Mercurial > repos > rnateam > viennarna_kinwalker

changeset 0:b13a2b5a811a draft

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/rna_tools/vienna_rna commit 3103ebed1a420c7d3415b67ef532ea579edf9faa
author rnateam
date Wed, 12 Jul 2017 14:25:23 -0400
parents
children 1914de607d39
files kinwalker.xml macros.xml rnafold_SHAPE.py test-data/kinfold_input.txt test-data/mfe_struct_result.fasta test-data/rna2dfold_input1.txt test-data/rna2dfold_result1.txt test-data/rnaaliduplex_input1.clustal test-data/rnaaliduplex_result1.txt test-data/rnaalifold_input1.clustal test-data/rnaalifold_result1.txt test-data/rnacofold_input1.fas test-data/rnacofold_result1.txt test-data/rnadistance_input1.dbn test-data/rnadistance_result1.txt test-data/rnaduplex_input1.fa test-data/rnaduplex_result1.txt test-data/rnaeval_input1.dbn test-data/rnaeval_result1.txt test-data/rnafold_input1.fa test-data/rnafold_input2.fa test-data/rnafold_result1.txt test-data/rnafold_result2.txt test-data/rnafold_result3.txt test-data/rnaheat_input1.fa test-data/rnaheat_result1.txt test-data/rnainverse_input1.clu test-data/rnalalifold_input1.clustal test-data/rnalalifold_result1.txt test-data/rnalfold_input1.fa test-data/rnalfold_result1.txt test-data/rnapaln_input1.fa test-data/rnapaln_input1.fas test-data/rnapaln_result1.txt test-data/rnapdist_input1.fa test-data/rnapdist_result1.txt test-data/rnapkplex_input1.fa test-data/rnapkplex_result1.txt test-data/rnaplex_input1.fa test-data/rnaplex_result1.txt test-data/rnaplfold_input1.fa test-data/rnaplfold_result1.ps test-data/rnaplfold_result2.ps test-data/rnaplot_input1.dbn test-data/rnaplot_input1.fa test-data/rnasnoop_input1a.fa test-data/rnasnoop_input1b.fa test-data/rnasnoop_result1.txt test-data/rnasubopt_input1.fa test-data/rnasubopt_result1.txt test-data/rnaup_input1.fa test-data/rnaup_result1.txt test-data/sample_3.fa test-data/sample_3.react test-data/sample_3_result.txt test-data/test_sequence_input.fasta test-data/trajectory_result.tabular vienna_rna.tar.gz
diffstat 58 files changed, 1435 insertions(+), 0 deletions(-) [+]
line wrap: on
line diff
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/kinwalker.xml	Wed Jul 12 14:25:23 2017 -0400
@@ -0,0 +1,134 @@
+<tool id="viennarna_kinwalker" name="@EXECUTABLE@" version="@VERSION@.0">
+    <description>cotranscriptional folding of RNAs</description>
+    <macros>
+        <token name="@EXECUTABLE@">kinwalker</token>
+        <import>macros.xml</import>
+    </macros>
+     <expand macro="requirements" />
+    <expand macro="stdio" />
+    <expand macro="version_command" />
+    <command>
+<![CDATA[
+    head -n 1 '$input_sequence' | head -c -1 -q  > seq.ident
+    &&
+    sed '1d' '$input_sequence' > input.seq
+    &&
+    kinwalker
+        $init_structure
+        $interrupt
+        ##$printfront
+        
+        --barrier_heuristic $barrier_heuristic.used
+        
+        #if $barrier_heuristic.used == "M"
+            --grouping $barrier_heuristic.grouping
+            --lookahead $barrier_heuristic.lookahead
+        #else if $barrier_heuristic.used == "B"
+            --maxkeep $barrier_heuristic.maxkeep
+        #end if
+        
+        --dangle $dangle
+        --noLonelyPairs $noLonelyPairs
+        --transcribed $transcribed
+        --transcription_rate $transcription_rate
+        --windowsize $windowsize
+        
+        < input.seq
+        
+        > blah
+         
+        &&
+        sed -n '2s/[\.\(\)]\+\s\+\(.\+\)$/ mfe: \1/p' blah > energy
+        
+        &&
+        cat seq.ident energy > '$mfe_struct'
+        
+        &&
+        sed -e '2s/^\([\.\(\)]\+\).*$/\1/' -ne '1,2p' blah >> '$mfe_struct'
+        
+        &&
+        sed -e 's/[ \t]*$//' -ne '/TRAJ/,/Kinwal/ {/TRAJ/n;/Kinwal/!{s/\s/\t/gp}}' blah > '$trajectory'
+]]>
+    </command>
+    <inputs>
+        <param name="input_sequence" format="fasta" type="data" label="Input sequence" help="A single sequence in FASTA format"/>
+        <param name="init_structure" type="boolean" truevalue="--init_structure" falsevalue="" checked="false" label="Start with a structure other than the open chain" help="(--init_structure)"/>
+        <param name="interrupt" type="boolean" truevalue="--interrupt" falsevalue="" checked="false" label="Allow interrupted folding trajectories when the barrier is exceeded" help="(--interrupt)"/>
+        <!-- need to implement with dataset collections <param name="printfront" type="boolean" truevalue="!doublehypen!printfront" falsevalue="" checked="true" label="Creates PS plots of front progression" help="(!doublehypen!printfront)"/> -->
+        <conditional name="barrier_heuristic">
+            <param name="used" type="select" label="Barrier Heuristic" help="(--barrier_heuristic)">
+                <option value="M" selected="true">Morgan-Higgs</option>
+                <option value="S">Limit small stacks</option>
+                <option value="B">Barriers</option>
+                <option value="A">All</option>
+            </param>
+            <when value="M">
+                <param name="grouping" type="select" label="How to treat conflict groups" help="(--grouping)">
+                    <option value="standard" selected="true">Standard</option>
+                    <option value="regroup">Re-group</option>
+                </param>
+                <param name="lookahead" type="integer" value="1" label="Number of basepairs that MorganHiggs forms its subpaths from" help="(--lookahead)"/>
+            </when>
+            <when value="S" />
+            <when value="B">
+                <param name="maxkeep" type="integer" value="1" label="Breadth of breadth first search" help="(--maxkeep)"/>
+            </when>
+            <when value="A" />
+        </conditional>
+        <param name="dangle" type="select" label="Dangle value as in VienneRNA package" help="(--dangle)">
+            <option value="0" selected="true">0</option>
+            <option value="1">1</option>
+            <option value="2">2</option>
+        </param>
+        <param name="noLonelyPairs" type="integer" value="2" label="Value of noLonelyPairs as in ViennaRNA" help="(--noLonelyPairs)"/>
+        
+        <param name="transcribed" type="integer" value="1" label="Number of bases initially transcribed" help="0 means all is transcribed (--transcribed)"/>
+        <param name="transcription_rate" type="float" value="200" label="Number of bases transcribed per second" help="(--transcription_rate)"/>
+        <param name="windowsize" type="integer" value="0" label="Max size of substructures considered for folding events during transcription" help="0= all are considered. (--windowsize)"/>
+    </inputs>
+    <outputs>
+        <data format="fasta" name="mfe_struct" label="MFE structure from ${tool.name} on ${on_string}" />
+        <data format="tabular" name="trajectory" label="Trajectory of ${tool.name} on ${on_string}" />
+    </outputs>
+    <tests>
+        <test>
+            <param name="input_sequence" value="test_sequence_input.fasta" />
+            <param name="init_structure" value="" />
+            <param name="interrupt" value="" />
+            <param name="used" value="M" />
+            <param name="grouping" value="standard" />
+            <param name="lookahead" value="1" />
+            <param name="dangle" value="0" />
+            <param name="noLonelyPairs" value="2" />
+            <param name="transcribed" value="1" />
+            <param name="transcription_rate" value="200" />
+            <param name="windowsize" value="0" />
+            <output name="mfe_struct" file="mfe_struct_result.fasta" />
+            <output name="trajectory" file="trajectory_result.tabular" />
+        </test>
+    </tests>
+    <help>
+<![CDATA[
+**What it does**
+
+Kinwalker splits the folding process into a series of events where each event can either be a folding event or a transcription event. In each transcription event one base from the RNA sequence is appended to the already transcribed and (partially) folded subsequence. 
+Kinwalker executes transcription events at regular time intervals. In each folding event a subsequence of the already transcribed RNA sequence is selected and a new structure is formed by combining base pairs from the current structure with base pairs from the mfE structure of that subsequence. 
+
+This is done in such a way that the new structure includes base pairs from both structures in an energetically favorable manner. Kinwalker estimates the waiting times for individual folding events depending on the height of the energy barrier between the current structure and the new structure into which the molecule is folded. Folding events between structures can only occur, if the energy barrier between them is less than the maximum allowed energy barrier. 
+
+As folding paths can only be calculated exhaustively for short sequences (n>100), heuristic approaches have to be employed which explicitly construct a (re)folding path between the two structures. The saddle height is then estimated as the highest point along the path. The best known algorithm for approximating saddle heights between RNA conformations is the Morgan-Higgs heuristic, which tries to find a folding path from an origin secondary structure to a target secondary structure where the maximum height along the path is minimal. The  heuristic models state transitions at base pair resolution.
+]]>
+
+**Input**
+
+RNA sequence in FASTA format
+
+**Output**
+
+RNA folding trajectory
+
+    </help>
+    <citations>
+        <citation type="doi">10.1016/j.jmb.2008.02.064</citation>
+    </citations>
+</tool>
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/macros.xml	Wed Jul 12 14:25:23 2017 -0400
@@ -0,0 +1,27 @@
+<macros>
+    <xml name="requirements">
+        <requirements>
+            <requirement type="package" version="2.2.10">viennarna</requirement>
+            <yield/>
+        </requirements>
+    </xml>
+    <token name="@VERSION@">2.2.10</token>
+    <xml name="version_command">
+        <version_command>@EXECUTABLE@ --version</version_command>
+    </xml>
+
+    <xml name="stdio">
+        <stdio>
+            <exit_code range="1:" />
+            <exit_code range=":-1" />
+            <regex match="Error:" />
+            <regex match="Exception:" />
+        </stdio>
+    </xml>
+
+    <xml name="citations">
+        <citations>
+            <citation type="doi">10.1186/1748-7188-6-26</citation>
+        </citations>
+    </xml>
+</macros>
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/rnafold_SHAPE.py	Wed Jul 12 14:25:23 2017 -0400
@@ -0,0 +1,45 @@
+### overcoming the problem of SHAPE data working with a single line.
+### creating multiple multiple files containg SHAPE data for a single sequence and running RNAfold for every
+### single sequence.
+
+import os
+import sys
+from os import system
+from Bio import SeqIO
+import re
+from subprocess import Popen, PIPE
+
+params_list = sys.argv[1:]
+param_list_no_shape = [s for s in params_list if not "--shape=" in s ]
+shape_file = [s for s in params_list if "--shape=" in s ]
+assert (len(shape_file) == 1)
+
+shape_file = shape_file[0]
+shape_file = shape_file.replace('--shape=', '')
+
+params_no_shape  =  " ".join(str(x) for x in param_list_no_shape)
+
+pattern = re.compile("^>.*$")
+id_line = ""
+with open(shape_file, 'r') as f:
+    content = f.read()
+    lines = content.split('\n')
+    for line in lines:
+        if pattern.match(line):
+            id_line = line.split()[0]
+            id_line = id_line[1:]
+            continue
+        else:
+            with open(id_line +'.tmp', "a") as clFile:
+                clFile.write(line + "\n")
+                
+input_file = sys.stdin
+
+for record in SeqIO.parse(input_file, "fasta"):
+    seq = ">{}\n{}".format(record.id,record.seq)
+    cmd =  " RNAfold  --shape=" + record.id + '.tmp ' + params_no_shape
+    p = Popen(cmd , stdin=PIPE, shell=True, stdout=PIPE, stderr=PIPE)
+    out,err = p.communicate(seq.encode())
+    if err:
+        raise RuntimeError("Error in calling RNAfold\n{}\n{}\n".format(out, err))
+    print (out.decode('utf-8').strip())
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/kinfold_input.txt	Wed Jul 12 14:25:23 2017 -0400
@@ -0,0 +1,1 @@
+ACUGAUCGUAGUCAC
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/mfe_struct_result.fasta	Wed Jul 12 14:25:23 2017 -0400
@@ -0,0 +1,3 @@
+>test_seq mfe: -13.6
+ACAGGUUCGCCUGUGUUGCGAACCUGCGGGUUCG
+.(((((((((.......)))))))))........
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rna2dfold_input1.txt	Wed Jul 12 14:25:23 2017 -0400
@@ -0,0 +1,4 @@
+>Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC (218800-218872)  Ala (AGC) 73 bp  Sc: 49.55
+UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA
+.((((((..((((........)))).(((((.......))))).....(((((.......)))))))))))..
+.((((((..(((..........))).(((((.......))))).....(((((.......)))))))))))..
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rna2dfold_result1.txt	Wed Jul 12 14:25:23 2017 -0400
@@ -0,0 +1,6 @@
+>Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC
+UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA
+.((((((..((((........)))).(((((.......))))).....(((((.......))))))))))).. (-22.00)
+.((((((..((((........)))).(((((.......))))).....(((((.......))))))))))).. (-22.00) <ref 1>
+.((((((..(((..........))).(((((.......))))).....(((((.......))))))))))).. (-17.30) <ref 2>
+k	l	en	structure
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnaaliduplex_input1.clustal	Wed Jul 12 14:25:23 2017 -0400
@@ -0,0 +1,7 @@
+CLUSTAL 2.1 multiple sequence alignment
+
+
+Anolis_carolinensis_chrUn_GL34      TGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGTGAGAGGTAGTGGGATCGATGCCCACATTCTCCA
+Anolis_carolinensis_chrUn_GL35      GGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGCGAGAGGTAGCGGGATTGATGCCCGCATTCTCCA
+                                     ************************************** ************** ******* ********* 
+
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnaaliduplex_result1.txt	Wed Jul 12 14:25:23 2017 -0400
@@ -0,0 +1,1 @@
+(((((((..(.......((((..(..((((((..((((((.......((((((..(..(((((..(((((((.&)))))))..).......))))..)..))))))..)))))).......))))))..)..)))))..))))))).   1,73  :   1,73  (-40.30)
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnaalifold_input1.clustal	Wed Jul 12 14:25:23 2017 -0400
@@ -0,0 +1,7 @@
+CLUSTAL 2.1 multiple sequence alignment
+
+
+Anolis_carolinensis_chrUn_GL34      TGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGTGAGAGGTAGTGGGATCGATGCCCACATTCTCCA
+Anolis_carolinensis_chrUn_GL35      GGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGCGAGAGGTAGCGGGATTGATGCCCGCATTCTCCA
+                                     ************************************** ************** ******* ********* 
+
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnaalifold_result1.txt	Wed Jul 12 14:25:23 2017 -0400
@@ -0,0 +1,2 @@
+GGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGCGAGAGGUAGCGGGAUCGAUGCCCACAUUCUCCA
+(((((((..((((........)))).(((((.......))))).....(((((.......)))))))))))). (-26.45 = -26.20 +  -0.25)
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnacofold_input1.fas	Wed Jul 12 14:25:23 2017 -0400
@@ -0,0 +1,2 @@
+>Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC (218800-218872)  Ala (AGC) 73 bp  Sc: 49.55
+UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA&UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnacofold_result1.txt	Wed Jul 12 14:25:23 2017 -0400
@@ -0,0 +1,3 @@
+>Anolis_carolinensis_chrUn_GL343590.trna2-A
+UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA&UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA
+.((((((..((((........)))).(((((.......))))).....(((((((((((.(((((((((((..&.))))))..((((........)))).(((((.......))))).....))))))))))).))))))))))).. (-55.90)
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnadistance_input1.dbn	Wed Jul 12 14:25:23 2017 -0400
@@ -0,0 +1,2 @@
+.((((((..((((........)))).(((((.......))))).....(((((.......)))))))))))..
+(((((((..((((........)))).(((((.......))))).....(((((.......)))))))))))).
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnadistance_result1.txt	Wed Jul 12 14:25:23 2017 -0400
@@ -0,0 +1,1 @@
+f: 4  
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnaduplex_input1.fa	Wed Jul 12 14:25:23 2017 -0400
@@ -0,0 +1,4 @@
+>Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC (218800-218872)  Ala (AGC) 73 bp  Sc: 49.55
+TGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGTGAGAGGTAGTGGGATCGATGCCCACATTCTCCA
+>Anolis_carolinensis_chrUn_GL343207.trna3-AlaAGC (1513626-1513698)  Ala (AGC) 73 bp  Sc: 56.15
+GGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGCGAGAGGTAGCGGGATTGATGCCCGCATTCTCCA
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnaduplex_result1.txt	Wed Jul 12 14:25:23 2017 -0400
@@ -0,0 +1,3 @@
+>Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC
+>Anolis_carolinensis_chrUn_GL343207.trna3-AlaAGC
+.((((((..((......((((...((((..(((.((((((.......((((((..(..((((...(((((((.&)))))))..........))))..)..))))))..))))))..)))..)))).......)))).)))))))).   1,73  :   1,72  (-40.70)
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnaeval_input1.dbn	Wed Jul 12 14:25:23 2017 -0400
@@ -0,0 +1,3 @@
+>Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC (218800-218872)  Ala (AGC) 73 bp  Sc: 49.55
+UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA
+.((((((..((((........)))).(((((.......))))).....(((((.......)))))))))))..
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnaeval_result1.txt	Wed Jul 12 14:25:23 2017 -0400
@@ -0,0 +1,3 @@
+>Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC (218800-218872)  Ala (AGC) 73 bp  Sc: 49.55
+UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA
+.((((((..((((........)))).(((((.......))))).....(((((.......))))))))))).. (-22.00)
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnafold_input1.fa	Wed Jul 12 14:25:23 2017 -0400
@@ -0,0 +1,4 @@
+>Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC (218800-218872)  Ala (AGC) 73 bp  Sc: 49.55
+TGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGTGAGAGGTAGTGGGATCGATGCCCACATTCTCCA
+>Anolis_carolinensis_chrUn_GL343207.trna3-AlaAGC (1513626-1513698)  Ala (AGC) 73 bp  Sc: 56.15
+GGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGCGAGAGGTAGCGGGATTGATGCCCGCATTCTCCA
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnafold_input2.fa	Wed Jul 12 14:25:23 2017 -0400
@@ -0,0 +1,4 @@
+>Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC (218800-218872)  Ala (AGC) 73 bp  Sc: 49.55
+TGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGTGAGAGGTAGTGGGATCGATGCCCACATTCTCCA
+>Anolis_carolinensis_chrUn_GL343207.trna3-AlaAGC (1513626-1513698)  Ala (AGC) 73 bp  Sc: 56.15
+GGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGCGAGAGGTAGCGGGATTGATGCCCGCATTCTCCA
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnafold_result1.txt	Wed Jul 12 14:25:23 2017 -0400
@@ -0,0 +1,6 @@
+>Anolis_carolinensis_chrUn_GL343590.trna2-A
+UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA
+.((((((..((((........)))).(((((.......))))).....(((((.......))))))))))).. (-22.00)
+>Anolis_carolinensis_chrUn_GL343207.trna3-A
+GGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGCGAGAGGUAGCGGGAUUGAUGCCCGCAUUCUCCA
+(((((((..((((........)))).(((((.......))))).....(((((.......)))))))))))). (-29.60)
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnafold_result2.txt	Wed Jul 12 14:25:23 2017 -0400
@@ -0,0 +1,6 @@
+>Anolis_carolinensis_chrUn_GL343590.trna2-A
+UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA
+..(((.....((((....((..(((....)))..))...)))).....(((((.......)))))....))). ( -3.37)
+>Anolis_carolinensis_chrUn_GL343207.trna3-A
+GGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGCGAGAGGUAGCGGGAUUGAUGCCCGCAUUCUCCA
+(((((..((.(((.....((..(((....)))..))......))).))(((((.......)))))..))))). ( -5.02)
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnafold_result3.txt	Wed Jul 12 14:25:23 2017 -0400
@@ -0,0 +1,3 @@
+>Sequence
+UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA
+.((((((..((((........)))).(((((.......))))).....(((((.......))))))))))).. (-22.00)
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnaheat_input1.fa	Wed Jul 12 14:25:23 2017 -0400
@@ -0,0 +1,2 @@
+> comment 1
+UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnaheat_result1.txt	Wed Jul 12 14:25:23 2017 -0400
@@ -0,0 +1,102 @@
+> comment 1
+0   0.0407267
+1   0.0435052
+2   0.0470227
+3   0.0505646
+4   0.0553391
+5   0.0603894
+6   0.0662047
+7   0.0718158
+8   0.0782007
+9   0.0863514
+10   0.0950516
+11   0.10505
+12   0.115613
+13   0.128245
+14   0.141712
+15   0.157281
+16   0.17497
+17   0.195056
+18   0.216799
+19   0.241743
+20   0.270432
+21   0.302132
+22   0.337644
+23   0.377263
+24   0.421546
+25   0.470799
+26   0.525589
+27   0.587016
+28   0.653829
+29   0.726606
+30   0.806458
+31   0.892656
+32   0.984857
+33   1.08272
+34   1.18601
+35   1.29332
+36   1.40305
+37   1.51467
+38   1.62618
+39   1.73524
+40   1.84032
+41   1.9407
+42   2.03385
+43   2.11859
+44   2.19443
+45   2.26182
+46   2.31999
+47   2.36969
+48   2.41182
+49   2.44826
+50   2.47967
+51   2.50769
+52   2.534
+53   2.55942
+54   2.5851
+55   2.61217
+56   2.64151
+57   2.67329
+58   2.70759
+59   2.74465
+60   2.78458
+61   2.8279
+62   2.8742
+63   2.92425
+64   2.97698
+65   3.03283
+66   3.09163
+67   3.15591
+68   3.23033
+69   3.3067
+70   3.38122
+71   3.45791
+72   3.54606
+73   3.63843
+74   3.73392
+75   3.83847
+76   3.94646
+77   4.05462
+78   4.16571
+79   4.28366
+80   4.39944
+81   4.50863
+82   4.61035
+83   4.70186
+84   4.78345
+85   4.85204
+86   4.90509
+87   4.9392
+88   4.95425
+89   4.95214
+90   4.93688
+91   4.91166
+92   4.87691
+93   4.8314
+94   4.78561
+95   4.75271
+96   4.71866
+97   4.66056
+98   4.57671
+99   4.48395
+100   4.39006
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnainverse_input1.clu	Wed Jul 12 14:25:23 2017 -0400
@@ -0,0 +1,2 @@
+(((((((..((((........)))).(((((.......))))).....(((((.......)))))))))))).
+gggccccnnaauunnnnnnnnaauunGGGGcnnnnnnnAAAAAnnnnnuuuuannnnnnnuaaaaggggcccn
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnalalifold_input1.clustal	Wed Jul 12 14:25:23 2017 -0400
@@ -0,0 +1,7 @@
+CLUSTAL 2.1 multiple sequence alignment
+
+
+Anolis_carolinensis_chrUn_GL34      TGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGTGAGAGGTAGTGGGATCGATGCCCACATTCTCCA
+Anolis_carolinensis_chrUn_GL35      GGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGCGAGAGGTAGCGGGATTGATGCCCGCATTCTCCA
+                                     ************************************** ************** ******* ********* 
+
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnalalifold_result1.txt	Wed Jul 12 14:25:23 2017 -0400
@@ -0,0 +1,4 @@
+(((.(((((.(((((.......)))))..)).(((((.......)))))..)))))) (-19.05)   17 -   73
+((((........)))). ( -5.10)   10 -   26
+GGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGCGAGAGGUAGCGGGAUCGAUGCCCACAUUCUCCA
+
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnalfold_input1.fa	Wed Jul 12 14:25:23 2017 -0400
@@ -0,0 +1,4 @@
+>Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC (218800-218872)  Ala (AGC) 73 bp  Sc: 49.55
+TGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGTGAGAGGTAGTGGGATCGATGCCCACATTCTCCA
+>Anolis_carolinensis_chrUn_GL343207.trna3-AlaAGC (1513626-1513698)  Ala (AGC) 73 bp  Sc: 56.15
+GGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGCGAGAGGTAGCGGGATTGATGCCCGCATTCTCCA
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnalfold_result1.txt	Wed Jul 12 14:25:23 2017 -0400
@@ -0,0 +1,28 @@
+>Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC (218800-218872)  Ala (AGC) 73 bp  Sc: 49.55
+.((((....)))).	( -0.10)	56
+.(((..((((....)))).))).	( -3.40)	51
+.(((((.......))))).	( -7.70)	48
+.((((..(((((.......)))))..)))).	(-10.30)	42
+.(((((...(((((.......))))).))))).	(-11.50)	40
+.((.(((((...(((((.......))))).)))))))	(-12.10)	37
+.(((((.......))))).	( -5.80)	26
+.((.(((((.......)))))..)).	( -6.70)	23
+.((((....)))).	( -3.20)	21
+.((.((((....)))).)).	( -4.70)	18
+.((((........)))).	( -5.30)	9
+.((((((..((((........)))).(((((.......))))).....(((((.......))))))))))).	(-22.00)	1
+UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA
+ (-22.00)
+>Anolis_carolinensis_chrUn_GL343207.trna3-AlaAGC (1513626-1513698)  Ala (AGC) 73 bp  Sc: 56.15
+.(((..((((....)))).))).	( -3.40)	51
+.(((((.......))))).	( -9.20)	48
+.((((..(((((.......)))))..)))).	(-11.80)	42
+.(((((...(((((.......))))).))))).	(-13.30)	40
+.((.(((((...(((((.......))))).)))))))	(-13.60)	37
+.(((((.......))))).	( -7.70)	26
+.((.(((((.......)))))..)).	( -8.60)	23
+.(((.(((((.(((((.......)))))..)).(((((.......)))))..))))))	(-20.00)	16
+.((((........)))).	( -5.30)	9
+(((((((..((((........)))).(((((.......))))).....(((((.......)))))))))))).	(-29.60)	1
+GGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGCGAGAGGUAGCGGGAUUGAUGCCCGCAUUCUCCA
+ (-29.60)
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnapaln_input1.fa	Wed Jul 12 14:25:23 2017 -0400
@@ -0,0 +1,4 @@
+>Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC (218800-218872)  Ala (AGC) 73 bp  Sc: 49.55
+TGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGTGAGAGGTAGTGGGATCGATGCCCACATTCTCCA
+>Anolis_carolinensis_chrUn_GL343207.trna3-AlaAGC (1513626-1513698)  Ala (AGC) 73 bp  Sc: 56.15
+GGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGCGAGAGGTAGCGGGATTGATGCCCGCATTCTCCA
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnapaln_input1.fas	Wed Jul 12 14:25:23 2017 -0400
@@ -0,0 +1,1 @@
+UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA&UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnapaln_result1.txt	Wed Jul 12 14:25:23 2017 -0400
@@ -0,0 +1,7 @@
+>Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC (218800-218872)  Ala (AGC) 73 bp  Sc: 49.55
+>Anolis_carolinensis_chrUn_GL343207.trna3-AlaAGC (1513626-1513698)  Ala (AGC) 73 bp  Sc: 56.15
+68.8844
+UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA
+,((((((..((((........)))).(((((.......))))).....(((((.......))))))))),)),
+GGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGCGAGAGGUAGCGGGAUUGAUGCCCGCAUUCUCCA
+(((((((..((((........)))).(((((.......))))).....(((((.......)))))))))))).
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnapdist_input1.fa	Wed Jul 12 14:25:23 2017 -0400
@@ -0,0 +1,4 @@
+>Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC (218800-218872)  Ala (AGC) 73 bp  Sc: 49.55
+TGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGTGAGAGGTAGTGGGATCGATGCCCACATTCTCCA
+>Anolis_carolinensis_chrUn_GL343207.trna3-AlaAGC (1513626-1513698)  Ala (AGC) 73 bp  Sc: 56.15
+GGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGCGAGAGGTAGCGGGATTGATGCCCGCATTCTCCA
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnapdist_result1.txt	Wed Jul 12 14:25:23 2017 -0400
@@ -0,0 +1,3 @@
+>Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC (218800-218872)  Ala (AGC) 73 bp  Sc: 49.55
+>Anolis_carolinensis_chrUn_GL343207.trna3-AlaAGC (1513626-1513698)  Ala (AGC) 73 bp  Sc: 56.15
+8.66253
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnapkplex_input1.fa	Wed Jul 12 14:25:23 2017 -0400
@@ -0,0 +1,4 @@
+>Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC (218800-218872)  Ala (AGC) 73 bp  Sc: 49.55
+TGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGTGAGAGGTAGTGGGATCGATGCCCACATTCTCCA
+>Anolis_carolinensis_chrUn_GL343207.trna3-AlaAGC (1513626-1513698)  Ala (AGC) 73 bp  Sc: 56.15
+GGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGCGAGAGGTAGCGGGATTGATGCCCGCATTCTCCA
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnapkplex_result1.txt	Wed Jul 12 14:25:23 2017 -0400
@@ -0,0 +1,6 @@
+>Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC (218800-218872)  Ala (AGC) 73 bp  Sc: 49.55
+UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA
+.((((((..((((........)))).(((((.......))))).[[[.(((((]]]....))))))))))).. (-31.90)
+>Anolis_carolinensis_chrUn_GL343207.trna3-AlaAGC (1513626-1513698)  Ala (AGC) 73 bp  Sc: 56.15
+GGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGCGAGAGGUAGCGGGAUUGAUGCCCGCAUUCUCCA
+(((((((..((((..[[[.[[)))).(((((.]].]]]))))).....(((((.......)))))))))))). (-38.54)
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnaplex_input1.fa	Wed Jul 12 14:25:23 2017 -0400
@@ -0,0 +1,4 @@
+>Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC (218800-218872)  Ala (AGC) 73 bp  Sc: 49.55
+TGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGTGAGAGGTAGTGGGATCGATGCCCACATTCTCCA
+>Anolis_carolinensis_chrUn_GL343207.trna3-AlaAGC (1513626-1513698)  Ala (AGC) 73 bp  Sc: 56.15
+GGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGCGAGAGGTAGCGGGATTGATGCCCGCATTCTCCA
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnaplex_result1.txt	Wed Jul 12 14:25:23 2017 -0400
@@ -0,0 +1,4 @@
+>Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC (218800-218872)  Ala (AGC) 73 bp  Sc: 49.55
+>Anolis_carolinensis_chrUn_GL343207.trna3-AlaAGC (1513626-1513698)  Ala (AGC) 73 bp  Sc: 56.15
+.((((((..((......((((...((((..(((.((((((.......((((((..(..((((...(((((((.&)))))))..........))))..)..))))))..))))))..)))..)))).......)))).)))))))).   1,73  :   1,72  (-40.70) i:72,j:1 <-41.26>
+
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnaplfold_input1.fa	Wed Jul 12 14:25:23 2017 -0400
@@ -0,0 +1,4 @@
+>Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC (218800-218872)  Ala (AGC) 73 bp  Sc: 49.55
+TGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGTGAGAGGTAGTGGGATCGATGCCCACATTCTCCA
+>Anolis_carolinensis_chrUn_GL343207.trna3-AlaAGC (1513626-1513698)  Ala (AGC) 73 bp  Sc: 56.15
+GGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGCGAGAGGTAGCGGGATTGATGCCCGCATTCTCCA
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnaplfold_result1.ps	Wed Jul 12 14:25:23 2017 -0400
@@ -0,0 +1,242 @@
+%!PS-Adobe-3.0 EPSF-3.0
+%%Title: RNA Dot Plot
+%%Creator: ViennaRNA-2.2.10
+%%CreationDate: Tue Oct  4 14:45:55 2016
+%%BoundingBox: 66 530 520 650
+%%DocumentFonts: Helvetica
+%%Pages: 1
+%%EndComments
+
+%Options: 
+%This file contains the square roots of the base pair probabilities in the form
+% i  j  sqrt(p(i,j)) ubox
+
+%%BeginProlog
+/DPdict 100 dict def
+DPdict begin
+/logscale false def
+/lpmin 1e-05 log def
+
+/box { %size x y box - draws box centered on x,y
+   2 index 0.5 mul sub            % x -= 0.5
+   exch 2 index 0.5 mul sub exch  % y -= 0.5
+   3 -1 roll dup rectfill
+} bind def
+
+/ubox {
+   logscale {
+      log dup add lpmin div 1 exch sub dup 0 lt { pop 0 } if
+   } if
+   3 1 roll
+   exch len exch sub 1 add box
+} bind def
+
+/lbox {
+   3 1 roll
+   len exch sub 1 add box
+} bind def
+
+/drawseq {
+% print sequence along all 4 sides
+[ [0.7 -0.3 0 ]
+  [0.7 0.7 len add 0]
+  [-0.3 len sub -0.4 -90]
+  [-0.3 len sub 0.7 len add -90]
+] {
+   gsave
+    aload pop rotate translate
+    0 1 len 1 sub {
+     dup 0 moveto
+     sequence exch 1 getinterval
+     show
+    } for
+   grestore
+  } forall
+} bind def
+
+/drawgrid{
+  0.01 setlinewidth
+  len log 0.9 sub cvi 10 exch exp  % grid spacing
+  dup 1 gt {
+     dup dup 20 div dup 2 array astore exch 40 div setdash
+  } { [0.3 0.7] 0.1 setdash } ifelse
+  0 exch len {
+     dup dup
+     0 moveto
+     len lineto
+     dup
+     len exch sub 0 exch moveto
+     len exch len exch sub lineto
+     stroke
+  } for
+  [] 0 setdash
+  0.04 setlinewidth
+  currentdict /cutpoint known {
+    cutpoint 1 sub
+    dup dup -1 moveto len 1 add lineto
+    len exch sub dup
+    -1 exch moveto len 1 add exch lineto
+    stroke
+  } if
+  0.5 neg dup translate
+} bind def
+
+end
+%%EndProlog
+DPdict begin
+%delete next line to get rid of title
+270 665 moveto /Helvetica findfont 14 scalefont setfont (Anolis_carolinensis_chrUn_GL343590.trna2-A) show
+
+/sequence { (\
+UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA\
+) } def
+/winSize 70 def
+/len { sequence length } bind def
+
+292 416 translate
+72 6 mul len 1 add winSize add 2 sqrt mul div dup scale
+/Helvetica findfont 0.95 scalefont setfont
+
+/drawseq_turn {% print sequence at bottom
+   gsave
+   len 2 sqrt div dup neg 0.28 add exch 0.78 sub translate
+    0 1 len 1 sub {
+     dup dup 2 sqrt mul 0 moveto
+     sequence exch 1 getinterval
+     show
+    } for
+   grestore
+} bind def
+/drawgrid_turn{
+  0.01 setlinewidth
+  len log 0.9 sub cvi 10 exch exp  % grid spacing
+  dup 1 gt {
+     dup dup 20 div dup 2 array astore exch 40 div setdash
+  } { [0.3 0.7] 0.1 setdash } ifelse
+  0 exch len {    %for (0, gridspacing, len) 
+     dup dup      %duplicate what - gridspacing??
+     dup len exch sub moveto     %moveto diagonal?
+     dup winSize gt
+     {dup dup len exch sub winSize add lineto}
+     {dup len lineto}ifelse
+     dup len exch sub moveto  %moveto diagonal?
+     dup len winSize sub le
+     {dup dup len exch sub dup winSize exch sub len add exch lineto}
+     {dup dup len exch sub len exch lineto}ifelse     stroke pop pop
+  } for
+  len log 0.9 sub cvi 10 exch exp  % grid spacing
+      dup 1 gt {
+          dup dup 20 div dup 2 array astore exch 40 div setdash
+      } { [0.3 0.7] 0.1 setdash } ifelse
+      0 exch len {    %for (0, gridspacing, len) 
+     dup dup      %duplicate what - gridspacing??
+     dup len exch sub moveto     %moveto diagonal?
+     len exch sub 0.7 sub exch 0.7 sub exch lineto
+     stroke
+   }for
+ winSize len moveto  len winSize  lineto stroke
+  [] 0 setdash
+  0.04 setlinewidth 
+  currentdict /cutpoint known {
+    cutpoint 1 sub
+    dup dup -1 moveto len 1 add lineto
+    len exch sub dup
+    -1 exch moveto len 1 add exch lineto
+   stroke
+  } if
+  0.5 neg dup translate
+} bind def 
+
+0.5 dup translate
+drawseq_turn
+45 rotate
+
+
+%draw the grid
+drawgrid_turn
+
+%start of base pair probability data
+2 70 0.1568 ubox
+2 71 0.9619 ubox
+3 69 0.1395 ubox
+3 70 0.7414 ubox
+3 72 0.8060 ubox
+4 68 0.1157 ubox
+4 69 0.6748 ubox
+4 71 0.4682 ubox
+5 67 0.1065 ubox
+5 68 0.6724 ubox
+5 70 0.3765 ubox
+6 47 0.1250 ubox
+6 67 0.6497 ubox
+7 46 0.1273 ubox
+7 66 0.6008 ubox
+8 45 0.1294 ubox
+8 48 0.2252 ubox
+9 47 0.2335 ubox
+10 25 0.7863 ubox
+11 24 0.7884 ubox
+11 43 0.5215 ubox
+11 45 0.2330 ubox
+12 23 0.7883 ubox
+12 42 0.5493 ubox
+12 44 0.2317 ubox
+13 22 0.7882 ubox
+13 41 0.5528 ubox
+13 43 0.2306 ubox
+14 40 0.5338 ubox
+15 20 0.1027 ubox
+16 38 0.5325 ubox
+16 40 0.1646 ubox
+17 37 0.5639 ubox
+17 39 0.1633 ubox
+18 36 0.5591 ubox
+18 38 0.1125 ubox
+19 36 0.2406 ubox
+20 34 0.5341 ubox
+20 35 0.2514 ubox
+21 33 0.4064 ubox
+22 32 0.2491 ubox
+22 33 0.4413 ubox
+23 32 0.5541 ubox
+24 31 0.6100 ubox
+25 30 0.6092 ubox
+26 36 0.2144 ubox
+27 35 0.2146 ubox
+27 43 0.7269 ubox
+28 34 0.2043 ubox
+28 42 0.7445 ubox
+29 41 0.7467 ubox
+30 40 0.7468 ubox
+31 39 0.7470 ubox
+38 73 0.3242 ubox
+39 72 0.3055 ubox
+40 73 0.1211 ubox
+41 71 0.2953 ubox
+41 72 0.1146 ubox
+42 70 0.2588 ubox
+43 69 0.2613 ubox
+43 71 0.2848 ubox
+44 68 0.2587 ubox
+44 70 0.3418 ubox
+45 67 0.2339 ubox
+45 68 0.1772 ubox
+45 69 0.3617 ubox
+45 70 0.1014 ubox
+45 72 0.3111 ubox
+46 67 0.2550 ubox
+46 68 0.3039 ubox
+46 69 0.1150 ubox
+46 71 0.2540 ubox
+47 66 0.2925 ubox
+48 67 0.1378 ubox
+49 65 0.9938 ubox
+50 64 0.9971 ubox
+51 63 0.9980 ubox
+52 62 0.9980 ubox
+53 61 0.9963 ubox
+54 59 0.1628 ubox
+55 60 0.1625 ubox
+showpage
+end
+%%EOF
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnaplfold_result2.ps	Wed Jul 12 14:25:23 2017 -0400
@@ -0,0 +1,212 @@
+%!PS-Adobe-3.0 EPSF-3.0
+%%Title: RNA Dot Plot
+%%Creator: ViennaRNA-2.2.10
+%%CreationDate: Tue Oct  4 14:45:55 2016
+%%BoundingBox: 66 530 520 650
+%%DocumentFonts: Helvetica
+%%Pages: 1
+%%EndComments
+
+%Options: 
+%This file contains the square roots of the base pair probabilities in the form
+% i  j  sqrt(p(i,j)) ubox
+
+%%BeginProlog
+/DPdict 100 dict def
+DPdict begin
+/logscale false def
+/lpmin 1e-05 log def
+
+/box { %size x y box - draws box centered on x,y
+   2 index 0.5 mul sub            % x -= 0.5
+   exch 2 index 0.5 mul sub exch  % y -= 0.5
+   3 -1 roll dup rectfill
+} bind def
+
+/ubox {
+   logscale {
+      log dup add lpmin div 1 exch sub dup 0 lt { pop 0 } if
+   } if
+   3 1 roll
+   exch len exch sub 1 add box
+} bind def
+
+/lbox {
+   3 1 roll
+   len exch sub 1 add box
+} bind def
+
+/drawseq {
+% print sequence along all 4 sides
+[ [0.7 -0.3 0 ]
+  [0.7 0.7 len add 0]
+  [-0.3 len sub -0.4 -90]
+  [-0.3 len sub 0.7 len add -90]
+] {
+   gsave
+    aload pop rotate translate
+    0 1 len 1 sub {
+     dup 0 moveto
+     sequence exch 1 getinterval
+     show
+    } for
+   grestore
+  } forall
+} bind def
+
+/drawgrid{
+  0.01 setlinewidth
+  len log 0.9 sub cvi 10 exch exp  % grid spacing
+  dup 1 gt {
+     dup dup 20 div dup 2 array astore exch 40 div setdash
+  } { [0.3 0.7] 0.1 setdash } ifelse
+  0 exch len {
+     dup dup
+     0 moveto
+     len lineto
+     dup
+     len exch sub 0 exch moveto
+     len exch len exch sub lineto
+     stroke
+  } for
+  [] 0 setdash
+  0.04 setlinewidth
+  currentdict /cutpoint known {
+    cutpoint 1 sub
+    dup dup -1 moveto len 1 add lineto
+    len exch sub dup
+    -1 exch moveto len 1 add exch lineto
+    stroke
+  } if
+  0.5 neg dup translate
+} bind def
+
+end
+%%EndProlog
+DPdict begin
+%delete next line to get rid of title
+270 665 moveto /Helvetica findfont 14 scalefont setfont (Anolis_carolinensis_chrUn_GL343207.trna3-A) show
+
+/sequence { (\
+GGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGCGAGAGGUAGCGGGAUUGAUGCCCGCAUUCUCCA\
+) } def
+/winSize 70 def
+/len { sequence length } bind def
+
+292 416 translate
+72 6 mul len 1 add winSize add 2 sqrt mul div dup scale
+/Helvetica findfont 0.95 scalefont setfont
+
+/drawseq_turn {% print sequence at bottom
+   gsave
+   len 2 sqrt div dup neg 0.28 add exch 0.78 sub translate
+    0 1 len 1 sub {
+     dup dup 2 sqrt mul 0 moveto
+     sequence exch 1 getinterval
+     show
+    } for
+   grestore
+} bind def
+/drawgrid_turn{
+  0.01 setlinewidth
+  len log 0.9 sub cvi 10 exch exp  % grid spacing
+  dup 1 gt {
+     dup dup 20 div dup 2 array astore exch 40 div setdash
+  } { [0.3 0.7] 0.1 setdash } ifelse
+  0 exch len {    %for (0, gridspacing, len) 
+     dup dup      %duplicate what - gridspacing??
+     dup len exch sub moveto     %moveto diagonal?
+     dup winSize gt
+     {dup dup len exch sub winSize add lineto}
+     {dup len lineto}ifelse
+     dup len exch sub moveto  %moveto diagonal?
+     dup len winSize sub le
+     {dup dup len exch sub dup winSize exch sub len add exch lineto}
+     {dup dup len exch sub len exch lineto}ifelse     stroke pop pop
+  } for
+  len log 0.9 sub cvi 10 exch exp  % grid spacing
+      dup 1 gt {
+          dup dup 20 div dup 2 array astore exch 40 div setdash
+      } { [0.3 0.7] 0.1 setdash } ifelse
+      0 exch len {    %for (0, gridspacing, len) 
+     dup dup      %duplicate what - gridspacing??
+     dup len exch sub moveto     %moveto diagonal?
+     len exch sub 0.7 sub exch 0.7 sub exch lineto
+     stroke
+   }for
+ winSize len moveto  len winSize  lineto stroke
+  [] 0 setdash
+  0.04 setlinewidth 
+  currentdict /cutpoint known {
+    cutpoint 1 sub
+    dup dup -1 moveto len 1 add lineto
+    len exch sub dup
+    -1 exch moveto len 1 add exch lineto
+   stroke
+  } if
+  0.5 neg dup translate
+} bind def 
+
+0.5 dup translate
+drawseq_turn
+45 rotate
+
+
+%draw the grid
+drawgrid_turn
+
+%start of base pair probability data
+2 70 0.1914 ubox
+2 71 0.9787 ubox
+3 69 0.1660 ubox
+3 70 0.7676 ubox
+3 72 0.8449 ubox
+4 68 0.1377 ubox
+4 69 0.7113 ubox
+4 71 0.4928 ubox
+5 67 0.1266 ubox
+5 68 0.7090 ubox
+5 70 0.3955 ubox
+6 67 0.6860 ubox
+7 66 0.6345 ubox
+10 25 0.9888 ubox
+11 24 0.9915 ubox
+12 23 0.9914 ubox
+13 22 0.9913 ubox
+15 20 0.1291 ubox
+17 73 0.1217 ubox
+18 72 0.1091 ubox
+27 43 0.9522 ubox
+28 42 0.9836 ubox
+29 41 0.9874 ubox
+30 40 0.9886 ubox
+31 39 0.9883 ubox
+33 37 0.1014 ubox
+38 73 0.1170 ubox
+39 72 0.1080 ubox
+41 71 0.1523 ubox
+42 70 0.1341 ubox
+43 69 0.1387 ubox
+43 71 0.2800 ubox
+44 68 0.1392 ubox
+44 70 0.3364 ubox
+45 67 0.1266 ubox
+45 68 0.1838 ubox
+45 69 0.3586 ubox
+45 72 0.3252 ubox
+46 67 0.2524 ubox
+46 68 0.3007 ubox
+46 69 0.1142 ubox
+46 71 0.2655 ubox
+47 66 0.2807 ubox
+48 67 0.1394 ubox
+49 65 0.9981 ubox
+50 64 0.9997 ubox
+51 63 0.9997 ubox
+52 62 0.9997 ubox
+53 61 0.9981 ubox
+54 59 0.1565 ubox
+55 60 0.3242 ubox
+showpage
+end
+%%EOF
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnaplot_input1.dbn	Wed Jul 12 14:25:23 2017 -0400
@@ -0,0 +1,3 @@
+>Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC (218800-218872)  Ala (AGC) 73 bp  Sc: 49.55
+UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA
+.((((((..((((........)))).(((((.......))))).....(((((.......))))))))))).. (-21.90)
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnaplot_input1.fa	Wed Jul 12 14:25:23 2017 -0400
@@ -0,0 +1,4 @@
+>Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC (218800-218872)  Ala (AGC) 73 bp  Sc: 49.55
+TGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGTGAGAGGTAGTGGGATCGATGCCCACATTCTCCA
+>Anolis_carolinensis_chrUn_GL343207.trna3-AlaAGC (1513626-1513698)  Ala (AGC) 73 bp  Sc: 56.15
+GGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGCGAGAGGTAGCGGGATTGATGCCCGCATTCTCCA
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnasnoop_input1a.fa	Wed Jul 12 14:25:23 2017 -0400
@@ -0,0 +1,2 @@
+>homo
+CGCGACCUCAGAUCAGACGUGGCGACCCGCUGAAUUUAAGCAUAUUAGUCAGCGGAGGAAAAGAAACUAACCAGGAUUCCCUCAGUAACGGCGAGUGAACAGGGAAGAGCCCAGCGCCGAAUCCCCGCCCCGCGGGGCGCGGGACAUGUGGCGUACGGAAGACCCGCUCCCCGGCGCCGCUCGUGGGGGGCCCAAGUCCUUCUGAUCGAGGCCCAGCCCGUGGACGGUGUGAGGCCGGUAGCGGCCGGCGCGCGCCCGGGUCUUCCCGGAGUCGGGUUGCUUGGGAAUGCAGCCCAAAGCGGGUGGUAAACUCCAUCUAAGGCUAAAUACCGGCACGAGACCGAUAGUCAACAAGUACCGUAAGGGAAAGUUGAAAAGAACUUUGAAGAGAGAGUUCAAGAGGGCGUGAAACCGUUAAGAGGUAAACGGGUGGGGUCCGCGCAGUCCGCCCGGAGGAUUCAACCCGGCGGCGGGUCCGGCCGUGUCGGCGGCCCGGCGGAUCUUUCCCGCCCCCCGUUCCUCCCGACCCCUCCACCCGCCCUCCCUUCCCCCGCCGCCCCUCCUCCUCCUCCCCGGAGGGGGCGGGCUCCGGCGGGUGCGGGGGUGGGCGGGCGGGGCCGGGGGUGGGGUCGGCGGGGGACCGUCCCCCGACCGGCGACCGGCCGCCGCCGGGCGCAUUUCCACCGCGGCGGUGCGCCGCGACCGGCUCCGGGACGGCUGGGAAGGCCCGGCGGGGAAGGUGGCUCGGGGGGCCCCGUCCGUCCGUCCGUCCUCCUCCUCCCCCGUCUCCGCCCCCCGGCCCCGCGUCCUCCCUCGGGAGGGCGCGCGGGUCGGGGCGGCGGCGGCGGCGGCGGUGGCGGCGGCGGCGGGGGCGGCGGGACCGAAACCCCCCCCGAGUGUUACAGCCCCCCCGGCAGCAGCACUCGCCGAAUCCCGGGGCCGAGGGAGCGAGACCCGUCGCCGCGCUCUCCCCCCUCCCGGCGCCCACCCCCGCGGGGAAUCCCCCGCGAGGGGGGUCUCCCCCGCGGGGGCGCGCCGGCGUCUCCUCGUGGGGGGGCCGGGCCACCCCUCCCACGGCGCGACCGCUCUCCCACCCCUCCUCCCCGCGCCCCCGCCCCGGCGACGGGGGGGGUGCCGCGCGCGGGUCGGGGGGCGGGGCGGACUGUCCCCAGUGCGCCCCGGGCGGGUCGCGCCGUCGGGCCCGGGGGAGGUUCUCUCGGGGCCACGCGCGCGUCCCCCGAAGAGGGGGACGGCGGAGCGAGCGCACGGGGUCGGCGGCGACGUCGGCUACCCACCCGACCCGUCUUGAAACACGGACCAAGGAGUCUAACACGUGCGCGAGUCGGGGGCUCGCACGAAAGCCGCCGUGGCGCAAUGAAGGUGAAGGCCGGCGCGCUCGCCGGCCGAGGUGGGAUCCCGAGGCCUCUCCAGUCCGCCGAGGGCGCACCACCGGCCCGUCUCGCCCGCCGCGCCGGGGAGGUGGAGCACGAGCGCACGUGUUAGGACCCGAAAGAUGGUGAACUAUGCCUGGGCAGGGCGAAGCCAGAGGAAACUCUGGUGGAGGUCCGUAGCGGUCCUGACGUGCAAAUCGGUCGUCCGACCUGGGUAUAGGGGCGAAAGACUAAUCGAACCAUCUAGUAGCUGGUUCCCUCCGAAGUUUCCCUCAGGAUAGCUGGCGCUCUCGCAGACCCGACGCACCCCCGCCACGCAGUUUUAUCCGGUAAAGCGAAUGAUUAGAGGUCUUGGGGCCGAAACGAUCUCAACCUAUUCUCAAACUUUAAAUGGGUAAGAAGCCCGGCUCGCUGGCGUGGAGCCGGGCGUGGAAUGCGAGUGCCUAGUGGGCCACUUUUGGUAAGCAGAACUGGCGCUGCGGGAUGAACCGAACGCCGGGUUAAGGCGCCCGAUGCCGACGCUCAUCAGACCCCAGAAAAGGUGUUGGUUGAUAUAGACAGCAGGACGGUGGCCAUGGAAGUCGGAAUCCGCUAAGGAGUGUGUAACAACUCACCUGCCGAAUCAACUAGCCCUGAAAAUGGAUGGCGCUGGAGCGUCGGGCCCAUACCCGGCCGUCGCCGGCAGUCGAGAGUGGACGGGAGCGGCGGGGGCGGCGCGCGCGCGCGCGCGUGUGGUGUGCGUCGGAGGGCGGCGGCGGCGGCGGCGGCGGGGGUGUGGGGUCCUUCCCCCGCCCCCCCCCCCACGCCUCCUCCCCUCCUCCCGCCCACGCCCCGCUCCCCGCCCCCGGAGCCCCGCGGACGCUACGCCGCGACGAGUAGGAGGGCCGCUGCGGUGAGCCUUGAAGCCUAGGGCGCGGGCCCGGGUGGAGCCGCCGCAGGUGCAGAUCUUGGUGGUAGUAGCAAAUAUUCAAACGAGAACUUUGAAGGCCGAAGUGGAGAAGGGUUCCAUGUGAACAGCAGUUGAACAUGGGUCAGUCGGUCCUGAGAGAUGGGCGAGCGCCGUUCCGAAGGGACGGGCGAUGGCCUCCGUUGCCCUCGGCCGAUCGAAAGGGAGUCGGGUUCAGAUCCCCGAAUCCGGAGUGGCGGAGAUGGGCGCCGCGAGGCGUCCAGUGCGGUAACGCGACCGAUCCCGGAGAAGCCGGCGGGAGCCCCGGGGAGAGUUCUCUUUUCUUUGUGAAGGGCAGGGCGCCCUGGAAUGGGUUCGCCCCGAGAGAGGGGCCCGUGCCUUGGAAAGCGUCGCGGUUCCGGCGGCGUCCGGUGAGCUCUCGCUGGCCCUUGAAAAUCCGGGGGAGAGGGUGUAAAUCUCGCGCCGGGCCGUACCCAUAUCCGCAGCAGGUCUCCAAGGUGAACAGCCUCUGGCAUGUUGGAACAAUGUAGGUAAGGGAAGUCGGCAAGCCGGAUCCGUAACUUCGGGAUAAGGAUUGGCUCUAAGGGCUGGGUCGGUCGGGCUGGGGCGCGAAGCGGGGCUGGGCGCGCGCCGCGGCUGGACGAGGCGCGCGCCCCCCCCACGCCCGGGGCACCCCCCUCGCGGCCCUCCCCCGCCCCACCCGCGCGCGCCGCUCGCUCCCUCCCCACCCCGCGCCCUCUCUCUCUCUCUCUCCCCCGCUCCCCGUCCUCCCCCCUCCCCGGGGGAGCGCCGCGUGGGGGCGCGGCGGGGGGAGAAGGGUCGGGGCGGCAGGGGCCGCGCGGCGGCCGCCGGGGCGGCCGGCGGGGGCAGGUCCCCGCGAGGGGGGCCCCGGGGACCCGGGGGGCCGGCGGCGGCGCGGACUCUGGACGCGAGCCGGGCCCUUCCCGUGGAUCGCCCCAGCUGCGGCGGGCGUCGCGGCCGCCCCCGGGGAGCCCGGCGGCGGCGCGGCGCGCCCCCCACCCCCACCCCACGUCUCGGUCGCGCGCGCGUCCGCUGGGGGCGGGAGCGGUCGGGCGGCGGCGGUCGGCGGGCGGCGGGGCGGGGCGGUUCGUCCCCCCGCCCUACCCCCCCGGCCCCGUCCGCCCCCCGUUCCCCCCUCCUCCUCGGCGCGCGGCGGCGGCGGCGGCAGGCGGCGGAGGGGCCGCGGGCCGGUCCCCCCCGCCGGGUCCGCCCCCGGGGCCGCGGUUCCGCGCGCGCCUCGCCUCGGCCGGCGCCUAGCAGCCGACUUAGAACUGGUGCGGACCAGGGGAAUCCGACUGUUUAAUUAAAACAAAGCAUCGCGAAGGCCCGCGGCGGGUGUUGACGCGAUGUGAUUUCUGCCCAGUGCUCUGAAUGUCAAAGUGAAGAAAUUCAAUGAAGCGCGGGUAAACGGCGGGAGUAACUAUGACUCUCUUAAGGUAGCCAAAUGCCUCGUCAUCUAAUUAGUGACGCGCAUGAAUGGAUGAACGAGAUUCCCACUGUCCCUACCUACUAUCCAGCGAAACCACAGCCAAGGGAACGGGCUUGGCGGAAUCAGCGGGGAAAGAAGACCCUGUUGAGCUUGACUCUAGUCUGGCACGGUGAAGAGACAUGAGAGGUGUAGAAUAAGUGGGAGGCCCCCGGCGCCCCCCCGGUGUCCCCGCGAGGGGCCCGGGGCGGGGUCCGCGGCCCUGCGGGCCGCCGGUGAAAUACCACUACUCUGAUCGUUUUUUCACUGACCCGGUGAGGCGGGGGGGCGAGCCCGAGGGGCUCUCGCUUCUGGCGCCAAGCGCCCGCCCGGCCGGGCGCGACCCGCUCCGGGGACAGUGCCAGGUGGGGAGUUUGACUGGGGCGGUACACCUGUCAAACGGUAACGCAGGUGUCCUAAGGCGAGCUCAGGGAGGACAGAAACCUCCCGUGGAGCAGAAGGGCAAAAGCUCGCUUGAUCUUGAUUUUCAGUACGAAUACAGACCGUGAAAGCGGGGCCUCACGAUCCUUCUGACCUUUUGGGUUUUAAGCAGGAGGUGUCAGAAAAGUUACCACAGGGAUAACUGGCUUGUGGCGGCCAAGCGUUCAUAGCGACGUCGCUUUUUGAUCCUUCGAUGUCGGCUCUUCCUAUCAUUGUGAAGCAGAAUUCGCCAAGCGUUGGAUUGUUCACCCACUAAUAGGGAACGUGAGCUGGGUUUAGACCGUCGUGAGACAGGUUAGUUUUACCCUACUGAUGAUGUGUUGUUGCCAUGGUAAUCCUGCUCAGUACGAGAGGAACCGCAGGUUCAGACAUUUGGUGUAUGUGCUUGGCUGAGGAGCCAAUGGGGCGAAGCUACCAUCUGUGGGAUUAUGACUGAACGCCUCUAAGUCAGAAUCCCGCCCAGGCGAACGAUACGGCAGCGCCGCGGAGCCUCGGUUGGCCUCGGAUAGCCGGUCCCCCGCCUGUCCCCGCCGGCGGGCCGCCCCCCCCUCCACGCGCCCCGCCGCGGGAGGGCGCGUGCCCCGCCGCGCGCCGGGACCGGGGUCCGGUGCGGAGUGCCCUUCGUCCUGGGAAACGGGGCGCGGCCGGAAAGGCGGCCGCCCCCUCGCCCGUCACGCACCGCACGUUCGUGGGGAACCUGGCGCUAAACCAUUCGUAGACGACCUGCUUCUGGGUCGGGGUUUCGUACGUAGCAGAGCAGCUCCCUCGCUGCGAUCUAUUGAAAGUCAGCCCUCGACACAAGGGUUUGUC
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnasnoop_input1b.fa	Wed Jul 12 14:25:23 2017 -0400
@@ -0,0 +1,2 @@
+>ACA51
+AACCTACCCCATATACACCTCAGCTCAGGCCCTGTGCCTGGTCTGTATTGTGAATGGGGGAACATAG
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnasnoop_result1.txt	Wed Jul 12 14:25:23 2017 -0400
@@ -0,0 +1,4 @@
+>ACA51
+>homo
+<<<<<.<<<<.|.<<.<<<&...(((>>>.>>.((((...............................))))..>>>>.>>>>>))) 4468,4486;4479 :   8,65  (-35.60 = -16.10 + -7.60 + -12.40 + -3.60 + 4.1 ) (-23.60) 
+UGUUCACCCACUAAUAGGG&AACCUACCCCAUAUACACCUCAGCUCAGGCCCUGUGCCUGGUCUGUAUUGUGAAUGGGGGAACAUAG
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnasubopt_input1.fa	Wed Jul 12 14:25:23 2017 -0400
@@ -0,0 +1,4 @@
+>Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC (218800-218872)  Ala (AGC) 73 bp  Sc: 49.55
+TGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGTGAGAGGTAGTGGGATCGATGCCCACATTCTCCA
+>Anolis_carolinensis_chrUn_GL343207.trna3-AlaAGC (1513626-1513698)  Ala (AGC) 73 bp  Sc: 56.15
+GGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGCGAGAGGTAGCGGGATTGATGCCCGCATTCTCCA
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnasubopt_result1.txt	Wed Jul 12 14:25:23 2017 -0400
@@ -0,0 +1,7 @@
+>Anolis_carolinensis_chrUn_GL343590.trna2-A [0]
+UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA -22.00   0.00
+(((((((..((((........)))).(((((.......))))).....(((((.......))))))))).))) -22.00
+.((((((..((((........)))).(((((.......))))).....(((((.......))))))))))).. -22.00
+>Anolis_carolinensis_chrUn_GL343207.trna3-A [0]
+GGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGCGAGAGGUAGCGGGAUUGAUGCCCGCAUUCUCCA -29.60   0.00
+(((((((..((((........)))).(((((.......))))).....(((((.......)))))))))))). -29.60
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnaup_input1.fa	Wed Jul 12 14:25:23 2017 -0400
@@ -0,0 +1,4 @@
+>Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC (218800-218872)  Ala (AGC) 73 bp  Sc: 49.55
+TGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGTGAGAGGTAGTGGGATCGATGCCCACATTCTCCA
+>Anolis_carolinensis_chrUn_GL343207.trna3-AlaAGC (1513626-1513698)  Ala (AGC) 73 bp  Sc: 56.15
+GGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGCGAGAGGTAGCGGGATTGATGCCCGCATTCTCCA
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnaup_result1.txt	Wed Jul 12 14:25:23 2017 -0400
@@ -0,0 +1,6 @@
+>Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC
+  55,  58 	 (0.019) 	 for u=  4
+RNAup output in file: Anolis_carolinensis_chrUn_GL343590.trna2-A_u1.out
+>Anolis_carolinensis_chrUn_GL343207.trna3-AlaAGC
+  16,  19 	 (0.004) 	 for u=  4
+RNAup output in file: Anolis_carolinensis_chrUn_GL343207.trna3-A_u1.out
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/sample_3.fa	Wed Jul 12 14:25:23 2017 -0400
@@ -0,0 +1,6 @@
+>SECIS_1 test
+AUUUUAUCCAUGAAAGUGUUUCCUCUAAACCUAUGUGGAGGAACACCUGAUGUCCAGGAAAAU
+>6S_1 test1
+GAAACCCUAAUGUAUUCGAUAUAGUUCCUGAUAUUUUUGAACCGAACAAUUUUUUAUACCUAGGGAGCUUGGAGUUCCGGCGCGGCGCACAUGCCUUCACACGAGGAAGUGCAAACCGUUAGACAGAGCACCCACCUGCUUUAAUUGAGAGCGGGUUCAAAGGAAGGGAAUCCUAAACGGUACGAUUGGGGUUUCU
+>6S_2
+UUGUCCCUGCCGUGCUCGUGACUUGGCCAUACAUUCUCUGAACCUAUGUCUUACGGCAUAUGGGUUGCGGGAGUGUAGAGCUGGAGUGAUCGUCUACUCGUAGACGAACCCGAUGCUCUUCGGAUCGCGACCACCUUGAACCUCAGGGUUCGAGAUGCCGGCCUUGACGGCACAGGCGGGGCAUC
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/sample_3.react	Wed Jul 12 14:25:23 2017 -0400
@@ -0,0 +1,447 @@
+>SECIS_1	
+1	0.0657466222
+2	0.1280448842
+3	0.2786665403
+4	0.1391216354
+5	0.0272299574
+6	0.1717063095
+7	0.488732281
+8	3.3015172695
+9	0.414494604
+10	0.1957445189
+11	0.4670328791
+12	0.1943420556
+13	0.2099109521
+14	0.5846784488
+15	0.1296563697
+16	0.0359267698
+17	0.0438238841
+18	1.6364597431
+19	1.72206594665E-17
+20	0.0099928394
+21	0.0475042774
+22	0.0065948845
+23	0.0574522715
+24	0.2126102485
+25	1.2006488448
+26	0.6040825271
+27	0.4114049219
+28	1.1514597937
+29	1.216707413
+30	0.0186005737
+31	0.0841609069
+32	0.086771667
+33	1.1672973211
+34	0.8144419625
+35	0.2583987716
+36	0.0182542709
+37	0.0875979754
+38	0.094456587
+39	0.5206337515
+40	0.000517531
+41	0.0253820905
+42	0.2076338063
+43	0.0087295599
+44	0.0129264641
+45	0.0127365182
+46	0.1193338151
+47	0.0186183812
+48	0.3581141112
+49	0.0941009884
+50	0.2050905673
+51	0.0209195644
+52	0.6030952711
+53	5.2129588113
+54	0.1747678483
+55	1.2231479801
+56	0.4978854319
+57	0.5711590135
+58	0.2793524314
+59	0.0037936012
+60	0.2158137729
+61	0.5646393912
+62	0.6229186627
+63	0.0193621982
+>6S_1	
+1	0.1158690877
+2	0.0774028501
+3	0.2349947573
+4	1.72206594665E-17
+5	0.0926174169
+6	0.0505177415
+7	0.0457131819
+8	0.0194615986
+9	2.1495069267
+10	0.0409639397
+11	0.2185631969
+12	0.1776745985
+13	0.0086422926
+14	0.0241577615
+15	0.0092855631
+16	0.3453240509
+17	0.1535840586
+18	0.0180643958
+19	0.1188776616
+20	0.3091581196
+21	0.3748109806
+22	0.6187506508
+23	0.3511511383
+24	0.6512026704
+25	0.3096370415
+26	0.5283368492
+27	0.7500060952
+28	0.0352720444
+29	0.3776026196
+30	0.3489100484
+31	1.3035405919
+32	0.1023638167
+33	0.133082988
+34	0.0024118398
+35	0.0281166587
+36	0.2818828676
+37	0.1316060603
+38	0.1813992598
+39	0.0047490217
+40	0.0204058553
+41	0.0675891142
+42	0.045119933
+43	0.0266727645
+44	0.0673921107
+45	0.0085752561
+46	0.495476266
+47	0.8224799434
+48	0.5574272341
+49	0.2431151153
+50	0.256015696
+51	0.0386339787
+52	0.6618567864
+53	0.0707284393
+54	1.1215284869
+55	0.0463423016
+56	0.3338809513
+57	0.3987796157
+58	1.1046527917
+59	0.6156154318
+60	0.1179259769
+61	2.0333569471
+62	0.1224421595
+63	0.0266055429
+64	0.0298356423
+65	0.3004015135
+66	2.1966900004
+67	0.0222153137
+68	0.0095300422
+69	0.0503009918
+70	0.0418994997
+71	0.0384566069
+72	2.6211662666
+73	0.1704872628
+74	0.8386436572
+75	0.6961218859
+76	0.1995308419
+77	0.0552442152
+78	0.1937915065
+79	0.1239592493
+80	0.0782601391
+81	0.0138965117
+82	0.0231978646
+83	0.0150709773
+84	0.4084290821
+85	0.0792668417
+86	1.0630476211
+87	0.2524739666
+88	0.0229636507
+89	0.1153934877
+90	0.2693801005
+91	0.0071337145
+92	1.0279231796
+93	0.0574241281
+94	0.103312087
+95	0.2100864561
+96	0.0252070712
+97	0.6067864142
+98	0.0607860625
+99	0.5416948523
+100	0.7090251541
+101	2.0470096713
+102	0.0368697578
+103	0.1221648319
+104	0.0484836208
+105	0.7188621431
+106	0.2405585888
+107	0.1071170724
+108	0.6859305671
+109	0.0997679124
+110	0.0342400356
+111	0.0201635
+112	0.4527960874
+113	0.7018417748
+114	0.2561295384
+115	0.2788440973
+116	0.2437240042
+117	0.0984135237
+118	0.1146045041
+119	0.2116296362
+120	0.0360702095
+121	0.2006613525
+122	0.0635994434
+123	0.8384420629
+124	0.3546527057
+125	0.014380068
+126	0.0041004554
+127	0.2404132813
+128	0.0016204246
+129	0.016365643
+130	0.0025333389
+131	0.0207130798
+132	0.2199275512
+133	0.2973627433
+134	1.7680018464
+135	0.3120917444
+136	0.854288287
+137	0.4309335923
+138	2.3003988746
+139	0.047166557
+140	0.7391255635
+141	0.1357653755
+142	0.4672659386
+143	0.3601080698
+144	0.9111911856
+145	0.7435427597
+146	0.3353115579
+147	1.0513358906
+148	0.1406855309
+149	0.3543459659
+150	0.0561408821
+151	0.563013834
+152	0.1549691284
+153	0.7460309808
+154	0.0486849156
+155	0.1080587915
+156	0.0699642772
+157	0.4423435657
+158	0.0171555252
+159	0.0064557797
+160	0.4739275466
+161	0.2617128164
+162	0.0879369647
+163	0.0062762841
+164	0.1060085461
+165	0.0971932081
+166	0.3139785044
+167	0.0771649003
+168	0.0753029618
+169	0.5676607679
+170	0.9836368904
+171	0.6193661835
+172	0.3890022353
+173	0.3304911731
+174	0.9354752573
+175	2.5683088408
+176	0.6777050636
+177	0.0195000778
+178	0.0532349161
+179	0.0993391181
+180	0.0667310411
+181	0.0123690861
+182	0.0165201319
+183	0.2056431695
+184	0.0114477122
+185	0.1684423923
+186	0.6236165725
+187	0.2533573459
+188	7.4644850979
+189	1.72206594665E-17
+190	0.0510513818
+191	0.071993023
+192	0.093087642
+193	0.026770297
+194	0.1003921418
+195	0.731799564
+196	0.3882654324
+>6S_2	
+1	5.135077189
+2	0.0137794619
+3	0.0198585136
+4	0.0394762621
+5	0.1032256038
+6	0.0124879331
+7	0.050343991
+8	0.0266906427
+9	0.0867862234
+10	0.0250443701
+11	0.1241682715
+12	0.0888505404
+13	1.72206594665E-17
+14	0.0443782398
+15	0.0331749933
+16	1.190843321
+17	0.0083605324
+18	0.1025127456
+19	0.0318835351
+20	0.6764653014
+21	1.6659553696
+22	0.0532195755
+23	0.1306535914
+24	3.2368938797
+25	0.2999875752
+26	0.1771608894
+27	0.0735275063
+28	1.1463641343
+29	0.3436951718
+30	0.6339043401
+31	0.8229568123
+32	0.0567986298
+33	0.3413998482
+34	0.1291037675
+35	0.561127074
+36	0.0076983354
+37	0.147000237
+38	0.0214390185
+39	0.5304305785
+40	0.0785507542
+41	0.0483731004
+42	0.0976091996
+43	1.2125480978
+44	0.1865263845
+45	0.6312459899
+46	0.1817958047
+47	2.8617198725
+48	0.2055922577
+49	1.3068827801
+50	0.2629492567
+51	0.8571308379
+52	0.2726647331
+53	1.129084224
+54	0.275119436
+55	0.5874419445
+56	0.3657294569
+57	0.2500734975
+58	1.0443534711
+59	4.5331285532
+60	0.2551985691
+61	0.1800315837
+62	1.2079574507
+63	0.1377332438
+64	0.034281766
+65	0.0098202871
+66	0.9938878178
+67	0.0331980613
+68	0.2884058117
+69	0.1471099733
+70	0.0250835628
+71	0.0040433138
+72	2.1207460501
+73	0.7413016698
+74	0.2856087978
+75	0.1043896327
+76	2.5426831833
+77	0.024753755
+78	0.0197741979
+79	0.0256614712
+80	0.0931195919
+81	0.2341548619
+82	0.9442989
+83	0.6902004027
+84	0.2615426874
+85	0.1968596889
+86	0.1317761893
+87	0.3101105886
+88	0.3109082689
+89	0.6036478733
+90	0.1383132052
+91	1.72206594665E-17
+92	1.3701244222
+93	0.0259262955
+94	0.0427849321
+95	0.0059202715
+96	0.4620195968
+97	1.1627066739
+98	0.1193652803
+99	0.5039174355
+100	0.7685843498
+101	3.3504451177
+102	0.0156110762
+103	0.0405202895
+104	0.0448853051
+105	0.1130352336
+106	0.0128895533
+107	0.0140152443
+108	0.8487385272
+109	0.5411302314
+110	0.1921994675
+111	0.0804367301
+112	2.1393979849
+113	0.657192459
+114	0.9680746376
+115	0.0181673032
+116	0.1293355582
+117	0.0385348779
+118	0.0599847607
+119	0.0286153267
+120	0.0529816257
+121	0.0738905329
+122	1.9826160191
+123	0.6850277412
+124	0.0240149916
+125	0.1003714264
+126	0.0282377438
+127	0.016091267
+128	0.0654324545
+129	1.3672926211
+130	0.3123897874
+131	0.0125997931
+132	0.0326682275
+133	0.8141700098
+134	2.7208263459
+135	0.9376426669
+136	0.2104407859
+137	0.9213456642
+138	0.9496557623
+139	0.0158974709
+140	1.0394051723
+141	3.395502997
+142	0.2786545217
+143	0.0944673368
+144	0.1658691067
+145	1.5138095878
+146	0.2388473327
+147	0.0071582802
+148	0.0399196127
+149	0.0269685694
+150	0.0343298406
+151	0.0260244978
+152	0.1131275763
+153	0.0217325853
+154	0.1015784545
+155	0.0991349861
+156	1.4195713543
+157	0.5085589945
+158	0.1250938659
+159	0.788081555
+160	0.1135816768
+161	0.0633806979
+162	2.7826494
+163	1.8003487205
+164	0.7686439584
+165	0.0397996113
+166	0.8340757785
+167	0.0060961894
+168	0.0003936337
+169	0.0179660084
+170	0.033466093
+171	0.0469772809
+172	0.1070226766
+173	0.3447929483
+174	0.8559366126
+175	0.1279778477
+176	0.2188243998
+177	0.0449863446
+178	0.0382790499
+179	0.0022221768
+180	0.0311889472
+181	0.0257878168
+182	0.0172539125
+183	0.2710934097
+184	0.0914500662
+185	0.208503114
\ No newline at end of file
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/sample_3_result.txt	Wed Jul 12 14:25:23 2017 -0400
@@ -0,0 +1,9 @@
+>SECIS_1
+AUUUUAUCCAUGAAAGUGUUUCCUCUAAACCUAUGUGGAGGAACACCUGAUGUCCAGGAAAAU
+.((((...(((.(..(((.((((((((........))))))))))).).))).....)))).. (-27.97)
+>6S_1
+GAAACCCUAAUGUAUUCGAUAUAGUUCCUGAUAUUUUUGAACCGAACAAUUUUUUAUACCUAGGGAGCUUGGAGUUCCGGCGCGGCGCACAUGCCUUCACACGAGGAAGUGCAAACCGUUAGACAGAGCACCCACCUGCUUUAAUUGAGAGCGGGUUCAAAGGAAGGGAAUCCUAAACGGUACGAUUGGGGUUUCU
+(((((((...(((((.((.....((((((....((((((((((...................(((.((((.....((.((((.(..((((.(.((((.....))))).))))...))))).))..)))).)))....(((((.....))))).))))))))))..))))))......)))))))....))))))). (-110.38)
+>6S_2
+UUGUCCCUGCCGUGCUCGUGACUUGGCCAUACAUUCUCUGAACCUAUGUCUUACGGCAUAUGGGUUGCGGGAGUGUAGAGCUGGAGUGAUCGUCUACUCGUAGACGAACCCGAUGCUCUUCGGAUCGCGACCACCUUGAACCUCAGGGUUCGAGAUGCCGGCCUUGACGGCACAGGCGGGGCAUC
+.((.(((((((((((.(((.(...((((...((.((((.((((((..(((....))).....((((((((...((.(((((.((.((..((((((......))))))))))...))))).))..)))))))).............))))))))))))..)))).).))))))).))))))))).. (-129.27)
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/test_sequence_input.fasta	Wed Jul 12 14:25:23 2017 -0400
@@ -0,0 +1,2 @@
+>test_seq
+ACAGGUUCGCCUGUGUUGCGAACCUGCGGGUUCG
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/trajectory_result.tabular	Wed Jul 12 14:25:23 2017 -0400
@@ -0,0 +1,10 @@
+..(((....)))	-0.4	0.0550686	3.9	6.46108	12	
+.((((....))))	-3	0.0600001	5.96046e-09	6.46108	13
+(((((....)))))	-4.7	0.065	0	6.46108	14
+(((((....)))))..((((....))))	-5.3	0.135069	3.9	6.46108	28
+(((((....))))).(((((....)))))	-5.8	0.14	1.90735e-07	6.46108	29
+(((((....))))).......(((....)))...	-6.9	0.17246	6.7	7.46108	34
+(((((....)))))......((((....))))..	-7.8	0.17246	9.53674e-08	7.46108	34
+(((((....))))).....(((((....))))).	-10.7	0.17246	1.90735e-07	7.46108	34
+(((((....)))))....((((((....))))))	-13.1	0.17246	-1.90735e-07	7.46108	34
+.(((((((((.......)))))))))........	-13.6	123.457	12.5	13	34
Binary file vienna_rna.tar.gz has changed