Mercurial > repos > rnateam > viennarna_kinwalker

diff test-data/rnafold_result3.txt @ 3:adf153c903d3 draft default tip

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/rna_tools/vienna_rna commit 36681a08c6e44c663169caaefd964781c43d0d29
author rnateam
date Wed, 20 Dec 2017 08:34:33 -0500
parents aad9e6557d00
children
line wrap: on
line diff
--- a/test-data/rnafold_result3.txt	Thu Sep 28 16:24:16 2017 -0400
+++ b/test-data/rnafold_result3.txt	Wed Dec 20 08:34:33 2017 -0500
@@ -1,7 +1,3 @@
 >Sequence
 UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA
 .((((((..((((........)))).(((((.......))))).....(((((.......))))))))))).. (-22.00)
-,((((((..((((........)))).(((((.......))))).....(((((.......))))))))),)), [-23.20]
-.((((((..((((........)))).(((((.......))))).....(((((.......))))))))).)). {-21.90 d=9.72}
-.((((((..((((........)))).(((((.......))))).....(((((.......))))))))).)). {-21.90 MEA=58.88}
- frequency of mfe structure in ensemble 0.142309; ensemble diversity 14.51