Mercurial > repos > rnateam > viennarna_rnalalifold

diff test-data/rnafold_result3.txt @ 6:271fdfd36786 draft default tip

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/rna_tools/vienna_rna commit 36681a08c6e44c663169caaefd964781c43d0d29
author rnateam
date Wed, 20 Dec 2017 08:35:14 -0500
parents 86a940341a00
children
line wrap: on
line diff
--- a/test-data/rnafold_result3.txt	Thu Sep 28 16:24:56 2017 -0400
+++ b/test-data/rnafold_result3.txt	Wed Dec 20 08:35:14 2017 -0500
@@ -1,7 +1,3 @@
 >Sequence
 UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA
 .((((((..((((........)))).(((((.......))))).....(((((.......))))))))))).. (-22.00)
-,((((((..((((........)))).(((((.......))))).....(((((.......))))))))),)), [-23.20]
-.((((((..((((........)))).(((((.......))))).....(((((.......))))))))).)). {-21.90 d=9.72}
-.((((((..((((........)))).(((((.......))))).....(((((.......))))))))).)). {-21.90 MEA=58.88}
- frequency of mfe structure in ensemble 0.142309; ensemble diversity 14.51