Mercurial > repos > rnateam > viennarna_rnafold

comparison rnafold.xml @ 8:bdb786715d28 draft default tip

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/rna_tools/vienna_rna commit 36681a08c6e44c663169caaefd964781c43d0d29
author rnateam
date Wed, 20 Dec 2017 08:34:54 -0500
parents 86f517dcfdfb
children
comparison
equal deleted inserted replaced
7:86f517dcfdfb 8:bdb786715d28
1 <tool id="viennarna_rnafold" name="@EXECUTABLE@" version="@VERSION@.3"> 1 <tool id="viennarna_rnafold" name="@EXECUTABLE@" version="@VERSION@.4">
2 <description>Calculate minimum free energy secondary structures and partition function of RNAs</description> 2 <description>Calculate minimum free energy secondary structures and partition function of RNAs</description>
3 <macros> 3 <macros>
4 <token name="@EXECUTABLE@">RNAfold</token> 4 <token name="@EXECUTABLE@">RNAfold</token>
5 <import>macros.xml</import> 5 <import>macros.xml</import>
6 </macros> 6 </macros>
29 -T $temperature 29 -T $temperature
30 --dangles=$dangling 30 --dangles=$dangling
31 #if $layout_type ==0 31 #if $layout_type ==0
32 --layout-type=$general_options.layout_type 32 --layout-type=$general_options.layout_type
33 #end if 33 #end if
34 #if $mea: 34
35 --MEA=$mea 35 #if $mea:
36 #end if 36 #if $meagamma:
37 --MEA=$meagamma
38 #else
39 --MEA
40 #end if
41 #end if
42
37 #if $pf 43 #if $pf
38 $pf 44 $pf
39 #if $pfscale: 45 #end if
40 --pfScale=$pfscale 46
41 #end if 47 #if $pfscale:
42 #end if 48 --pfScale=$pfscale
49 #end if
50
43 $advancedOptions.noconversion 51 $advancedOptions.noconversion
44 $advancedOptions.gquad 52 $advancedOptions.gquad
45 $advancedOptions.nolp 53 $advancedOptions.nolp
46 $advancedOptions.nops 54 $advancedOptions.nops
47 $advancedOptions.nogu 55 $advancedOptions.nogu
102 #if str($input_source.select_fasta) == "false" 110 #if str($input_source.select_fasta) == "false"
103 "input.fasta" 111 "input.fasta"
104 #else 112 #else
105 "${input_source.fasta_input}" 113 "${input_source.fasta_input}"
106 #end if 114 #end if
107 > '$tabular_file' 115 > '$dot_bracket_stdout'
108 ]]> 116 ]]>
109 </command> 117 </command>
110 118
111 <inputs> 119 <inputs>
112 <conditional name="input_source"> 120 <conditional name="input_source">
130 </param> 138 </param>
131 <param name="layout_type" type="select" label="Layout algorithm" argument="--layout_type" > 139 <param name="layout_type" type="select" label="Layout algorithm" argument="--layout_type" >
132 <option value="1" selected="true">Default: Naview layout</option> 140 <option value="1" selected="true">Default: Naview layout</option>
133 <option value="0">Simple radial layout</option> 141 <option value="0">Simple radial layout</option>
134 </param> 142 </param>
135 <param argument="--MEA" name="mea" type="float" value="1.0" optional="true" label="Gamma Value" help="Used for the calculation of the Maximum Expected accuracy"/> 143
144 <param name="mea" type="boolean" checked="false" falsevalue="" label="Calculate Maximum Expected accuracy" help="--MEA"/>
145 <param name="meagamma" type="float" optional="true" label="MEA-Gamma Value"/>
146
136 <param name="pf" type="boolean" checked="false" truevalue="--partfunc" falsevalue="" label="Calculate Partition Function" help="--partfunc"/> 147 <param name="pf" type="boolean" checked="false" truevalue="--partfunc" falsevalue="" label="Calculate Partition Function" help="--partfunc"/>
137 <param name="pfscale" type="float" value="1.07" optional="true" label="Scaling factor" help="In the calculation of the pf use scale*mfe as an estimate for the ensemble free energy (used to avoid overflows). The default is 1.07, useful values are 1.0 to 1.2. Occasionally needed for long sequences."/> 148 <param name="pfscale" type="float" optional="true" label="Scaling factor" help="In the calculation of the pf use scale*mfe as an estimate for the ensemble free energy (used to avoid overflows). The default is 1.07, useful values are 1.0 to 1.2. Occasionally needed for long sequences."/>
138 <section name="advancedOptions" title="Advanced options"> 149 <section name="advancedOptions" title="Advanced options">
139 <param name="nops" type="boolean" truevalue="--noPS" falsevalue="" checked="false" label="Do not produce postscript drawing of the mfe structure (reduces run-time)" help="(--noPS)"/> 150 <param name="nops" type="boolean" truevalue="--noPS" falsevalue="" checked="false" label="Do not produce postscript drawing of the mfe structure (reduces run-time)" help="(--noPS)"/>
140 <param name="nolp" type="boolean" truevalue="" falsevalue="--noLP" checked="true" label="Allow lonely base-pairs" help="(--noLP)"/> 151 <param name="nolp" type="boolean" truevalue="" falsevalue="--noLP" checked="true" label="Allow lonely base-pairs" help="(--noLP)"/>
141 <param name="nogu" type="boolean" truevalue="" falsevalue="--noGU" checked="true" label="Allow GU pairing" help="--noGU"/> 152 <param name="nogu" type="boolean" truevalue="" falsevalue="--noGU" checked="true" label="Allow GU pairing" help="--noGU"/>
142 <param name="noclosinggu" type="boolean" truevalue="" falsevalue="--noClosingGU" checked="true" label="Allow GU pairing at the ends" help="Allow pairing of G and U at the ends of helices. --noClosingGU"/> 153 <param name="noclosinggu" type="boolean" truevalue="" falsevalue="--noClosingGU" checked="true" label="Allow GU pairing at the ends" help="Allow pairing of G and U at the ends of helices. --noClosingGU"/>
277 help="When sequence IDs are automatically generated, they receive an increasing number, usually starting with 1. Using this parameter, the first number can be specified to the users requirements. Note: negative numbers are not allowed. Note: Setting this parameter implies continuous sequence IDs, i.e. it activates the −−continuous−ids flag.." 288 help="When sequence IDs are automatically generated, they receive an increasing number, usually starting with 1. Using this parameter, the first number can be specified to the users requirements. Note: negative numbers are not allowed. Note: Setting this parameter implies continuous sequence IDs, i.e. it activates the −−continuous−ids flag.."
278 argument="--id-start"/> 289 argument="--id-start"/>
279 </section> 290 </section>
280 </inputs> 291 </inputs>
281 <outputs> 292 <outputs>
282 <data format="dbn" name="tabular_file"/> 293 <data format="dbn" name="dot_bracket_stdout"/>
283 <collection name="sequence_outputs" type="list" label="rna_eps outputs"> 294 <collection name="structure_outputs" type="list" label="rna_strcuture_eps outputs">
284 <filter>advancedOptions['nops'] is False</filter> 295 <filter>advancedOptions['nops'] is False</filter>
285 <discover_datasets pattern="(?P&lt;designation&gt;.+)_ss\.ps" ext="eps" /> 296 <discover_datasets pattern="(?P&lt;designation&gt;.+)_ss\.ps" ext="eps" />
286 </collection> 297 </collection>
287 <collection name="matrix_outputs" type="list" label="rna_eps outputs"> 298 <collection name="matrix_outputs" type="list" label="rna_matrix_eps outputs">
288 <filter>measelect['pf'] is True</filter> 299 <filter>pf is True</filter>
289 <discover_datasets pattern="(?P&lt;designation&gt;.+)_dp\.ps" ext="rna_eps" visible="true"/> 300 <discover_datasets pattern="(?P&lt;designation&gt;.+)_dp\.ps" ext="rna_eps" visible="true"/>
290 </collection> 301 </collection>
291 </outputs> 302 </outputs>
292 <tests> 303 <tests>
293 <test> 304 <test>
294 <param name="select_fasta" value="true" /> 305 <param name="select_fasta" value="true" />
295 <param name="fasta_input" value="rnafold_input1.fa"/> 306 <param name="fasta_input" value="rnafold_input1.fa"/>
296 <output name="tabular_file" file="rnafold_result1.txt"/> 307 <output name="dot_bracket_stdout" file="rnafold_result1.txt"/>
297 </test> 308 </test>
309
310 <test>
311 <param name="select_fasta" value="true" />
312 <param name="mea" value="true" />
313 <param name="fasta_input" value="rnafold_input1.fa"/>
314 <output name="dot_bracket_stdout" file="rnafold_result1_mea.txt"/>
315 </test>
316 <test>
317 <param name="select_fasta" value="true" />
318 <param name="pf" value="true" />
319 <param name="fasta_input" value="rnafold_input1.fa"/>
320 <output name="dot_bracket_stdout" file="rnafold_result1_pf.txt"/>
321 <output_collection name="structure_outputs" type="list">
322 <element name="Anolis_caro_chrUn_GL343590.trna2_AlaAGC" file="Anolis_caro_chrUn_GL343590.trna2_AlaAGC_ss.ps" compare="sim_size" />
323 <element name="Anolis_caro_chrUn_GL343207.trna3_AlaAGC" file="Anolis_caro_chrUn_GL343207.trna3_AlaAGC_ss.ps" compare="sim_size" />
324 </output_collection>
325
326 <output_collection name="matrix_outputs" type="list">
327 <element name="Anolis_caro_chrUn_GL343590.trna2_AlaAGC" file="Anolis_caro_chrUn_GL343590.trna2_AlaAGC_dp.ps" compare="sim_size" />
328 <element name="Anolis_caro_chrUn_GL343207.trna3_AlaAGC" file="Anolis_caro_chrUn_GL343207.trna3_AlaAGC_dp.ps" compare="sim_size" />
329 </output_collection>
330 </test>
298 <test> 331 <test>
299 <param name="select_fasta" value="true" /> 332 <param name="select_fasta" value="true" />
300 <param name="fasta_input" value="rnafold_input2.fa"/> 333 <param name="fasta_input" value="rnafold_input2.fa"/>
301 <param name="temperature" value="75"/> 334 <param name="temperature" value="75"/>
302 <output name="tabular_file" file="rnafold_result2.txt"/> 335 <output name="dot_bracket_stdout" file="rnafold_result2.txt"/>
303 </test> 336 </test>
304 <test> 337 <test>
305 <param name="select_fasta" value="false" /> 338 <param name="select_fasta" value="false" />
306 <param name="input_sequence" value="TGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGTGAGAGGTAGTGGGATCGATGCCCACATTCTCCA"/> 339 <param name="input_sequence" value="TGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGTGAGAGGTAGTGGGATCGATGCCCACATTCTCCA"/>
307 <output name="tabular_file" file="rnafold_result3.txt"/> 340 <output name="dot_bracket_stdout" file="rnafold_result3.txt"/>
308 </test> 341 </test>
309 <test> 342 <test>
310 <param name="select_fasta" value="true" /> 343 <param name="select_fasta" value="true" />
311 <param name="fasta_input" value="sample_3.fa"/> 344 <param name="fasta_input" value="sample_3.fa"/>
312 <conditional name="shapeOption"> 345 <conditional name="shapeOption">
313 <param name="shapeSelector" value="isUsed"/> 346 <param name="shapeSelector" value="isUsed"/>
314 </conditional> 347 </conditional>
315 <param name="shapeFile" value="sample_3.react"/> 348 <param name="shapeFile" value="sample_3.react"/>
316 <output name="tabular_file" file="sample_3_result.txt"/> 349 <output name="dot_bracket_stdout" file="sample_3_result.txt"/>
317 </test> 350 </test>
351
318 </tests> 352 </tests>
319 <help> 353 <help>
320 <![CDATA[ 354 <![CDATA[
321 **RNAfold** 355 **RNAfold**
322 356