comparison test-data/rnaplfold_result2.ps @ 0:289f7e5b3d51 draft

planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/rna_tools/vienna_rna commit 0065dafe7bbd382bb995b28cc4089c9e4f4eeeb9
author rnateam
date Tue, 06 Dec 2016 12:33:12 -0500
parents
children
comparison
equal deleted inserted replaced
-1:000000000000 0:289f7e5b3d51
1 %!PS-Adobe-3.0 EPSF-3.0
2 %%Title: RNA Dot Plot
3 %%Creator: ViennaRNA-2.2.10
4 %%CreationDate: Tue Oct 4 14:45:55 2016
5 %%BoundingBox: 66 530 520 650
6 %%DocumentFonts: Helvetica
7 %%Pages: 1
8 %%EndComments
9
10 %Options:
11 %This file contains the square roots of the base pair probabilities in the form
12 % i j sqrt(p(i,j)) ubox
13
14 %%BeginProlog
15 /DPdict 100 dict def
16 DPdict begin
17 /logscale false def
18 /lpmin 1e-05 log def
19
20 /box { %size x y box - draws box centered on x,y
21 2 index 0.5 mul sub % x -= 0.5
22 exch 2 index 0.5 mul sub exch % y -= 0.5
23 3 -1 roll dup rectfill
24 } bind def
25
26 /ubox {
27 logscale {
28 log dup add lpmin div 1 exch sub dup 0 lt { pop 0 } if
29 } if
30 3 1 roll
31 exch len exch sub 1 add box
32 } bind def
33
34 /lbox {
35 3 1 roll
36 len exch sub 1 add box
37 } bind def
38
39 /drawseq {
40 % print sequence along all 4 sides
41 [ [0.7 -0.3 0 ]
42 [0.7 0.7 len add 0]
43 [-0.3 len sub -0.4 -90]
44 [-0.3 len sub 0.7 len add -90]
45 ] {
46 gsave
47 aload pop rotate translate
48 0 1 len 1 sub {
49 dup 0 moveto
50 sequence exch 1 getinterval
51 show
52 } for
53 grestore
54 } forall
55 } bind def
56
57 /drawgrid{
58 0.01 setlinewidth
59 len log 0.9 sub cvi 10 exch exp % grid spacing
60 dup 1 gt {
61 dup dup 20 div dup 2 array astore exch 40 div setdash
62 } { [0.3 0.7] 0.1 setdash } ifelse
63 0 exch len {
64 dup dup
65 0 moveto
66 len lineto
67 dup
68 len exch sub 0 exch moveto
69 len exch len exch sub lineto
70 stroke
71 } for
72 [] 0 setdash
73 0.04 setlinewidth
74 currentdict /cutpoint known {
75 cutpoint 1 sub
76 dup dup -1 moveto len 1 add lineto
77 len exch sub dup
78 -1 exch moveto len 1 add exch lineto
79 stroke
80 } if
81 0.5 neg dup translate
82 } bind def
83
84 end
85 %%EndProlog
86 DPdict begin
87 %delete next line to get rid of title
88 270 665 moveto /Helvetica findfont 14 scalefont setfont (Anolis_carolinensis_chrUn_GL343207.trna3-A) show
89
90 /sequence { (\
91 GGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGCGAGAGGUAGCGGGAUUGAUGCCCGCAUUCUCCA\
92 ) } def
93 /winSize 70 def
94 /len { sequence length } bind def
95
96 292 416 translate
97 72 6 mul len 1 add winSize add 2 sqrt mul div dup scale
98 /Helvetica findfont 0.95 scalefont setfont
99
100 /drawseq_turn {% print sequence at bottom
101 gsave
102 len 2 sqrt div dup neg 0.28 add exch 0.78 sub translate
103 0 1 len 1 sub {
104 dup dup 2 sqrt mul 0 moveto
105 sequence exch 1 getinterval
106 show
107 } for
108 grestore
109 } bind def
110 /drawgrid_turn{
111 0.01 setlinewidth
112 len log 0.9 sub cvi 10 exch exp % grid spacing
113 dup 1 gt {
114 dup dup 20 div dup 2 array astore exch 40 div setdash
115 } { [0.3 0.7] 0.1 setdash } ifelse
116 0 exch len { %for (0, gridspacing, len)
117 dup dup %duplicate what - gridspacing??
118 dup len exch sub moveto %moveto diagonal?
119 dup winSize gt
120 {dup dup len exch sub winSize add lineto}
121 {dup len lineto}ifelse
122 dup len exch sub moveto %moveto diagonal?
123 dup len winSize sub le
124 {dup dup len exch sub dup winSize exch sub len add exch lineto}
125 {dup dup len exch sub len exch lineto}ifelse stroke pop pop
126 } for
127 len log 0.9 sub cvi 10 exch exp % grid spacing
128 dup 1 gt {
129 dup dup 20 div dup 2 array astore exch 40 div setdash
130 } { [0.3 0.7] 0.1 setdash } ifelse
131 0 exch len { %for (0, gridspacing, len)
132 dup dup %duplicate what - gridspacing??
133 dup len exch sub moveto %moveto diagonal?
134 len exch sub 0.7 sub exch 0.7 sub exch lineto
135 stroke
136 }for
137 winSize len moveto len winSize lineto stroke
138 [] 0 setdash
139 0.04 setlinewidth
140 currentdict /cutpoint known {
141 cutpoint 1 sub
142 dup dup -1 moveto len 1 add lineto
143 len exch sub dup
144 -1 exch moveto len 1 add exch lineto
145 stroke
146 } if
147 0.5 neg dup translate
148 } bind def
149
150 0.5 dup translate
151 drawseq_turn
152 45 rotate
153
154
155 %draw the grid
156 drawgrid_turn
157
158 %start of base pair probability data
159 2 70 0.1914 ubox
160 2 71 0.9787 ubox
161 3 69 0.1660 ubox
162 3 70 0.7676 ubox
163 3 72 0.8449 ubox
164 4 68 0.1377 ubox
165 4 69 0.7113 ubox
166 4 71 0.4928 ubox
167 5 67 0.1266 ubox
168 5 68 0.7090 ubox
169 5 70 0.3955 ubox
170 6 67 0.6860 ubox
171 7 66 0.6345 ubox
172 10 25 0.9888 ubox
173 11 24 0.9915 ubox
174 12 23 0.9914 ubox
175 13 22 0.9913 ubox
176 15 20 0.1291 ubox
177 17 73 0.1217 ubox
178 18 72 0.1091 ubox
179 27 43 0.9522 ubox
180 28 42 0.9836 ubox
181 29 41 0.9874 ubox
182 30 40 0.9886 ubox
183 31 39 0.9883 ubox
184 33 37 0.1014 ubox
185 38 73 0.1170 ubox
186 39 72 0.1080 ubox
187 41 71 0.1523 ubox
188 42 70 0.1341 ubox
189 43 69 0.1387 ubox
190 43 71 0.2800 ubox
191 44 68 0.1392 ubox
192 44 70 0.3364 ubox
193 45 67 0.1266 ubox
194 45 68 0.1838 ubox
195 45 69 0.3586 ubox
196 45 72 0.3252 ubox
197 46 67 0.2524 ubox
198 46 68 0.3007 ubox
199 46 69 0.1142 ubox
200 46 71 0.2655 ubox
201 47 66 0.2807 ubox
202 48 67 0.1394 ubox
203 49 65 0.9981 ubox
204 50 64 0.9997 ubox
205 51 63 0.9997 ubox
206 52 62 0.9997 ubox
207 53 61 0.9981 ubox
208 54 59 0.1565 ubox
209 55 60 0.3242 ubox
210 showpage
211 end
212 %%EOF