Mercurial > repos > rnateam > viennarna_rnapaln
changeset 0:6b3f717d1a9b draft
planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/rna_tools/vienna_rna commit 0065dafe7bbd382bb995b28cc4089c9e4f4eeeb9
line wrap: on
line diff
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/macros.xml Tue Dec 06 12:35:50 2016 -0500 @@ -0,0 +1,26 @@ +<macros> + <xml name="requirements"> + <requirements> + <requirement version="2.2.10">viennarna</requirement> + </requirements> + </xml> + <token name="@VERSION@">2.2.10</token> + <xml name="version_command"> + <version_command>@EXECUTABLE@ --version</version_command> + </xml> + + <xml name="stdio"> + <stdio> + <exit_code range="1:" /> + <exit_code range=":-1" /> + <regex match="Error:" /> + <regex match="Exception:" /> + </stdio> + </xml> + + <xml name="citations"> + <citations> + <citation type="doi">10.1186/1748-7188-6-26</citation> + </citations> + </xml> +</macros>
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/rnapaln.xml Tue Dec 06 12:35:50 2016 -0500 @@ -0,0 +1,112 @@ +<tool id="viennarna_rnapaln" name="@EXECUTABLE@" version="@VERSION@.0"> + <description>RNA alignment based on sequence base pairing propensities + </description> + <macros> + <token name="@EXECUTABLE@">RNApaln</token> + <import>macros.xml</import> + </macros> + <expand macro="requirements" /> + <expand macro="stdio" /> + <expand macro="version_command" /> + <command> +<![CDATA[ + RNApaln < '$input' > '$output' + --mode=$alignmentmode + -T$temperature -d$dangling + $backtrack + --gapo=$gapo + --gape=$gape + --seqw=$seqw + $endgaps + #if $varExists('$advancedOptions.nolp') + $advancedOptions.noconversion + $advancedOptions.nolp + $advancedOptions.nogu + $advancedOptions.noclosinggu + $advancedOptions.notetra + #end if + #if $backtrack and str($alignmentmode)=="m" + && cat backtrack.file >> '$outfile' + #end if +]]> + </command> + + <inputs> + <param format="fasta" name="input" type="data" label="Fasta file"/> + <param name="temperature" type="float" value="37.0" label="Temperature [°C]" help="-T"/> + <param name="dangling" type="select" label="How to treat dangling end energies" help="-d"> + <option value="0">0: ignore dangling ends</option> + <option value="1">1: unpaired bases participate in one dangling end only</option> + <option value="2" selected="True">2: unpaired bases participate in all dangling ends</option> + <option value="3">3: allow coaxial stacking</option> + </param> + <param name="alignmentmode" type="select" label="Comparison Option" help="--mode"> + <option value="p" selected="True">p: pairwise (1st with 2nd, 3rd with 4th, ...)</option> + <option value="m">m: matrix (each with each, output in matrix form)</option> + <option value="f" >f: first (1st with 2nd, 1st with 3rd, ...)</option> + <option value="c">c: continuous (1st with 2nd, 2nd with 3rd, ...)</option> + </param> + + <!-- In versions 2.1.2, 2.1.7, and 2.2.10 the alignment score is wrong if -B is not selected, therefore the default for this option is set to true --> + <param name="backtrack" type="boolean" checked="true" truevalue="-B" falsevalue="" label="Print an alignment" help="-B"/> + + <param name="gapo" type="float" value="1.5" label="gap open penalty" help="--gapo"/> + <param name="gape" type="float" value="0.67" label="gap extension penalty" help="--gape"/> + <param name="seqw" type="float" value="0.5" label="weight of sequence compared to structure" help="--seqw"/> + <param name="endgaps" type="boolean" checked="false" truevalue="--endgaps" falsevalue="" label="Allow free end-gaps" help="--endgaps"/> + + <conditional name="advancedOptions"> + <param name="advancedSelector" type="select" label="advanced options"> + <option value="basic">basic Options</option> + <option value="advanced">advanced Options</option> + </param> + <when value="advanced"> + <param name="nolp" type="boolean" truevalue="" falsevalue="--noLP" checked="true" label="Allow lonely base-pairs" help="(--noLP)"/> + <param name="nogu" type="boolean" truevalue="" falsevalue="--noGU" checked="true" label="Allow GU pairing" help="--noGU"/> + <param name="noclosinggu" type="boolean" truevalue="" falsevalue="--noClosingGU" checked="true" label="Allow GU pairing at the ends" help="Allow pairing of G and U at the ends of helices. --noClosingGU"/> + <param name="notetra" type="boolean" truevalue="" falsevalue="--noTetra" checked="true" label="Allow stabilization for loops, hairpins etc." help=" Include special tabulated stabilizing energies for tri-, tetra- and hexaloop hairpins. Mostly for testing. (--noTetra)"/> + <param name="noconversion" type="boolean" truevalue="" falsevalue="--noconv" checked="true" label="Convert Thymine to Uracil (T -> U)" help="Avoids confusion with DNA sequences (--noconv)"/> + </when> + <when value="basic"> + </when> + </conditional> + </inputs> + <outputs> + <data format="txt" name="output"/> + <collection name="matrix_outputs" type="list" label="rna_eps outputs"> + <discover_datasets pattern="(?P<designation>.+)_dp\.ps" ext="rna_eps" visible="true"/> + </collection> + </outputs> + <tests> + <test> + <param name="input" value="rnapaln_input1.fa"/> + <output name="out_file" file="rnapaln_result1.txt"/> + </test> + </tests> + <help> +<![CDATA[ + +**RNApaln** + +RNA alignment based on sequence base pairing propensities. + +Uses string-alignment techniques to perform fast pairwise structural alignments of RNAs. Similar to RNApdist secondary structure is incorporated in an approximate manner by computing base pair probabilities, which are then reduced to a vector holding the probability that a base is paired upstream, downstream, or remains unpaired. Such pair propsensity vectors can then be compared using standard alignment algorithms. In contrast to RNApdist, RNApaln performs similarity (instead of distance) alignments, considers both sequence and structure information, and uses affine (rather than linear) gap costs. RNApaln can perform semi-local alignments by using free end gaps, a true local alignment mode is planned. + +----- + +**Input format** + +RNApaln requires one input file +- Fasta file + +------ + +**Outputs** + +- output of alignment scores and alignments (if -B option is selected) +- dot plot matrices in postscript format bundled together in a tar file + +]]> + </help> + <expand macro="citations" /> +</tool>
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/kinfold_input.txt Tue Dec 06 12:35:50 2016 -0500 @@ -0,0 +1,1 @@ +ACUGAUCGUAGUCAC
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rna2dfold_input1.txt Tue Dec 06 12:35:50 2016 -0500 @@ -0,0 +1,4 @@ +>Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC (218800-218872) Ala (AGC) 73 bp Sc: 49.55 +UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA +.((((((..((((........)))).(((((.......))))).....(((((.......))))))))))).. +.((((((..(((..........))).(((((.......))))).....(((((.......)))))))))))..
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rna2dfold_result1.txt Tue Dec 06 12:35:50 2016 -0500 @@ -0,0 +1,6 @@ +>Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC +UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA +.((((((..((((........)))).(((((.......))))).....(((((.......))))))))))).. (-22.00) +.((((((..((((........)))).(((((.......))))).....(((((.......))))))))))).. (-22.00) <ref 1> +.((((((..(((..........))).(((((.......))))).....(((((.......))))))))))).. (-17.30) <ref 2> +k l en structure
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rnaaliduplex_input1.clustal Tue Dec 06 12:35:50 2016 -0500 @@ -0,0 +1,7 @@ +CLUSTAL 2.1 multiple sequence alignment + + +Anolis_carolinensis_chrUn_GL34 TGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGTGAGAGGTAGTGGGATCGATGCCCACATTCTCCA +Anolis_carolinensis_chrUn_GL35 GGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGCGAGAGGTAGCGGGATTGATGCCCGCATTCTCCA + ************************************** ************** ******* ********* +
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rnaaliduplex_result1.txt Tue Dec 06 12:35:50 2016 -0500 @@ -0,0 +1,1 @@ +(((((((..(.......((((..(..((((((..((((((.......((((((..(..(((((..(((((((.&)))))))..).......))))..)..))))))..)))))).......))))))..)..)))))..))))))). 1,73 : 1,73 (-40.30)
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rnaalifold_input1.clustal Tue Dec 06 12:35:50 2016 -0500 @@ -0,0 +1,7 @@ +CLUSTAL 2.1 multiple sequence alignment + + +Anolis_carolinensis_chrUn_GL34 TGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGTGAGAGGTAGTGGGATCGATGCCCACATTCTCCA +Anolis_carolinensis_chrUn_GL35 GGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGCGAGAGGTAGCGGGATTGATGCCCGCATTCTCCA + ************************************** ************** ******* ********* +
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rnaalifold_result1.txt Tue Dec 06 12:35:50 2016 -0500 @@ -0,0 +1,2 @@ +GGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGCGAGAGGUAGCGGGAUCGAUGCCCACAUUCUCCA +(((((((..((((........)))).(((((.......))))).....(((((.......)))))))))))). (-26.45 = -26.20 + -0.25)
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rnacofold_input1.fas Tue Dec 06 12:35:50 2016 -0500 @@ -0,0 +1,2 @@ +>Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC (218800-218872) Ala (AGC) 73 bp Sc: 49.55 +UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA&UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rnacofold_result1.txt Tue Dec 06 12:35:50 2016 -0500 @@ -0,0 +1,3 @@ +>Anolis_carolinensis_chrUn_GL343590.trna2-A +UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA&UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA +.((((((..((((........)))).(((((.......))))).....(((((((((((.(((((((((((..&.))))))..((((........)))).(((((.......))))).....))))))))))).))))))))))).. (-55.90)
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rnadistance_input1.dbn Tue Dec 06 12:35:50 2016 -0500 @@ -0,0 +1,2 @@ +.((((((..((((........)))).(((((.......))))).....(((((.......))))))))))).. +(((((((..((((........)))).(((((.......))))).....(((((.......)))))))))))).
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rnadistance_result1.txt Tue Dec 06 12:35:50 2016 -0500 @@ -0,0 +1,1 @@ +f: 4
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rnaduplex_input1.fa Tue Dec 06 12:35:50 2016 -0500 @@ -0,0 +1,4 @@ +>Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC (218800-218872) Ala (AGC) 73 bp Sc: 49.55 +TGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGTGAGAGGTAGTGGGATCGATGCCCACATTCTCCA +>Anolis_carolinensis_chrUn_GL343207.trna3-AlaAGC (1513626-1513698) Ala (AGC) 73 bp Sc: 56.15 +GGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGCGAGAGGTAGCGGGATTGATGCCCGCATTCTCCA
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rnaduplex_result1.txt Tue Dec 06 12:35:50 2016 -0500 @@ -0,0 +1,3 @@ +>Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC +>Anolis_carolinensis_chrUn_GL343207.trna3-AlaAGC +.((((((..((......((((...((((..(((.((((((.......((((((..(..((((...(((((((.&)))))))..........))))..)..))))))..))))))..)))..)))).......)))).)))))))). 1,73 : 1,72 (-40.70)
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rnaeval_input1.dbn Tue Dec 06 12:35:50 2016 -0500 @@ -0,0 +1,3 @@ +>Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC (218800-218872) Ala (AGC) 73 bp Sc: 49.55 +UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA +.((((((..((((........)))).(((((.......))))).....(((((.......)))))))))))..
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rnaeval_result1.txt Tue Dec 06 12:35:50 2016 -0500 @@ -0,0 +1,3 @@ +>Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC (218800-218872) Ala (AGC) 73 bp Sc: 49.55 +UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA +.((((((..((((........)))).(((((.......))))).....(((((.......))))))))))).. (-22.00)
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rnafold_input1.fa Tue Dec 06 12:35:50 2016 -0500 @@ -0,0 +1,4 @@ +>Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC (218800-218872) Ala (AGC) 73 bp Sc: 49.55 +TGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGTGAGAGGTAGTGGGATCGATGCCCACATTCTCCA +>Anolis_carolinensis_chrUn_GL343207.trna3-AlaAGC (1513626-1513698) Ala (AGC) 73 bp Sc: 56.15 +GGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGCGAGAGGTAGCGGGATTGATGCCCGCATTCTCCA
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rnafold_input2.fa Tue Dec 06 12:35:50 2016 -0500 @@ -0,0 +1,4 @@ +>Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC (218800-218872) Ala (AGC) 73 bp Sc: 49.55 +TGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGTGAGAGGTAGTGGGATCGATGCCCACATTCTCCA +>Anolis_carolinensis_chrUn_GL343207.trna3-AlaAGC (1513626-1513698) Ala (AGC) 73 bp Sc: 56.15 +GGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGCGAGAGGTAGCGGGATTGATGCCCGCATTCTCCA
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rnafold_result1.txt Tue Dec 06 12:35:50 2016 -0500 @@ -0,0 +1,6 @@ +>Anolis_carolinensis_chrUn_GL343590.trna2-A +UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA +.((((((..((((........)))).(((((.......))))).....(((((.......))))))))))).. (-22.00) +>Anolis_carolinensis_chrUn_GL343207.trna3-A +GGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGCGAGAGGUAGCGGGAUUGAUGCCCGCAUUCUCCA +(((((((..((((........)))).(((((.......))))).....(((((.......)))))))))))). (-29.60)
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rnafold_result2.txt Tue Dec 06 12:35:50 2016 -0500 @@ -0,0 +1,6 @@ +>Anolis_carolinensis_chrUn_GL343590.trna2-A +UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA +..(((.....((((....((..(((....)))..))...)))).....(((((.......)))))....))). ( -3.37) +>Anolis_carolinensis_chrUn_GL343207.trna3-A +GGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGCGAGAGGUAGCGGGAUUGAUGCCCGCAUUCUCCA +(((((..((.(((.....((..(((....)))..))......))).))(((((.......)))))..))))). ( -5.02)
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rnafold_result3.txt Tue Dec 06 12:35:50 2016 -0500 @@ -0,0 +1,3 @@ +>Sequence +UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA +.((((((..((((........)))).(((((.......))))).....(((((.......))))))))))).. (-22.00)
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rnaheat_input1.fa Tue Dec 06 12:35:50 2016 -0500 @@ -0,0 +1,2 @@ +> comment 1 +UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rnaheat_result1.txt Tue Dec 06 12:35:50 2016 -0500 @@ -0,0 +1,102 @@ +> comment 1 +0 0.0407267 +1 0.0435052 +2 0.0470227 +3 0.0505646 +4 0.0553391 +5 0.0603894 +6 0.0662047 +7 0.0718158 +8 0.0782007 +9 0.0863514 +10 0.0950516 +11 0.10505 +12 0.115613 +13 0.128245 +14 0.141712 +15 0.157281 +16 0.17497 +17 0.195056 +18 0.216799 +19 0.241743 +20 0.270432 +21 0.302132 +22 0.337644 +23 0.377263 +24 0.421546 +25 0.470799 +26 0.525589 +27 0.587016 +28 0.653829 +29 0.726606 +30 0.806458 +31 0.892656 +32 0.984857 +33 1.08272 +34 1.18601 +35 1.29332 +36 1.40305 +37 1.51467 +38 1.62618 +39 1.73524 +40 1.84032 +41 1.9407 +42 2.03385 +43 2.11859 +44 2.19443 +45 2.26182 +46 2.31999 +47 2.36969 +48 2.41182 +49 2.44826 +50 2.47967 +51 2.50769 +52 2.534 +53 2.55942 +54 2.5851 +55 2.61217 +56 2.64151 +57 2.67329 +58 2.70759 +59 2.74465 +60 2.78458 +61 2.8279 +62 2.8742 +63 2.92425 +64 2.97698 +65 3.03283 +66 3.09163 +67 3.15591 +68 3.23033 +69 3.3067 +70 3.38122 +71 3.45791 +72 3.54606 +73 3.63843 +74 3.73392 +75 3.83847 +76 3.94646 +77 4.05462 +78 4.16571 +79 4.28366 +80 4.39944 +81 4.50863 +82 4.61035 +83 4.70186 +84 4.78345 +85 4.85204 +86 4.90509 +87 4.9392 +88 4.95425 +89 4.95214 +90 4.93688 +91 4.91166 +92 4.87691 +93 4.8314 +94 4.78561 +95 4.75271 +96 4.71866 +97 4.66056 +98 4.57671 +99 4.48395 +100 4.39006
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rnainverse_input1.clu Tue Dec 06 12:35:50 2016 -0500 @@ -0,0 +1,2 @@ +(((((((..((((........)))).(((((.......))))).....(((((.......)))))))))))). +gggccccnnaauunnnnnnnnaauunGGGGcnnnnnnnAAAAAnnnnnuuuuannnnnnnuaaaaggggcccn
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rnalalifold_input1.clustal Tue Dec 06 12:35:50 2016 -0500 @@ -0,0 +1,7 @@ +CLUSTAL 2.1 multiple sequence alignment + + +Anolis_carolinensis_chrUn_GL34 TGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGTGAGAGGTAGTGGGATCGATGCCCACATTCTCCA +Anolis_carolinensis_chrUn_GL35 GGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGCGAGAGGTAGCGGGATTGATGCCCGCATTCTCCA + ************************************** ************** ******* ********* +
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rnalalifold_result1.txt Tue Dec 06 12:35:50 2016 -0500 @@ -0,0 +1,4 @@ +(((.(((((.(((((.......)))))..)).(((((.......)))))..)))))) (-19.05) 17 - 73 +((((........)))). ( -5.10) 10 - 26 +GGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGCGAGAGGUAGCGGGAUCGAUGCCCACAUUCUCCA +
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rnalfold_input1.fa Tue Dec 06 12:35:50 2016 -0500 @@ -0,0 +1,4 @@ +>Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC (218800-218872) Ala (AGC) 73 bp Sc: 49.55 +TGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGTGAGAGGTAGTGGGATCGATGCCCACATTCTCCA +>Anolis_carolinensis_chrUn_GL343207.trna3-AlaAGC (1513626-1513698) Ala (AGC) 73 bp Sc: 56.15 +GGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGCGAGAGGTAGCGGGATTGATGCCCGCATTCTCCA
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rnalfold_result1.txt Tue Dec 06 12:35:50 2016 -0500 @@ -0,0 +1,28 @@ +>Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC (218800-218872) Ala (AGC) 73 bp Sc: 49.55 +.((((....)))). ( -0.10) 56 +.(((..((((....)))).))). ( -3.40) 51 +.(((((.......))))). ( -7.70) 48 +.((((..(((((.......)))))..)))). (-10.30) 42 +.(((((...(((((.......))))).))))). (-11.50) 40 +.((.(((((...(((((.......))))).))))))) (-12.10) 37 +.(((((.......))))). ( -5.80) 26 +.((.(((((.......)))))..)). ( -6.70) 23 +.((((....)))). ( -3.20) 21 +.((.((((....)))).)). ( -4.70) 18 +.((((........)))). ( -5.30) 9 +.((((((..((((........)))).(((((.......))))).....(((((.......))))))))))). (-22.00) 1 +UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA + (-22.00) +>Anolis_carolinensis_chrUn_GL343207.trna3-AlaAGC (1513626-1513698) Ala (AGC) 73 bp Sc: 56.15 +.(((..((((....)))).))). ( -3.40) 51 +.(((((.......))))). ( -9.20) 48 +.((((..(((((.......)))))..)))). (-11.80) 42 +.(((((...(((((.......))))).))))). (-13.30) 40 +.((.(((((...(((((.......))))).))))))) (-13.60) 37 +.(((((.......))))). ( -7.70) 26 +.((.(((((.......)))))..)). ( -8.60) 23 +.(((.(((((.(((((.......)))))..)).(((((.......)))))..)))))) (-20.00) 16 +.((((........)))). ( -5.30) 9 +(((((((..((((........)))).(((((.......))))).....(((((.......)))))))))))). (-29.60) 1 +GGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGCGAGAGGUAGCGGGAUUGAUGCCCGCAUUCUCCA + (-29.60)
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rnapaln_input1.fa Tue Dec 06 12:35:50 2016 -0500 @@ -0,0 +1,4 @@ +>Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC (218800-218872) Ala (AGC) 73 bp Sc: 49.55 +TGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGTGAGAGGTAGTGGGATCGATGCCCACATTCTCCA +>Anolis_carolinensis_chrUn_GL343207.trna3-AlaAGC (1513626-1513698) Ala (AGC) 73 bp Sc: 56.15 +GGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGCGAGAGGTAGCGGGATTGATGCCCGCATTCTCCA
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rnapaln_input1.fas Tue Dec 06 12:35:50 2016 -0500 @@ -0,0 +1,1 @@ +UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA&UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rnapaln_result1.txt Tue Dec 06 12:35:50 2016 -0500 @@ -0,0 +1,7 @@ +>Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC (218800-218872) Ala (AGC) 73 bp Sc: 49.55 +>Anolis_carolinensis_chrUn_GL343207.trna3-AlaAGC (1513626-1513698) Ala (AGC) 73 bp Sc: 56.15 +68.8844 +UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA +,((((((..((((........)))).(((((.......))))).....(((((.......))))))))),)), +GGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGCGAGAGGUAGCGGGAUUGAUGCCCGCAUUCUCCA +(((((((..((((........)))).(((((.......))))).....(((((.......)))))))))))).
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rnapdist_input1.fa Tue Dec 06 12:35:50 2016 -0500 @@ -0,0 +1,4 @@ +>Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC (218800-218872) Ala (AGC) 73 bp Sc: 49.55 +TGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGTGAGAGGTAGTGGGATCGATGCCCACATTCTCCA +>Anolis_carolinensis_chrUn_GL343207.trna3-AlaAGC (1513626-1513698) Ala (AGC) 73 bp Sc: 56.15 +GGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGCGAGAGGTAGCGGGATTGATGCCCGCATTCTCCA
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rnapdist_result1.txt Tue Dec 06 12:35:50 2016 -0500 @@ -0,0 +1,3 @@ +>Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC (218800-218872) Ala (AGC) 73 bp Sc: 49.55 +>Anolis_carolinensis_chrUn_GL343207.trna3-AlaAGC (1513626-1513698) Ala (AGC) 73 bp Sc: 56.15 +8.66253
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rnapkplex_input1.fa Tue Dec 06 12:35:50 2016 -0500 @@ -0,0 +1,4 @@ +>Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC (218800-218872) Ala (AGC) 73 bp Sc: 49.55 +TGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGTGAGAGGTAGTGGGATCGATGCCCACATTCTCCA +>Anolis_carolinensis_chrUn_GL343207.trna3-AlaAGC (1513626-1513698) Ala (AGC) 73 bp Sc: 56.15 +GGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGCGAGAGGTAGCGGGATTGATGCCCGCATTCTCCA
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rnapkplex_result1.txt Tue Dec 06 12:35:50 2016 -0500 @@ -0,0 +1,6 @@ +>Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC (218800-218872) Ala (AGC) 73 bp Sc: 49.55 +UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA +.((((((..((((........)))).(((((.......))))).[[[.(((((]]]....))))))))))).. (-31.90) +>Anolis_carolinensis_chrUn_GL343207.trna3-AlaAGC (1513626-1513698) Ala (AGC) 73 bp Sc: 56.15 +GGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGCGAGAGGUAGCGGGAUUGAUGCCCGCAUUCUCCA +(((((((..((((..[[[.[[)))).(((((.]].]]]))))).....(((((.......)))))))))))). (-38.54)
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rnaplex_input1.fa Tue Dec 06 12:35:50 2016 -0500 @@ -0,0 +1,4 @@ +>Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC (218800-218872) Ala (AGC) 73 bp Sc: 49.55 +TGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGTGAGAGGTAGTGGGATCGATGCCCACATTCTCCA +>Anolis_carolinensis_chrUn_GL343207.trna3-AlaAGC (1513626-1513698) Ala (AGC) 73 bp Sc: 56.15 +GGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGCGAGAGGTAGCGGGATTGATGCCCGCATTCTCCA
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rnaplex_result1.txt Tue Dec 06 12:35:50 2016 -0500 @@ -0,0 +1,4 @@ +>Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC (218800-218872) Ala (AGC) 73 bp Sc: 49.55 +>Anolis_carolinensis_chrUn_GL343207.trna3-AlaAGC (1513626-1513698) Ala (AGC) 73 bp Sc: 56.15 +.((((((..((......((((...((((..(((.((((((.......((((((..(..((((...(((((((.&)))))))..........))))..)..))))))..))))))..)))..)))).......)))).)))))))). 1,73 : 1,72 (-40.70) i:72,j:1 <-41.26> +
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rnaplfold_input1.fa Tue Dec 06 12:35:50 2016 -0500 @@ -0,0 +1,4 @@ +>Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC (218800-218872) Ala (AGC) 73 bp Sc: 49.55 +TGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGTGAGAGGTAGTGGGATCGATGCCCACATTCTCCA +>Anolis_carolinensis_chrUn_GL343207.trna3-AlaAGC (1513626-1513698) Ala (AGC) 73 bp Sc: 56.15 +GGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGCGAGAGGTAGCGGGATTGATGCCCGCATTCTCCA
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rnaplfold_result1.ps Tue Dec 06 12:35:50 2016 -0500 @@ -0,0 +1,242 @@ +%!PS-Adobe-3.0 EPSF-3.0 +%%Title: RNA Dot Plot +%%Creator: ViennaRNA-2.2.10 +%%CreationDate: Tue Oct 4 14:45:55 2016 +%%BoundingBox: 66 530 520 650 +%%DocumentFonts: Helvetica +%%Pages: 1 +%%EndComments + +%Options: +%This file contains the square roots of the base pair probabilities in the form +% i j sqrt(p(i,j)) ubox + +%%BeginProlog +/DPdict 100 dict def +DPdict begin +/logscale false def +/lpmin 1e-05 log def + +/box { %size x y box - draws box centered on x,y + 2 index 0.5 mul sub % x -= 0.5 + exch 2 index 0.5 mul sub exch % y -= 0.5 + 3 -1 roll dup rectfill +} bind def + +/ubox { + logscale { + log dup add lpmin div 1 exch sub dup 0 lt { pop 0 } if + } if + 3 1 roll + exch len exch sub 1 add box +} bind def + +/lbox { + 3 1 roll + len exch sub 1 add box +} bind def + +/drawseq { +% print sequence along all 4 sides +[ [0.7 -0.3 0 ] + [0.7 0.7 len add 0] + [-0.3 len sub -0.4 -90] + [-0.3 len sub 0.7 len add -90] +] { + gsave + aload pop rotate translate + 0 1 len 1 sub { + dup 0 moveto + sequence exch 1 getinterval + show + } for + grestore + } forall +} bind def + +/drawgrid{ + 0.01 setlinewidth + len log 0.9 sub cvi 10 exch exp % grid spacing + dup 1 gt { + dup dup 20 div dup 2 array astore exch 40 div setdash + } { [0.3 0.7] 0.1 setdash } ifelse + 0 exch len { + dup dup + 0 moveto + len lineto + dup + len exch sub 0 exch moveto + len exch len exch sub lineto + stroke + } for + [] 0 setdash + 0.04 setlinewidth + currentdict /cutpoint known { + cutpoint 1 sub + dup dup -1 moveto len 1 add lineto + len exch sub dup + -1 exch moveto len 1 add exch lineto + stroke + } if + 0.5 neg dup translate +} bind def + +end +%%EndProlog +DPdict begin +%delete next line to get rid of title +270 665 moveto /Helvetica findfont 14 scalefont setfont (Anolis_carolinensis_chrUn_GL343590.trna2-A) show + +/sequence { (\ +UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA\ +) } def +/winSize 70 def +/len { sequence length } bind def + +292 416 translate +72 6 mul len 1 add winSize add 2 sqrt mul div dup scale +/Helvetica findfont 0.95 scalefont setfont + +/drawseq_turn {% print sequence at bottom + gsave + len 2 sqrt div dup neg 0.28 add exch 0.78 sub translate + 0 1 len 1 sub { + dup dup 2 sqrt mul 0 moveto + sequence exch 1 getinterval + show + } for + grestore +} bind def +/drawgrid_turn{ + 0.01 setlinewidth + len log 0.9 sub cvi 10 exch exp % grid spacing + dup 1 gt { + dup dup 20 div dup 2 array astore exch 40 div setdash + } { [0.3 0.7] 0.1 setdash } ifelse + 0 exch len { %for (0, gridspacing, len) + dup dup %duplicate what - gridspacing?? + dup len exch sub moveto %moveto diagonal? + dup winSize gt + {dup dup len exch sub winSize add lineto} + {dup len lineto}ifelse + dup len exch sub moveto %moveto diagonal? + dup len winSize sub le + {dup dup len exch sub dup winSize exch sub len add exch lineto} + {dup dup len exch sub len exch lineto}ifelse stroke pop pop + } for + len log 0.9 sub cvi 10 exch exp % grid spacing + dup 1 gt { + dup dup 20 div dup 2 array astore exch 40 div setdash + } { [0.3 0.7] 0.1 setdash } ifelse + 0 exch len { %for (0, gridspacing, len) + dup dup %duplicate what - gridspacing?? + dup len exch sub moveto %moveto diagonal? + len exch sub 0.7 sub exch 0.7 sub exch lineto + stroke + }for + winSize len moveto len winSize lineto stroke + [] 0 setdash + 0.04 setlinewidth + currentdict /cutpoint known { + cutpoint 1 sub + dup dup -1 moveto len 1 add lineto + len exch sub dup + -1 exch moveto len 1 add exch lineto + stroke + } if + 0.5 neg dup translate +} bind def + +0.5 dup translate +drawseq_turn +45 rotate + + +%draw the grid +drawgrid_turn + +%start of base pair probability data +2 70 0.1568 ubox +2 71 0.9619 ubox +3 69 0.1395 ubox +3 70 0.7414 ubox +3 72 0.8060 ubox +4 68 0.1157 ubox +4 69 0.6748 ubox +4 71 0.4682 ubox +5 67 0.1065 ubox +5 68 0.6724 ubox +5 70 0.3765 ubox +6 47 0.1250 ubox +6 67 0.6497 ubox +7 46 0.1273 ubox +7 66 0.6008 ubox +8 45 0.1294 ubox +8 48 0.2252 ubox +9 47 0.2335 ubox +10 25 0.7863 ubox +11 24 0.7884 ubox +11 43 0.5215 ubox +11 45 0.2330 ubox +12 23 0.7883 ubox +12 42 0.5493 ubox +12 44 0.2317 ubox +13 22 0.7882 ubox +13 41 0.5528 ubox +13 43 0.2306 ubox +14 40 0.5338 ubox +15 20 0.1027 ubox +16 38 0.5325 ubox +16 40 0.1646 ubox +17 37 0.5639 ubox +17 39 0.1633 ubox +18 36 0.5591 ubox +18 38 0.1125 ubox +19 36 0.2406 ubox +20 34 0.5341 ubox +20 35 0.2514 ubox +21 33 0.4064 ubox +22 32 0.2491 ubox +22 33 0.4413 ubox +23 32 0.5541 ubox +24 31 0.6100 ubox +25 30 0.6092 ubox +26 36 0.2144 ubox +27 35 0.2146 ubox +27 43 0.7269 ubox +28 34 0.2043 ubox +28 42 0.7445 ubox +29 41 0.7467 ubox +30 40 0.7468 ubox +31 39 0.7470 ubox +38 73 0.3242 ubox +39 72 0.3055 ubox +40 73 0.1211 ubox +41 71 0.2953 ubox +41 72 0.1146 ubox +42 70 0.2588 ubox +43 69 0.2613 ubox +43 71 0.2848 ubox +44 68 0.2587 ubox +44 70 0.3418 ubox +45 67 0.2339 ubox +45 68 0.1772 ubox +45 69 0.3617 ubox +45 70 0.1014 ubox +45 72 0.3111 ubox +46 67 0.2550 ubox +46 68 0.3039 ubox +46 69 0.1150 ubox +46 71 0.2540 ubox +47 66 0.2925 ubox +48 67 0.1378 ubox +49 65 0.9938 ubox +50 64 0.9971 ubox +51 63 0.9980 ubox +52 62 0.9980 ubox +53 61 0.9963 ubox +54 59 0.1628 ubox +55 60 0.1625 ubox +showpage +end +%%EOF
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rnaplfold_result2.ps Tue Dec 06 12:35:50 2016 -0500 @@ -0,0 +1,212 @@ +%!PS-Adobe-3.0 EPSF-3.0 +%%Title: RNA Dot Plot +%%Creator: ViennaRNA-2.2.10 +%%CreationDate: Tue Oct 4 14:45:55 2016 +%%BoundingBox: 66 530 520 650 +%%DocumentFonts: Helvetica +%%Pages: 1 +%%EndComments + +%Options: +%This file contains the square roots of the base pair probabilities in the form +% i j sqrt(p(i,j)) ubox + +%%BeginProlog +/DPdict 100 dict def +DPdict begin +/logscale false def +/lpmin 1e-05 log def + +/box { %size x y box - draws box centered on x,y + 2 index 0.5 mul sub % x -= 0.5 + exch 2 index 0.5 mul sub exch % y -= 0.5 + 3 -1 roll dup rectfill +} bind def + +/ubox { + logscale { + log dup add lpmin div 1 exch sub dup 0 lt { pop 0 } if + } if + 3 1 roll + exch len exch sub 1 add box +} bind def + +/lbox { + 3 1 roll + len exch sub 1 add box +} bind def + +/drawseq { +% print sequence along all 4 sides +[ [0.7 -0.3 0 ] + [0.7 0.7 len add 0] + [-0.3 len sub -0.4 -90] + [-0.3 len sub 0.7 len add -90] +] { + gsave + aload pop rotate translate + 0 1 len 1 sub { + dup 0 moveto + sequence exch 1 getinterval + show + } for + grestore + } forall +} bind def + +/drawgrid{ + 0.01 setlinewidth + len log 0.9 sub cvi 10 exch exp % grid spacing + dup 1 gt { + dup dup 20 div dup 2 array astore exch 40 div setdash + } { [0.3 0.7] 0.1 setdash } ifelse + 0 exch len { + dup dup + 0 moveto + len lineto + dup + len exch sub 0 exch moveto + len exch len exch sub lineto + stroke + } for + [] 0 setdash + 0.04 setlinewidth + currentdict /cutpoint known { + cutpoint 1 sub + dup dup -1 moveto len 1 add lineto + len exch sub dup + -1 exch moveto len 1 add exch lineto + stroke + } if + 0.5 neg dup translate +} bind def + +end +%%EndProlog +DPdict begin +%delete next line to get rid of title +270 665 moveto /Helvetica findfont 14 scalefont setfont (Anolis_carolinensis_chrUn_GL343207.trna3-A) show + +/sequence { (\ +GGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGCGAGAGGUAGCGGGAUUGAUGCCCGCAUUCUCCA\ +) } def +/winSize 70 def +/len { sequence length } bind def + +292 416 translate +72 6 mul len 1 add winSize add 2 sqrt mul div dup scale +/Helvetica findfont 0.95 scalefont setfont + +/drawseq_turn {% print sequence at bottom + gsave + len 2 sqrt div dup neg 0.28 add exch 0.78 sub translate + 0 1 len 1 sub { + dup dup 2 sqrt mul 0 moveto + sequence exch 1 getinterval + show + } for + grestore +} bind def +/drawgrid_turn{ + 0.01 setlinewidth + len log 0.9 sub cvi 10 exch exp % grid spacing + dup 1 gt { + dup dup 20 div dup 2 array astore exch 40 div setdash + } { [0.3 0.7] 0.1 setdash } ifelse + 0 exch len { %for (0, gridspacing, len) + dup dup %duplicate what - gridspacing?? + dup len exch sub moveto %moveto diagonal? + dup winSize gt + {dup dup len exch sub winSize add lineto} + {dup len lineto}ifelse + dup len exch sub moveto %moveto diagonal? + dup len winSize sub le + {dup dup len exch sub dup winSize exch sub len add exch lineto} + {dup dup len exch sub len exch lineto}ifelse stroke pop pop + } for + len log 0.9 sub cvi 10 exch exp % grid spacing + dup 1 gt { + dup dup 20 div dup 2 array astore exch 40 div setdash + } { [0.3 0.7] 0.1 setdash } ifelse + 0 exch len { %for (0, gridspacing, len) + dup dup %duplicate what - gridspacing?? + dup len exch sub moveto %moveto diagonal? + len exch sub 0.7 sub exch 0.7 sub exch lineto + stroke + }for + winSize len moveto len winSize lineto stroke + [] 0 setdash + 0.04 setlinewidth + currentdict /cutpoint known { + cutpoint 1 sub + dup dup -1 moveto len 1 add lineto + len exch sub dup + -1 exch moveto len 1 add exch lineto + stroke + } if + 0.5 neg dup translate +} bind def + +0.5 dup translate +drawseq_turn +45 rotate + + +%draw the grid +drawgrid_turn + +%start of base pair probability data +2 70 0.1914 ubox +2 71 0.9787 ubox +3 69 0.1660 ubox +3 70 0.7676 ubox +3 72 0.8449 ubox +4 68 0.1377 ubox +4 69 0.7113 ubox +4 71 0.4928 ubox +5 67 0.1266 ubox +5 68 0.7090 ubox +5 70 0.3955 ubox +6 67 0.6860 ubox +7 66 0.6345 ubox +10 25 0.9888 ubox +11 24 0.9915 ubox +12 23 0.9914 ubox +13 22 0.9913 ubox +15 20 0.1291 ubox +17 73 0.1217 ubox +18 72 0.1091 ubox +27 43 0.9522 ubox +28 42 0.9836 ubox +29 41 0.9874 ubox +30 40 0.9886 ubox +31 39 0.9883 ubox +33 37 0.1014 ubox +38 73 0.1170 ubox +39 72 0.1080 ubox +41 71 0.1523 ubox +42 70 0.1341 ubox +43 69 0.1387 ubox +43 71 0.2800 ubox +44 68 0.1392 ubox +44 70 0.3364 ubox +45 67 0.1266 ubox +45 68 0.1838 ubox +45 69 0.3586 ubox +45 72 0.3252 ubox +46 67 0.2524 ubox +46 68 0.3007 ubox +46 69 0.1142 ubox +46 71 0.2655 ubox +47 66 0.2807 ubox +48 67 0.1394 ubox +49 65 0.9981 ubox +50 64 0.9997 ubox +51 63 0.9997 ubox +52 62 0.9997 ubox +53 61 0.9981 ubox +54 59 0.1565 ubox +55 60 0.3242 ubox +showpage +end +%%EOF
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rnaplot_input1.dbn Tue Dec 06 12:35:50 2016 -0500 @@ -0,0 +1,3 @@ +>Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC (218800-218872) Ala (AGC) 73 bp Sc: 49.55 +UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA +.((((((..((((........)))).(((((.......))))).....(((((.......))))))))))).. (-21.90)
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rnaplot_input1.fa Tue Dec 06 12:35:50 2016 -0500 @@ -0,0 +1,4 @@ +>Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC (218800-218872) Ala (AGC) 73 bp Sc: 49.55 +TGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGTGAGAGGTAGTGGGATCGATGCCCACATTCTCCA +>Anolis_carolinensis_chrUn_GL343207.trna3-AlaAGC (1513626-1513698) Ala (AGC) 73 bp Sc: 56.15 +GGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGCGAGAGGTAGCGGGATTGATGCCCGCATTCTCCA
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rnasnoop_input1a.fa Tue Dec 06 12:35:50 2016 -0500 @@ -0,0 +1,2 @@ +>homo +CGCGACCUCAGAUCAGACGUGGCGACCCGCUGAAUUUAAGCAUAUUAGUCAGCGGAGGAAAAGAAACUAACCAGGAUUCCCUCAGUAACGGCGAGUGAACAGGGAAGAGCCCAGCGCCGAAUCCCCGCCCCGCGGGGCGCGGGACAUGUGGCGUACGGAAGACCCGCUCCCCGGCGCCGCUCGUGGGGGGCCCAAGUCCUUCUGAUCGAGGCCCAGCCCGUGGACGGUGUGAGGCCGGUAGCGGCCGGCGCGCGCCCGGGUCUUCCCGGAGUCGGGUUGCUUGGGAAUGCAGCCCAAAGCGGGUGGUAAACUCCAUCUAAGGCUAAAUACCGGCACGAGACCGAUAGUCAACAAGUACCGUAAGGGAAAGUUGAAAAGAACUUUGAAGAGAGAGUUCAAGAGGGCGUGAAACCGUUAAGAGGUAAACGGGUGGGGUCCGCGCAGUCCGCCCGGAGGAUUCAACCCGGCGGCGGGUCCGGCCGUGUCGGCGGCCCGGCGGAUCUUUCCCGCCCCCCGUUCCUCCCGACCCCUCCACCCGCCCUCCCUUCCCCCGCCGCCCCUCCUCCUCCUCCCCGGAGGGGGCGGGCUCCGGCGGGUGCGGGGGUGGGCGGGCGGGGCCGGGGGUGGGGUCGGCGGGGGACCGUCCCCCGACCGGCGACCGGCCGCCGCCGGGCGCAUUUCCACCGCGGCGGUGCGCCGCGACCGGCUCCGGGACGGCUGGGAAGGCCCGGCGGGGAAGGUGGCUCGGGGGGCCCCGUCCGUCCGUCCGUCCUCCUCCUCCCCCGUCUCCGCCCCCCGGCCCCGCGUCCUCCCUCGGGAGGGCGCGCGGGUCGGGGCGGCGGCGGCGGCGGCGGUGGCGGCGGCGGCGGGGGCGGCGGGACCGAAACCCCCCCCGAGUGUUACAGCCCCCCCGGCAGCAGCACUCGCCGAAUCCCGGGGCCGAGGGAGCGAGACCCGUCGCCGCGCUCUCCCCCCUCCCGGCGCCCACCCCCGCGGGGAAUCCCCCGCGAGGGGGGUCUCCCCCGCGGGGGCGCGCCGGCGUCUCCUCGUGGGGGGGCCGGGCCACCCCUCCCACGGCGCGACCGCUCUCCCACCCCUCCUCCCCGCGCCCCCGCCCCGGCGACGGGGGGGGUGCCGCGCGCGGGUCGGGGGGCGGGGCGGACUGUCCCCAGUGCGCCCCGGGCGGGUCGCGCCGUCGGGCCCGGGGGAGGUUCUCUCGGGGCCACGCGCGCGUCCCCCGAAGAGGGGGACGGCGGAGCGAGCGCACGGGGUCGGCGGCGACGUCGGCUACCCACCCGACCCGUCUUGAAACACGGACCAAGGAGUCUAACACGUGCGCGAGUCGGGGGCUCGCACGAAAGCCGCCGUGGCGCAAUGAAGGUGAAGGCCGGCGCGCUCGCCGGCCGAGGUGGGAUCCCGAGGCCUCUCCAGUCCGCCGAGGGCGCACCACCGGCCCGUCUCGCCCGCCGCGCCGGGGAGGUGGAGCACGAGCGCACGUGUUAGGACCCGAAAGAUGGUGAACUAUGCCUGGGCAGGGCGAAGCCAGAGGAAACUCUGGUGGAGGUCCGUAGCGGUCCUGACGUGCAAAUCGGUCGUCCGACCUGGGUAUAGGGGCGAAAGACUAAUCGAACCAUCUAGUAGCUGGUUCCCUCCGAAGUUUCCCUCAGGAUAGCUGGCGCUCUCGCAGACCCGACGCACCCCCGCCACGCAGUUUUAUCCGGUAAAGCGAAUGAUUAGAGGUCUUGGGGCCGAAACGAUCUCAACCUAUUCUCAAACUUUAAAUGGGUAAGAAGCCCGGCUCGCUGGCGUGGAGCCGGGCGUGGAAUGCGAGUGCCUAGUGGGCCACUUUUGGUAAGCAGAACUGGCGCUGCGGGAUGAACCGAACGCCGGGUUAAGGCGCCCGAUGCCGACGCUCAUCAGACCCCAGAAAAGGUGUUGGUUGAUAUAGACAGCAGGACGGUGGCCAUGGAAGUCGGAAUCCGCUAAGGAGUGUGUAACAACUCACCUGCCGAAUCAACUAGCCCUGAAAAUGGAUGGCGCUGGAGCGUCGGGCCCAUACCCGGCCGUCGCCGGCAGUCGAGAGUGGACGGGAGCGGCGGGGGCGGCGCGCGCGCGCGCGCGUGUGGUGUGCGUCGGAGGGCGGCGGCGGCGGCGGCGGCGGGGGUGUGGGGUCCUUCCCCCGCCCCCCCCCCCACGCCUCCUCCCCUCCUCCCGCCCACGCCCCGCUCCCCGCCCCCGGAGCCCCGCGGACGCUACGCCGCGACGAGUAGGAGGGCCGCUGCGGUGAGCCUUGAAGCCUAGGGCGCGGGCCCGGGUGGAGCCGCCGCAGGUGCAGAUCUUGGUGGUAGUAGCAAAUAUUCAAACGAGAACUUUGAAGGCCGAAGUGGAGAAGGGUUCCAUGUGAACAGCAGUUGAACAUGGGUCAGUCGGUCCUGAGAGAUGGGCGAGCGCCGUUCCGAAGGGACGGGCGAUGGCCUCCGUUGCCCUCGGCCGAUCGAAAGGGAGUCGGGUUCAGAUCCCCGAAUCCGGAGUGGCGGAGAUGGGCGCCGCGAGGCGUCCAGUGCGGUAACGCGACCGAUCCCGGAGAAGCCGGCGGGAGCCCCGGGGAGAGUUCUCUUUUCUUUGUGAAGGGCAGGGCGCCCUGGAAUGGGUUCGCCCCGAGAGAGGGGCCCGUGCCUUGGAAAGCGUCGCGGUUCCGGCGGCGUCCGGUGAGCUCUCGCUGGCCCUUGAAAAUCCGGGGGAGAGGGUGUAAAUCUCGCGCCGGGCCGUACCCAUAUCCGCAGCAGGUCUCCAAGGUGAACAGCCUCUGGCAUGUUGGAACAAUGUAGGUAAGGGAAGUCGGCAAGCCGGAUCCGUAACUUCGGGAUAAGGAUUGGCUCUAAGGGCUGGGUCGGUCGGGCUGGGGCGCGAAGCGGGGCUGGGCGCGCGCCGCGGCUGGACGAGGCGCGCGCCCCCCCCACGCCCGGGGCACCCCCCUCGCGGCCCUCCCCCGCCCCACCCGCGCGCGCCGCUCGCUCCCUCCCCACCCCGCGCCCUCUCUCUCUCUCUCUCCCCCGCUCCCCGUCCUCCCCCCUCCCCGGGGGAGCGCCGCGUGGGGGCGCGGCGGGGGGAGAAGGGUCGGGGCGGCAGGGGCCGCGCGGCGGCCGCCGGGGCGGCCGGCGGGGGCAGGUCCCCGCGAGGGGGGCCCCGGGGACCCGGGGGGCCGGCGGCGGCGCGGACUCUGGACGCGAGCCGGGCCCUUCCCGUGGAUCGCCCCAGCUGCGGCGGGCGUCGCGGCCGCCCCCGGGGAGCCCGGCGGCGGCGCGGCGCGCCCCCCACCCCCACCCCACGUCUCGGUCGCGCGCGCGUCCGCUGGGGGCGGGAGCGGUCGGGCGGCGGCGGUCGGCGGGCGGCGGGGCGGGGCGGUUCGUCCCCCCGCCCUACCCCCCCGGCCCCGUCCGCCCCCCGUUCCCCCCUCCUCCUCGGCGCGCGGCGGCGGCGGCGGCAGGCGGCGGAGGGGCCGCGGGCCGGUCCCCCCCGCCGGGUCCGCCCCCGGGGCCGCGGUUCCGCGCGCGCCUCGCCUCGGCCGGCGCCUAGCAGCCGACUUAGAACUGGUGCGGACCAGGGGAAUCCGACUGUUUAAUUAAAACAAAGCAUCGCGAAGGCCCGCGGCGGGUGUUGACGCGAUGUGAUUUCUGCCCAGUGCUCUGAAUGUCAAAGUGAAGAAAUUCAAUGAAGCGCGGGUAAACGGCGGGAGUAACUAUGACUCUCUUAAGGUAGCCAAAUGCCUCGUCAUCUAAUUAGUGACGCGCAUGAAUGGAUGAACGAGAUUCCCACUGUCCCUACCUACUAUCCAGCGAAACCACAGCCAAGGGAACGGGCUUGGCGGAAUCAGCGGGGAAAGAAGACCCUGUUGAGCUUGACUCUAGUCUGGCACGGUGAAGAGACAUGAGAGGUGUAGAAUAAGUGGGAGGCCCCCGGCGCCCCCCCGGUGUCCCCGCGAGGGGCCCGGGGCGGGGUCCGCGGCCCUGCGGGCCGCCGGUGAAAUACCACUACUCUGAUCGUUUUUUCACUGACCCGGUGAGGCGGGGGGGCGAGCCCGAGGGGCUCUCGCUUCUGGCGCCAAGCGCCCGCCCGGCCGGGCGCGACCCGCUCCGGGGACAGUGCCAGGUGGGGAGUUUGACUGGGGCGGUACACCUGUCAAACGGUAACGCAGGUGUCCUAAGGCGAGCUCAGGGAGGACAGAAACCUCCCGUGGAGCAGAAGGGCAAAAGCUCGCUUGAUCUUGAUUUUCAGUACGAAUACAGACCGUGAAAGCGGGGCCUCACGAUCCUUCUGACCUUUUGGGUUUUAAGCAGGAGGUGUCAGAAAAGUUACCACAGGGAUAACUGGCUUGUGGCGGCCAAGCGUUCAUAGCGACGUCGCUUUUUGAUCCUUCGAUGUCGGCUCUUCCUAUCAUUGUGAAGCAGAAUUCGCCAAGCGUUGGAUUGUUCACCCACUAAUAGGGAACGUGAGCUGGGUUUAGACCGUCGUGAGACAGGUUAGUUUUACCCUACUGAUGAUGUGUUGUUGCCAUGGUAAUCCUGCUCAGUACGAGAGGAACCGCAGGUUCAGACAUUUGGUGUAUGUGCUUGGCUGAGGAGCCAAUGGGGCGAAGCUACCAUCUGUGGGAUUAUGACUGAACGCCUCUAAGUCAGAAUCCCGCCCAGGCGAACGAUACGGCAGCGCCGCGGAGCCUCGGUUGGCCUCGGAUAGCCGGUCCCCCGCCUGUCCCCGCCGGCGGGCCGCCCCCCCCUCCACGCGCCCCGCCGCGGGAGGGCGCGUGCCCCGCCGCGCGCCGGGACCGGGGUCCGGUGCGGAGUGCCCUUCGUCCUGGGAAACGGGGCGCGGCCGGAAAGGCGGCCGCCCCCUCGCCCGUCACGCACCGCACGUUCGUGGGGAACCUGGCGCUAAACCAUUCGUAGACGACCUGCUUCUGGGUCGGGGUUUCGUACGUAGCAGAGCAGCUCCCUCGCUGCGAUCUAUUGAAAGUCAGCCCUCGACACAAGGGUUUGUC
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rnasnoop_input1b.fa Tue Dec 06 12:35:50 2016 -0500 @@ -0,0 +1,2 @@ +>ACA51 +AACCTACCCCATATACACCTCAGCTCAGGCCCTGTGCCTGGTCTGTATTGTGAATGGGGGAACATAG
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rnasnoop_result1.txt Tue Dec 06 12:35:50 2016 -0500 @@ -0,0 +1,4 @@ +>ACA51 +>homo +<<<<<.<<<<.|.<<.<<<&...(((>>>.>>.((((...............................))))..>>>>.>>>>>))) 4468,4486;4479 : 8,65 (-35.60 = -16.10 + -7.60 + -12.40 + -3.60 + 4.1 ) (-23.60) +UGUUCACCCACUAAUAGGG&AACCUACCCCAUAUACACCUCAGCUCAGGCCCUGUGCCUGGUCUGUAUUGUGAAUGGGGGAACAUAG
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rnasubopt_input1.fa Tue Dec 06 12:35:50 2016 -0500 @@ -0,0 +1,4 @@ +>Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC (218800-218872) Ala (AGC) 73 bp Sc: 49.55 +TGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGTGAGAGGTAGTGGGATCGATGCCCACATTCTCCA +>Anolis_carolinensis_chrUn_GL343207.trna3-AlaAGC (1513626-1513698) Ala (AGC) 73 bp Sc: 56.15 +GGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGCGAGAGGTAGCGGGATTGATGCCCGCATTCTCCA
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rnasubopt_result1.txt Tue Dec 06 12:35:50 2016 -0500 @@ -0,0 +1,7 @@ +>Anolis_carolinensis_chrUn_GL343590.trna2-A [0] +UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA -22.00 0.00 +(((((((..((((........)))).(((((.......))))).....(((((.......))))))))).))) -22.00 +.((((((..((((........)))).(((((.......))))).....(((((.......))))))))))).. -22.00 +>Anolis_carolinensis_chrUn_GL343207.trna3-A [0] +GGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGCGAGAGGUAGCGGGAUUGAUGCCCGCAUUCUCCA -29.60 0.00 +(((((((..((((........)))).(((((.......))))).....(((((.......)))))))))))). -29.60
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rnaup_input1.fa Tue Dec 06 12:35:50 2016 -0500 @@ -0,0 +1,4 @@ +>Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC (218800-218872) Ala (AGC) 73 bp Sc: 49.55 +TGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGTGAGAGGTAGTGGGATCGATGCCCACATTCTCCA +>Anolis_carolinensis_chrUn_GL343207.trna3-AlaAGC (1513626-1513698) Ala (AGC) 73 bp Sc: 56.15 +GGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGCGAGAGGTAGCGGGATTGATGCCCGCATTCTCCA
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rnaup_result1.txt Tue Dec 06 12:35:50 2016 -0500 @@ -0,0 +1,6 @@ +>Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC + 55, 58 (0.019) for u= 4 +RNAup output in file: Anolis_carolinensis_chrUn_GL343590.trna2-A_u1.out +>Anolis_carolinensis_chrUn_GL343207.trna3-AlaAGC + 16, 19 (0.004) for u= 4 +RNAup output in file: Anolis_carolinensis_chrUn_GL343207.trna3-A_u1.out