Mercurial > repos > rnateam > viennarna_rnafold

comparison rnafold.xml @ 2:84aad99aca1f draft

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/rna_tools/vienna_rna commit b'bd13ffd1c3e126a6dc59dd3c478347ec1b5824a3\n'
author rnateam
date Tue, 16 May 2017 16:30:38 -0400
parents f87325531be8
children fcf2463f85c1
comparison
equal deleted inserted replaced
1:f87325531be8 2:84aad99aca1f
1 <tool id="viennarna_rnafold" name="@EXECUTABLE@" version="@VERSION@.0"> 1 <tool id="viennarna_rnafold" name="@EXECUTABLE@" version="@VERSION@.1">
2 <description>Calculate minimum free energy secondary structures and partition function of RNAs</description> 2 <description>Calculate minimum free energy secondary structures and partition function of RNAs</description>
3 <macros> 3 <macros>
4 <token name="@EXECUTABLE@">RNAfold</token> 4 <token name="@EXECUTABLE@">RNAfold</token>
5 <import>macros.xml</import> 5 <import>macros.xml</import>
6 </macros> 6 </macros>
7 <expand macro="requirements" /> 7 <expand macro="requirements">
8 <requirement type="package" version="1.65">biopython</requirement>
9 </expand>
8 <expand macro="stdio" /> 10 <expand macro="stdio" />
9 <expand macro="version_command" /> 11 <expand macro="version_command" />
10 <command> 12 <command>
11 <![CDATA[ 13 <![CDATA[
12 #if str($input_source.select_fasta) == "false" 14 #if str($input_source.select_fasta) == "false"
13 #if str($input_source.input_sequence).lstrip()[0] == ">" 15 #if str($input_source.input_sequence).lstrip()[0] == ">"
14 echo "${input_source.input_sequence}" > "input.fasta" && 16 echo '${input_source.input_sequence}' > "input.fasta" &&
15 #else 17 #else
16 echo ">Sequence" > "input.fasta" && 18 echo ">Sequence" > "input.fasta" &&
17 echo "${input_source.input_sequence}" >> "input.fasta" && 19 echo '${input_source.input_sequence}' >> "input.fasta" &&
18 #end if 20 #end if
19 #end if 21 #end if
20 RNAfold 22
23 #if str($constraints.shapeOption.shapeSelector) == "isUsed"
24 python '$__tool_directory__/rnafold_SHAPE.py'
25 #else
26 RNAfold
27 #end if
28
21 -T $temperature 29 -T $temperature
22 --dangles=$dangling 30 --dangles=$dangling
23 #if $layout_type ==0 31 #if $layout_type ==0
24 --layout-type=$general_options.layout_type 32 --layout-type=$general_options.layout_type
25 #end if 33 #end if
31 #else 39 #else
32 $measelect.pf 40 $measelect.pf
33 #if $measelect.pfScale <> 1.07 41 #if $measelect.pfScale <> 1.07
34 --pfScale=$measelect.pfScale 42 --pfScale=$measelect.pfScale
35 #end if 43 #end if
36 #end if 44 #end if
37 $advancedOptions.noconversion 45 $advancedOptions.noconversion
38 $advancedOptions.gquad 46 $advancedOptions.gquad
39 $advancedOptions.nolp 47 $advancedOptions.nolp
40 $advancedOptions.nogu 48 $advancedOptions.nogu
41 $advancedOptions.noclosinggu 49 $advancedOptions.noclosinggu
47 #if $advancedOptions.nsp 55 #if $advancedOptions.nsp
48 --nsp='$advancedOptions.nsp' 56 --nsp='$advancedOptions.nsp'
49 #end if 57 #end if
50 #if $advancedOptions.betaScale <> 1.0 58 #if $advancedOptions.betaScale <> 1.0
51 --betaScale=$advancedOptions.betaScale 59 --betaScale=$advancedOptions.betaScale
52 #end if 60 #end if
53 #if $constraints.maxBPspan <> -1 61 #if $constraints.maxBPspan <> -1
54 --maxBPspan=$constraints.maxBPspan 62 --maxBPspan=$constraints.maxBPspan
55 #end if 63 #end if
56 #if str($constraints.constraintLocation.constraintSelector) == "fromFile" 64 #if str($constraints.constraintLocation.constraintSelector) == "fromFile"
57 --constraint='$constraints.constraintLocation.constraintsFile' 65 --constraint='$constraints.constraintLocation.constraintsFile'
67 #if str($constraints.shapeOption.shapeMethod.methodSelector) == "W" 75 #if str($constraints.shapeOption.shapeMethod.methodSelector) == "W"
68 #set $s="W" 76 #set $s="W"
69 --shapeMethod=$s 77 --shapeMethod=$s
70 #else if str($constraints.shapeOption.shapeMethod.methodSelector) == "Z" 78 #else if str($constraints.shapeOption.shapeMethod.methodSelector) == "Z"
71 #set $s="Zb"+str($constraints.shapeOption.shapeMethod.b) 79 #set $s="Zb"+str($constraints.shapeOption.shapeMethod.b)
72 --shapeMethod=$s 80 --shapeMethod=$s
73 #if str($constraints.shapeOption.shapeMethod.shapeConversion.conversionSelector) == "C" 81 #if str($constraints.shapeOption.shapeMethod.shapeConversion.conversionSelector) == "C"
74 #set $c="C"+str($constraints.shapeOption.shapeMethod.shapeConversion.c) 82 #set $c="C"+str($constraints.shapeOption.shapeMethod.shapeConversion.c)
75 --shapeConversion=$c 83 --shapeConversion=$c
76 #else if str($constraints.shapeOption.shapeMethod.shapeConversion.conversionSelector) == "L" 84 #else if str($constraints.shapeOption.shapeMethod.shapeConversion.conversionSelector) == "L"
77 #set $c="Ls"+str($constraints.shapeOption.shapeMethod.shapeConversion.s)+"i"+ str($constraints.shapeOption.shapeMethod.shapeConversion.i) 85 #set $c="Ls"+str($constraints.shapeOption.shapeMethod.shapeConversion.s)+"i"+ str($constraints.shapeOption.shapeMethod.shapeConversion.i)
88 --shapeMethod=$s 96 --shapeMethod=$s
89 #end if 97 #end if
90 #end if 98 #end if
91 #if $constraints.motif 99 #if $constraints.motif
92 --motif='$constraints.motif' 100 --motif='$constraints.motif'
93 #end if 101 #end if
94 < 102 <
95 #if str($input_source.select_fasta) == "false" 103 #if str($input_source.select_fasta) == "false"
96 "input.fasta" 104 "input.fasta"
97 #else 105 #else
98 "${input_source.fasta_input}" 106 "${input_source.fasta_input}"
99 #end if 107 #end if
118 <param name="dangling" type="select" label="How to treat dangling end energies" argument="-d"> 126 <param name="dangling" type="select" label="How to treat dangling end energies" argument="-d">
119 <option value="0">0: ignore dangling ends</option> 127 <option value="0">0: ignore dangling ends</option>
120 <option value="1">1: unpaired bases participate in one dangling end only</option> 128 <option value="1">1: unpaired bases participate in one dangling end only</option>
121 <option value="2" selected="True">2: unpaired bases participate in all dangling ends</option> 129 <option value="2" selected="True">2: unpaired bases participate in all dangling ends</option>
122 <option value="3">3: allow coaxial stacking</option> 130 <option value="3">3: allow coaxial stacking</option>
123 </param> 131 </param>
124 <param name="layout_type" type="select" label="Layout algorithm" argument="--layout_type" > 132 <param name="layout_type" type="select" label="Layout algorithm" argument="--layout_type" >
125 <option value="1" selected="true">Default: Naview layout</option> 133 <option value="1" selected="true">Default: Naview layout</option>
126 <option value="0">Simple radial layout</option> 134 <option value="0">Simple radial layout</option>
127 </param> 135 </param>
128 <conditional name="measelect"> 136 <conditional name="measelect">
129 <param name="mea" type="select" label="Calculate Maximum Expected accuracy" argument="--MEA"> 137 <param name="mea" type="select" label="Calculate Maximum Expected accuracy" argument="--MEA">
130 <option value="no">No</option> 138 <option value="no">No</option>
131 <option value="yes">Yes</option> 139 <option value="yes">Yes</option>
132 </param> 140 </param>
136 </when> 144 </when>
137 <when value="no"> 145 <when value="no">
138 <param name="pf" type="boolean" checked="false" truevalue="--partfunc" falsevalue="" label="Calculate Partition Function" help="--partfunc"/> 146 <param name="pf" type="boolean" checked="false" truevalue="--partfunc" falsevalue="" label="Calculate Partition Function" help="--partfunc"/>
139 <param argument="--pfScale" type="float" value="1.07" label="Scaling factor" help="In the calculation of the pf use scale*mfe as an estimate for the ensemble free energy (used to avoid overflows). The default is 1.07, useful values are 1.0 to 1.2. Occasionally needed for long sequences."/> 147 <param argument="--pfScale" type="float" value="1.07" label="Scaling factor" help="In the calculation of the pf use scale*mfe as an estimate for the ensemble free energy (used to avoid overflows). The default is 1.07, useful values are 1.0 to 1.2. Occasionally needed for long sequences."/>
140 </when> 148 </when>
141 </conditional> 149 </conditional>
142 <section name="advancedOptions" title="Advanced options"> 150 <section name="advancedOptions" title="Advanced options">
143 <param name="nolp" type="boolean" truevalue="" falsevalue="--noLP" checked="true" label="Allow lonely base-pairs" help="(--noLP)"/> 151 <param name="nolp" type="boolean" truevalue="" falsevalue="--noLP" checked="true" label="Allow lonely base-pairs" help="(--noLP)"/>
144 <param name="nogu" type="boolean" truevalue="" falsevalue="--noGU" checked="true" label="Allow GU pairing" help="--noGU"/> 152 <param name="nogu" type="boolean" truevalue="" falsevalue="--noGU" checked="true" label="Allow GU pairing" help="--noGU"/>
145 <param name="noclosinggu" type="boolean" truevalue="" falsevalue="--noClosingGU" checked="true" label="Allow GU pairing at the ends" help="Allow pairing of G and U at the ends of helices. --noClosingGU"/> 153 <param name="noclosinggu" type="boolean" truevalue="" falsevalue="--noClosingGU" checked="true" label="Allow GU pairing at the ends" help="Allow pairing of G and U at the ends of helices. --noClosingGU"/>
146 <param name="notetra" type="boolean" truevalue="" falsevalue="--noTetra" checked="true" label="Allow stabilization for loops, hairpins etc." help=" Include special tabulated stabilizing energies for tri-, tetra- and hexaloop hairpins. Mostly for testing. (--noTetra)"/> 154 <param name="notetra" type="boolean" truevalue="" falsevalue="--noTetra" checked="true" label="Allow stabilization for loops, hairpins etc." help=" Include special tabulated stabilizing energies for tri-, tetra- and hexaloop hairpins. Mostly for testing. (--noTetra)"/>
157 truevalue="--circ" 165 truevalue="--circ"
158 falsevalue="" 166 falsevalue=""
159 checked="false" 167 checked="false"
160 label="Model as circular RNA structure" 168 label="Model as circular RNA structure"
161 argument="--circ"/> 169 argument="--circ"/>
162 <param name="bppmThreshold" 170 <param name="bppmThreshold"
163 type="float" 171 type="float"
164 value="1e-5" 172 value="1e-5"
165 label="Threshold for base pair probabilities" 173 label="Threshold for base pair probabilities"
166 help="By setting the threshold the base pair probabilities that are included in the output can be varied. By default only those exceeding 1e−5 in probability will be shown as squares in the dot plot. Changing the threshold to any other value allows for increase or decrease of data." 174 help="By setting the threshold the base pair probabilities that are included in the output can be varied. By default only those exceeding 1e−5 in probability will be shown as squares in the dot plot. Changing the threshold to any other value allows for increase or decrease of data."
167 argument="--bppmThreshold"/> 175 argument="--bppmThreshold"/>
168 <param name="nsp" 176 <param name="nsp"
169 type="text" 177 type="text"
170 value="" 178 value=""
171 label="Allow other pairs in addition to the usual AU,GC,and GU pairs." 179 label="Allow other pairs in addition to the usual AU,GC,and GU pairs."
172 help="Its argument is a comma separated list of additionally allowed pairs. If the first character is '-' then AB will imply that AB and BA are allowed pairs. e.g. RNAfold -nsp -GA will allow GA and AG pairs. Nonstandard pairs are given 0 stacking energy." 180 help="Its argument is a comma separated list of additionally allowed pairs. If the first character is '-' then AB will imply that AB and BA are allowed pairs. e.g. RNAfold -nsp -GA will allow GA and AG pairs. Nonstandard pairs are given 0 stacking energy."
173 argument="--nsp"/> 181 argument="--nsp"/>
174 <param name="betaScale" 182 <param name="betaScale"
175 type="float" 183 type="float"
176 value="1.0" 184 value="1.0"
177 label="Scaling of Boltzman factors" 185 label="Scaling of Boltzman factors"
178 help=" The argument provided with this option enables to scale the thermodynamic temperature used in the Boltzmann factors independently from the temperature used to scale the individual energy contributions of the loop types." 186 help=" The argument provided with this option enables to scale the thermodynamic temperature used in the Boltzmann factors independently from the temperature used to scale the individual energy contributions of the loop types."
179 argument="--betaScale"/> 187 argument="--betaScale"/>
180 </section> 188 </section>
181 <section name="constraints" title="Structure constraints"> 189 <section name="constraints" title="Structure constraints">
182 <param name="maxBPspan" type="integer" value="-1" label="Set the maximum base pair span" help="" argument="--maxBPspan"/> 190 <param name="maxBPspan" type="integer" value="-1" label="Set the maximum base pair span" help="" argument="--maxBPspan"/>
183 <conditional name="constraintLocation"> 191 <conditional name="constraintLocation">
184 <param name="constraintSelector" type="select" label="Constraints"> 192 <param name="constraintSelector" type="select" label="Constraints">
185 <!-- <option value="fromInput">The constraints are included in the input file</option> --> 193 <!-- <option value="fromInput">The constraints are included in the input file</option> -->
190 <!-- <when value="fromInput"></when> --> 198 <!-- <when value="fromInput"></when> -->
191 <when value="none"></when> 199 <when value="none"></when>
192 <when value="inFile"></when> 200 <when value="inFile"></when>
193 <when value="fromFile"> 201 <when value="fromFile">
194 <param name="constraintsFile" type="data" format="*" label="Constraints file" argument="--constraint"/> 202 <param name="constraintsFile" type="data" format="*" label="Constraints file" argument="--constraint"/>
195 <param name="batch" type="boolean" checked="false" truevalue="--batch" falsevalue="" 203 <param name="batch" type="boolean" checked="false" truevalue="--batch" falsevalue=""
196 label="Use constraints for all alignment records" 204 label="Use constraints for all alignment records"
197 help="Usually, constraints provided from input file are only applied to a single sequence alignment. Therefore, RNAalifold will stop its computation and quit after the first input alignment was processed. Using this switch, RNAfold processes all sequence alignments in the input and applies the same provided constraints to each of them." 205 help="Usually, constraints provided from input file are only applied to a single sequence alignment. Therefore, RNAalifold will stop its computation and quit after the first input alignment was processed. Using this switch, RNAfold processes all sequence alignments in the input and applies the same provided constraints to each of them."
198 argument="--batch"/> 206 argument="--batch"/>
199 <param argument="--canonicalBPonly" type="boolean" truevalue="--canonicalBPonly" falsevalue="" checked="false" label="Remove non-canonical base pairs from he structure constraint" /> 207 <param argument="--canonicalBPonly" type="boolean" truevalue="--canonicalBPonly" falsevalue="" checked="false" label="Remove non-canonical base pairs from he structure constraint" />
200 <param argument="--enforceConstraint" type="boolean" truevalue="--enforceConstraint" falsevalue="" checked="false" label="Enforce base pair given by round brackets () in structure constraint" /> 208 <param argument="--enforceConstraint" type="boolean" truevalue="--enforceConstraint" falsevalue="" checked="false" label="Enforce base pair given by round brackets () in structure constraint" />
201 </when> 209 </when>
202 </conditional> 210 </conditional>
203 <conditional name="shapeOption"> 211 <conditional name="shapeOption">
204 <param name="shapeSelector" type="select" label="Shape reactivity data"> 212 <param name="shapeSelector" type="select" label="Shape reactivity data">
205 <option value="isUsed">Use shape reactivity data</option> 213 <option value="isUsed">Use shape reactivity data</option>
206 <option value="notUsed" selected="true">Don't use shape reactivity data</option> 214 <option value="notUsed" selected="true">Don't use shape reactivity data</option>
207 </param> 215 </param>
241 <when value="O"> 249 <when value="O">
242 <param name="s" type="float" value="1.6" label="Slope s"/> 250 <param name="s" type="float" value="1.6" label="Slope s"/>
243 <param name="i" type="float" value="-2.29" label="Intercept"/> 251 <param name="i" type="float" value="-2.29" label="Intercept"/>
244 </when> 252 </when>
245 </conditional> 253 </conditional>
246 </when> 254 </when>
247 <when value="W"> 255 <when value="W">
248 </when> 256 </when>
249 </conditional> 257 </conditional>
250 </when> 258 </when>
251 <when value="notUsed"> 259 <when value="notUsed">
252 </when> 260 </when>
253 </conditional> 261 </conditional>
254 <param argument="--motif" type="text" value="" label="Sequence structure energy" help="Specify stabilizing effect of ligand binding to a particular sequence/structure motif. Some ligands binding to RNAs require and/or induce particular sequence and structure motifs. For instance they bind to an interior loop, or small hairpin loop. If for such cases a binding free energy is known, the binding and therefore stabilizing effect of the ligand can be included in the folding recursions. Interior loop motifs are specified as concatenations of 5’ and 3’ motif, separated by an ’&amp;’ character. Energy contributions must be specified in kcal/mol."/> 262 <param argument="--motif" type="text" value="" label="Sequence structure energy" help="Specify stabilizing effect of ligand binding to a particular sequence/structure motif. Some ligands binding to RNAs require and/or induce particular sequence and structure motifs. For instance they bind to an interior loop, or small hairpin loop. If for such cases a binding free energy is known, the binding and therefore stabilizing effect of the ligand can be included in the folding recursions. Interior loop motifs are specified as concatenations of 5’ and 3’ motif, separated by an ’&amp;’ character. Energy contributions must be specified in kcal/mol."/>
255 </section> 263 </section>
256 <section name="IDs" title="Naming Conventions"> 264 <section name="IDs" title="Naming Conventions">
257 <param name="auto_id" 265 <param name="auto_id"
258 type="boolean" truevalue="--auto-id" falsevalue="" checked="false" 266 type="boolean" truevalue="--auto-id" falsevalue="" checked="false"
259 label="Automatically generate an ID for each alignment." 267 label="Automatically generate an ID for each alignment."
260 help="If this flag is active, RNAfold ignores any IDs retrieved from the input and automatically generates an ID for each sequence." 268 help="If this flag is active, RNAfold ignores any IDs retrieved from the input and automatically generates an ID for each sequence."
261 argument="--auto-id"/> 269 argument="--auto-id"/>
262 <param name="id_prefix" 270 <param name="id_prefix"
263 type="text" value="sequence" 271 type="text" value="sequence"
264 label="Prefix for automatically generated IDs (as used in output file names)" 272 label="Prefix for automatically generated IDs (as used in output file names)"
265 help="If this parameter is set, each sequence will be prefixed with the provided string. Hence, the output files will obey the following naming scheme: 'prefix_xxxx_ss.ps' (secondary structure plot), 'prefix_xxxx_dp.ps' (dot−plot), 'prefix_xxxx_aln.ps' (annotated sequence), etc. where xxxx is the sequence number beginning with the second sequence in the input. Use this setting in conjunction with the −−continuous−ids flag to assign IDs beginning with the first input sequence." 273 help="If this parameter is set, each sequence will be prefixed with the provided string. Hence, the output files will obey the following naming scheme: 'prefix_xxxx_ss.ps' (secondary structure plot), 'prefix_xxxx_dp.ps' (dot−plot), 'prefix_xxxx_aln.ps' (annotated sequence), etc. where xxxx is the sequence number beginning with the second sequence in the input. Use this setting in conjunction with the −−continuous−ids flag to assign IDs beginning with the first input sequence."
266 argument="--id-prefix"/> 274 argument="--id-prefix"/>
267 <param name="id_digits" 275 <param name="id_digits"
268 type="integer" value="4" min="1" max="18" 276 type="integer" value="4" min="1" max="18"
269 label="The number of digits of the counter in automatically generated sequence IDs" 277 label="The number of digits of the counter in automatically generated sequence IDs"
270 help="When sequences IDs are automatically generated, they receive an increasing number, starting with 1. This number will always be left−padded by leading zeros, such that the number takes up a certain width. Using this parameter, the width can be specified to the users need. We allow numbers in the range [1:18]." 278 help="When sequences IDs are automatically generated, they receive an increasing number, starting with 1. This number will always be left−padded by leading zeros, such that the number takes up a certain width. Using this parameter, the width can be specified to the users need. We allow numbers in the range [1:18]."
271 argument="--id-digits"/> 279 argument="--id-digits"/>
272 <param name="id_start" 280 <param name="id_start"
273 type="integer" value="1" min="0" 281 type="integer" value="1" min="0"
274 label="First number in automatically generated sequence IDs" 282 label="First number in automatically generated sequence IDs"
275 help="When sequence IDs are automatically generated, they receive an increasing number, usually starting with 1. Using this parameter, the first number can be specified to the users requirements. Note: negative numbers are not allowed. Note: Setting this parameter implies continuous sequence IDs, i.e. it activates the −−continuous−ids flag.." 283 help="When sequence IDs are automatically generated, they receive an increasing number, usually starting with 1. Using this parameter, the first number can be specified to the users requirements. Note: negative numbers are not allowed. Note: Setting this parameter implies continuous sequence IDs, i.e. it activates the −−continuous−ids flag.."
276 argument="--id-start"/> 284 argument="--id-start"/>
277 </section> 285 </section>
278 </inputs> 286 </inputs>
279 <outputs> 287 <outputs>
280 <data format="dbn" name="tabular_file"/> 288 <data format="dbn" name="tabular_file"/>
281 <collection name="sequence_outputs" type="list" label="rna_eps outputs"> 289 <collection name="sequence_outputs" type="list" label="rna_eps outputs">
282 <discover_datasets pattern="(?P&lt;designation&gt;.+)_ss\.ps" ext="eps" /> 290 <discover_datasets pattern="(?P&lt;designation&gt;.+)_ss\.ps" ext="eps" />
290 <test> 298 <test>
291 <param name="select_fasta" value="true" /> 299 <param name="select_fasta" value="true" />
292 <param name="fasta_input" value="rnafold_input1.fa"/> 300 <param name="fasta_input" value="rnafold_input1.fa"/>
293 <output name="out_file1" file="rnafold_result1.txt"/> 301 <output name="out_file1" file="rnafold_result1.txt"/>
294 </test> 302 </test>
295
296 <test> 303 <test>
297 <param name="select_fasta" value="true" /> 304 <param name="select_fasta" value="true" />
298 <param name="fasta_input" value="rnafold_input2.fa"/> 305 <param name="fasta_input" value="rnafold_input2.fa"/>
299 <param name="temperature" value="75"/> 306 <param name="temperature" value="75"/>
300 <output name="out_file1" file="rnafold_result2.txt"/> 307 <output name="out_file1" file="rnafold_result2.txt"/>
301 </test> 308 </test>
302
303 <test> 309 <test>
304 <param name="select_fasta" value="false" /> 310 <param name="select_fasta" value="false" />
305 <param name="input_sequence" value="TGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGTGAGAGGTAGTGGGATCGATGCCCACATTCTCCA"/> 311 <param name="input_sequence" value="TGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGTGAGAGGTAGTGGGATCGATGCCCACATTCTCCA"/>
306 <output name="out_file1" file="rnafold_result3.txt"/> 312 <output name="out_file1" file="rnafold_result3.txt"/>
307 </test> 313 </test>
314 <test>
315 <param name="select_fasta" value="true" />
316 <param name="fasta_input" value="sample_3.fa"/>
317 <conditional name="shapeOption">
318 <param name="shapeSelector" value="isUsed"/>
319 </conditional>
320 <param name="shapeFile" value="sample_3.react"/>
321 <output name="out_file1" file="sample_3_result.txt"/>
322 </test>
308 </tests> 323 </tests>
309 <help> 324 <help>
310 <![CDATA[ 325 <![CDATA[
311 **RNAfold** 326 **RNAfold**
312 327
341 356
342 - Secondary structures in dot-bracket notation 357 - Secondary structures in dot-bracket notation
343 358
344 - several possible postscript images bundled together in a tar file 359 - several possible postscript images bundled together in a tar file
345 - secondary structure for each sequence in the input file 360 - secondary structure for each sequence in the input file
346 - if partition function is calculated (--MEA or --partfunc is set) then also the pairing probabilty matrix is generated for each sequence 361 - if partition function is calculated (--MEA or --partfunc is set) then also the pairing probabilty matrix is generated for each sequence
347 362
348 ]]> 363 ]]>
349 </help> 364 </help>
350 <expand macro="citations" /> 365 <expand macro="citations" />
351 </tool> 366 </tool>