
106 dup ymin lt {dup /ymin exch def} if
107 dup ymax gt {/ymax exch def} {pop} ifelse
108 dup xmin lt {dup /xmin exch def} if
109 dup xmax gt {/xmax exch def} {pop} ifelse
110 } forall
111 /size {xmax xmin sub ymax ymin sub max} bind def
112 72 6 mul size div dup scale
113 size xmin sub xmax sub 2 div size ymin sub ymax sub 2 div
114 translate
115 } bind def
116 end
117 %%EndProlog
118 RNAplot begin
119 % data start here
120 /sequence (\
121 UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA\
122 ) def
123 /coor [
124 [102.34599304 225.12051392]
125 [110.41094971 210.84155273]
126 [109.77433014 195.85507202]
127 [109.13771057 180.86859131]
128 [108.50109100 165.88211060]
129 [107.86447144 150.89561462]
130 [107.22785950 135.90913391]
131 [90.28739166 133.48460388]
132 [77.11851501 123.91786957]
133 [70.32070923 110.05319977]
134 [55.37474823 111.32528687]
135 [40.42878342 112.59737396]
136 [25.48282242 113.86946106]
137 [17.57515907 127.22043610]
138 [3.31690264 133.34266663]
139 [-11.80935574 129.88204956]
140 [-21.98726082 118.16923523]
141 [-23.30319977 102.70806122]
142 [-15.25116920 89.44365692]
143 [-0.92733771 83.47645569]
144 [14.16048908 87.10096741]
145 [24.21073341 98.92350006]
146 [39.15669632 97.65141296]
147 [54.10265732 96.37932587]
148 [69.04862213 95.10723114]
149 [75.20735168 80.83619690]
150 [87.46604156 71.28019714]
151 [84.93103027 56.49596024]
152 [82.39601898 41.71172333]
153 [79.86100006 26.92748451]
154 [77.32598877 12.14324570]
155 [63.73017883 4.41744947]
156 [58.32971573 -10.25800610]
157 [63.67453384 -24.95381927]
158 [77.24097443 -32.73107910]
159 [92.62337494 -29.91759682]
160 [102.55863953 -17.84181786]
161 [102.35564423 -2.20555139]
162 [92.11022949 9.60823345]
163 [94.64524078 24.39247131]
164 [97.18025208 39.17671204]
165 [99.71526337 53.96094894]
166 [102.25028229 68.74518585]
167 [111.61898041 69.95008087]
168 [120.45154572 73.97383881]
169 [127.89853668 80.59681702]
170 [133.19635010 89.34370422]
171 [135.74378967 99.51597595]
172 [135.16680908 110.24712372]
173 [150.04531860 112.15238953]
174 [164.92382812 114.05766296]
175 [179.80232239 115.96292877]
176 [194.68083191 117.86819458]
177 [206.04914856 107.13062286]
178 [221.66270447 106.26418304]
179 [234.14927673 115.67798615]
180 [237.61306763 130.92712402]
181 [230.41859436 144.81141663]
182 [215.96286011 150.77513123]
183 [201.07142639 146.00236511]
184 [192.77557373 132.74670410]
185 [177.89706421 130.84143066]
186 [163.01855469 128.93617249]
187 [148.14004517 127.03089905]
188 [133.26153564 125.12563324]
189 [122.21434021 135.27252197]
190 [122.85095978 150.25900269]
191 [123.48757935 165.24548340]
192 [124.12419128 180.23197937]
193 [124.76081085 195.21846008]
194 [125.39743042 210.20494080]
195 [134.64427185 223.74850464]
196 [127.29573059 238.40902710]
197 ] def
198 /pairs [
199 [2 71]
200 [3 70]
201 [4 69]
202 [5 68]
203 [6 67]
204 [7 66]
205 [10 25]
206 [11 24]
207 [12 23]
208 [13 22]
209 [27 43]
210 [28 42]
211 [29 41]
212 [30 40]
213 [31 39]
214 [49 65]
215 [50 64]
216 [51 63]
217 [52 62]
218 [53 61]
219 ] def
220
221 init
222
223 % switch off outline pairs or bases by removing these lines
224 drawoutline
225 drawpairs
226 drawbases
227 % show it
228 showpage
229 end
230 %%EOF