Mercurial > repos > rnateam > viennarna_rnapaln

diff test-data/rnafold_result3.txt @ 5:e6314cf1d9c6 draft

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/rna_tools/vienna_rna commit d9f13fd859165e4280412ec73f8f3f8b258d351d-dirty
author rnateam
date Thu, 28 Sep 2017 16:25:57 -0400
parents 6b3f717d1a9b
children fb69ae544451
line wrap: on
line diff
--- a/test-data/rnafold_result3.txt	Tue Jul 18 01:50:19 2017 -0400
+++ b/test-data/rnafold_result3.txt	Thu Sep 28 16:25:57 2017 -0400
@@ -1,3 +1,7 @@
 >Sequence
 UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA
 .((((((..((((........)))).(((((.......))))).....(((((.......))))))))))).. (-22.00)
+,((((((..((((........)))).(((((.......))))).....(((((.......))))))))),)), [-23.20]
+.((((((..((((........)))).(((((.......))))).....(((((.......))))))))).)). {-21.90 d=9.72}
+.((((((..((((........)))).(((((.......))))).....(((((.......))))))))).)). {-21.90 MEA=58.88}
+ frequency of mfe structure in ensemble 0.142309; ensemble diversity 14.51