# HG changeset patch
# User rnateam
# Date 1513776644 18000
# Node ID 22e8485bc5f3979e735102211d947622260d9c56
planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/rna_tools/vienna_rna commit 36681a08c6e44c663169caaefd964781c43d0d29
diff -r 000000000000 -r 22e8485bc5f3 macros.xml
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/macros.xml Wed Dec 20 08:30:44 2017 -0500
@@ -0,0 +1,27 @@
+
+
+
+ viennarna
+
+
+
+ 2.2.10
+
+ @EXECUTABLE@ --version
+
+
+
+
+
+
+
+
+
+
+
+
+
+ 10.1186/1748-7188-6-26
+
+
+
diff -r 000000000000 -r 22e8485bc5f3 rnafold_SHAPE.py
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/rnafold_SHAPE.py Wed Dec 20 08:30:44 2017 -0500
@@ -0,0 +1,45 @@
+### overcoming the problem of SHAPE data working with a single line.
+### creating multiple multiple files containg SHAPE data for a single sequence and running RNAfold for every
+### single sequence.
+
+import os
+import sys
+from os import system
+from Bio import SeqIO
+import re
+from subprocess import Popen, PIPE
+
+params_list = sys.argv[1:]
+param_list_no_shape = [s for s in params_list if not "--shape=" in s ]
+shape_file = [s for s in params_list if "--shape=" in s ]
+assert (len(shape_file) == 1)
+
+shape_file = shape_file[0]
+shape_file = shape_file.replace('--shape=', '')
+
+params_no_shape = " ".join(str(x) for x in param_list_no_shape)
+
+pattern = re.compile("^>.*$")
+id_line = ""
+with open(shape_file, 'r') as f:
+ content = f.read()
+ lines = content.split('\n')
+ for line in lines:
+ if pattern.match(line):
+ id_line = line.split()[0]
+ id_line = id_line[1:]
+ continue
+ else:
+ with open(id_line +'.tmp', "a") as clFile:
+ clFile.write(line + "\n")
+
+input_file = sys.stdin
+
+for record in SeqIO.parse(input_file, "fasta"):
+ seq = ">{}\n{}".format(record.id,record.seq)
+ cmd = " RNAfold --shape=" + record.id + '.tmp ' + params_no_shape
+ p = Popen(cmd , stdin=PIPE, shell=True, stdout=PIPE, stderr=PIPE)
+ out,err = p.communicate(seq.encode())
+ if err:
+ raise RuntimeError("Error in calling RNAfold\n{}\n{}\n".format(out, err))
+ print (out.decode('utf-8').strip())
diff -r 000000000000 -r 22e8485bc5f3 rnaplfold.xml
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/rnaplfold.xml Wed Dec 20 08:30:44 2017 -0500
@@ -0,0 +1,125 @@
+
+ predicts RNA secondary structures including pseudoknots
+
+
+ RNAplfold
+ macros.xml
+
+
+
+
+
+ files.tmp
+ && tar -cf '$outputf' --files-from=files.tmp
+
+]]>
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
diff -r 000000000000 -r 22e8485bc5f3 test-data/Anolis_caro_chrUn_GL343207.trna3_AlaAGC_dp.ps
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/Anolis_caro_chrUn_GL343207.trna3_AlaAGC_dp.ps Wed Dec 20 08:30:44 2017 -0500
@@ -0,0 +1,370 @@
+%!PS-Adobe-3.0 EPSF-3.0
+%%Title: RNA Dot Plot
+%%Creator: ViennaRNA-2.2.10
+%%CreationDate: Tue Dec 19 19:42:58 2017
+%%BoundingBox: 66 211 518 662
+%%DocumentFonts: Helvetica
+%%Pages: 1
+%%EndComments
+
+%Options:
+%
+%This file contains the square roots of the base pair probabilities in the form
+% i j sqrt(p(i,j)) ubox
+
+%%BeginProlog
+/DPdict 100 dict def
+DPdict begin
+/logscale false def
+/lpmin 1e-05 log def
+
+/box { %size x y box - draws box centered on x,y
+ 2 index 0.5 mul sub % x -= 0.5
+ exch 2 index 0.5 mul sub exch % y -= 0.5
+ 3 -1 roll dup rectfill
+} bind def
+
+/ubox {
+ logscale {
+ log dup add lpmin div 1 exch sub dup 0 lt { pop 0 } if
+ } if
+ 3 1 roll
+ exch len exch sub 1 add box
+} bind def
+
+/lbox {
+ 3 1 roll
+ len exch sub 1 add box
+} bind def
+
+/drawseq {
+% print sequence along all 4 sides
+[ [0.7 -0.3 0 ]
+ [0.7 0.7 len add 0]
+ [-0.3 len sub -0.4 -90]
+ [-0.3 len sub 0.7 len add -90]
+] {
+ gsave
+ aload pop rotate translate
+ 0 1 len 1 sub {
+ dup 0 moveto
+ sequence exch 1 getinterval
+ show
+ } for
+ grestore
+ } forall
+} bind def
+
+/drawgrid{
+ 0.01 setlinewidth
+ len log 0.9 sub cvi 10 exch exp % grid spacing
+ dup 1 gt {
+ dup dup 20 div dup 2 array astore exch 40 div setdash
+ } { [0.3 0.7] 0.1 setdash } ifelse
+ 0 exch len {
+ dup dup
+ 0 moveto
+ len lineto
+ dup
+ len exch sub 0 exch moveto
+ len exch len exch sub lineto
+ stroke
+ } for
+ [] 0 setdash
+ 0.04 setlinewidth
+ currentdict /cutpoint known {
+ cutpoint 1 sub
+ dup dup -1 moveto len 1 add lineto
+ len exch sub dup
+ -1 exch moveto len 1 add exch lineto
+ stroke
+ } if
+ 0.5 neg dup translate
+} bind def
+
+end
+%%EndProlog
+DPdict begin
+%delete next line to get rid of title
+270 665 moveto /Helvetica findfont 14 scalefont setfont (Anolis_caro_chrUn_GL343207.trna3_AlaAGC) show
+
+/sequence { (\
+GGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGCGAGAGGUAGCGGGAUUGAUGCCCGCAUUCUCCA\
+) } def
+/len { sequence length } bind def
+
+72 216 translate
+72 6 mul len 1 add div dup scale
+/Helvetica findfont 0.95 scalefont setfont
+
+drawseq
+0.5 dup translate
+% draw diagonal
+0.04 setlinewidth
+0 len moveto len 0 lineto stroke
+
+/min { 2 copy gt { exch } if pop } bind def
+
+/utri{ % i j prob utri
+ gsave
+ 1 min 2 div
+ 0.85 mul 0.15 add 0.95 0.33
+ 3 1 roll % prepare hsb color
+ sethsbcolor
+ % now produce the coordinates for lines
+ exch 1 sub dup len exch sub dup 4 -1 roll dup 3 1 roll dup len exch sub
+ moveto lineto lineto closepath fill
+ grestore
+} bind def
+/uHmotif{ % i j uHmotif
+ gsave
+ 1 min 2 div
+ 0.85 mul 0.15 add 0.95 0.99
+ 3 1 roll % prepare hsb color
+ sethsbcolor
+ % now produce the coordinates for lines
+ exch 1 sub dup len exch sub dup 4 -1 roll dup 3 1 roll dup len exch sub
+ moveto lineto lineto closepath fill
+ grestore
+} bind def
+/lHmotif{ % i j lHmotif
+ gsave
+ 1 min 2 div
+ 0.85 mul 0.15 add 0.95 0.99
+ 3 1 roll % prepare hsb color
+ sethsbcolor
+ % now produce the coordinates for lines
+ dup len exch sub dup 4 -1 roll 1 sub dup 3 1 roll dup len exch sub
+ moveto lineto lineto closepath fill
+ grestore
+} bind def
+/uImotif{ % i j k l uImotif
+ gsave
+ 1 min 2 div
+ 0.85 mul 0.15 add 0.95 0.99
+ 3 1 roll % prepare hsb color
+ sethsbcolor
+ % now produce the coordinates for lines
+ 1 sub dup 5 1 roll exch len exch sub dup 5 1 roll 3 -1 roll dup
+ 5 1 roll exch 4 1 roll 3 1 roll exch 1 sub len exch sub dup 3 1 roll
+ moveto lineto lineto lineto closepath fill
+ grestore
+} bind def
+/lImotif{ % i j k l lImotif
+ gsave
+ 1 min 2 div
+ 0.85 mul 0.15 add 0.95 0.99
+ 3 1 roll % prepare hsb color
+ sethsbcolor
+ % now produce the coordinates for lines
+ 4 -1 roll 1 sub dup 5 1 roll exch 1 sub len exch sub dup 3 -1 roll exch
+ 5 -1 roll len exch sub dup 6 -1 roll dup 3 1 roll 7 4 roll
+ moveto lineto lineto lineto closepath fill
+ grestore
+} bind def
+
+%data starts here
+
+%start of quadruplex data
+
+%start of Hmotif data
+
+%start of Imotif data
+
+%draw the grid
+drawgrid
+
+%start of base pair probability data
+1 71 0.011137621 ubox
+1 72 0.998618513 ubox
+2 70 0.011249479 ubox
+2 71 0.999343269 ubox
+2 72 0.029380302 ubox
+3 69 0.016278852 ubox
+3 70 0.998657995 ubox
+3 71 0.029349731 ubox
+3 72 0.013044031 ubox
+4 68 0.015570075 ubox
+4 69 0.999660285 ubox
+4 70 0.006500567 ubox
+4 71 0.013063530 ubox
+5 67 0.017184802 ubox
+5 68 0.995393993 ubox
+5 70 0.012116272 ubox
+6 20 0.003683136 ubox
+6 47 0.007871866 ubox
+6 67 0.961997835 ubox
+6 68 0.010641824 ubox
+7 19 0.003963646 ubox
+7 22 0.016669769 ubox
+7 23 0.006395271 ubox
+7 26 0.010803708 ubox
+7 45 0.003325342 ubox
+7 46 0.008388346 ubox
+7 66 0.889354167 ubox
+8 18 0.004993356 ubox
+8 21 0.043576199 ubox
+8 22 0.009051039 ubox
+8 23 0.003412982 ubox
+8 26 0.053349931 ubox
+8 44 0.006391561 ubox
+8 45 0.009575801 ubox
+8 46 0.006511628 ubox
+8 48 0.044296110 ubox
+8 66 0.051228716 ubox
+9 17 0.005076838 ubox
+9 20 0.044973880 ubox
+9 47 0.045851242 ubox
+9 67 0.006907131 ubox
+10 20 0.031947572 ubox
+10 25 0.993218795 ubox
+10 47 0.003684611 ubox
+10 61 0.005362683 ubox
+11 18 0.045881626 ubox
+11 19 0.032788757 ubox
+11 22 0.010762380 ubox
+11 24 0.996351171 ubox
+11 43 0.031784396 ubox
+11 45 0.044997253 ubox
+11 46 0.003273388 ubox
+11 60 0.005393685 ubox
+12 18 0.028759750 ubox
+12 19 0.007591504 ubox
+12 21 0.010602364 ubox
+12 23 0.996289342 ubox
+12 42 0.031993047 ubox
+12 44 0.044989514 ubox
+12 58 0.005409282 ubox
+13 18 0.016589428 ubox
+13 19 0.009128152 ubox
+13 22 0.996158882 ubox
+13 41 0.032010508 ubox
+13 43 0.044839517 ubox
+13 57 0.005483356 ubox
+14 20 0.079642667 ubox
+14 56 0.005446527 ubox
+15 20 0.129735024 ubox
+15 55 0.005085787 ubox
+16 20 0.018529841 ubox
+16 38 0.051862141 ubox
+17 21 0.010497970 ubox
+17 26 0.003797728 ubox
+17 37 0.052295806 ubox
+17 39 0.003520191 ubox
+17 42 0.004660118 ubox
+17 52 0.004889289 ubox
+18 25 0.005375323 ubox
+18 36 0.051745231 ubox
+18 38 0.003387544 ubox
+19 25 0.004215070 ubox
+19 36 0.018363451 ubox
+19 40 0.005479857 ubox
+19 50 0.005352275 ubox
+20 24 0.003956630 ubox
+20 34 0.049426221 ubox
+20 35 0.019676299 ubox
+20 39 0.005488315 ubox
+20 49 0.005308891 ubox
+21 33 0.037607150 ubox
+21 38 0.005407841 ubox
+22 32 0.023047831 ubox
+22 33 0.039236028 ubox
+23 32 0.049874318 ubox
+23 47 0.036867639 ubox
+24 31 0.055184372 ubox
+24 47 0.041474959 ubox
+25 30 0.055108050 ubox
+25 41 0.003625640 ubox
+25 45 0.072422399 ubox
+25 46 0.047506335 ubox
+26 36 0.020612775 ubox
+26 40 0.011634581 ubox
+26 47 0.044476135 ubox
+27 35 0.020631543 ubox
+27 39 0.011645626 ubox
+27 43 0.992061337 ubox
+27 45 0.025461226 ubox
+27 46 0.039850990 ubox
+28 34 0.019643833 ubox
+28 42 0.996960401 ubox
+28 44 0.021374269 ubox
+28 45 0.024434496 ubox
+29 41 0.997917003 ubox
+29 43 0.018395309 ubox
+29 45 0.003166236 ubox
+30 36 0.012434123 ubox
+30 40 0.998065717 ubox
+30 47 0.007404570 ubox
+31 35 0.012393915 ubox
+31 39 0.997764981 ubox
+31 41 0.005414838 ubox
+31 43 0.003645699 ubox
+31 46 0.007622516 ubox
+32 37 0.068093187 ubox
+32 39 0.013599795 ubox
+32 42 0.003678913 ubox
+32 45 0.007610493 ubox
+33 37 0.102337630 ubox
+33 39 0.003720007 ubox
+33 41 0.003538594 ubox
+33 44 0.007538047 ubox
+34 38 0.013851913 ubox
+36 41 0.007501659 ubox
+38 48 0.018700348 ubox
+39 47 0.020533473 ubox
+40 46 0.020625702 ubox
+44 68 0.005576608 ubox
+44 70 0.006111196 ubox
+45 50 0.003800521 ubox
+45 62 0.010043051 ubox
+45 65 0.003484260 ubox
+45 67 0.009783316 ubox
+45 68 0.032579696 ubox
+45 69 0.007408521 ubox
+46 61 0.010086460 ubox
+46 65 0.005780351 ubox
+46 67 0.077112938 ubox
+46 68 0.006873266 ubox
+47 60 0.010092967 ubox
+47 64 0.003785455 ubox
+47 66 0.084736602 ubox
+48 59 0.008724857 ubox
+48 67 0.019275395 ubox
+49 65 0.998806957 ubox
+50 57 0.009062054 ubox
+50 64 0.999848265 ubox
+51 56 0.007052370 ubox
+51 62 0.010700667 ubox
+51 63 0.999834583 ubox
+52 61 0.014860342 ubox
+52 62 0.999778783 ubox
+52 63 0.005533111 ubox
+53 61 0.998254922 ubox
+53 62 0.007658167 ubox
+54 59 0.156536412 ubox
+55 60 0.324268739 ubox
+56 60 0.024269416 ubox
+1 72 0.9500000 lbox
+2 71 0.9500000 lbox
+3 70 0.9500000 lbox
+4 69 0.9500000 lbox
+5 68 0.9500000 lbox
+6 67 0.9500000 lbox
+7 66 0.9500000 lbox
+10 25 0.9500000 lbox
+11 24 0.9500000 lbox
+12 23 0.9500000 lbox
+13 22 0.9500000 lbox
+27 43 0.9500000 lbox
+28 42 0.9500000 lbox
+29 41 0.9500000 lbox
+30 40 0.9500000 lbox
+31 39 0.9500000 lbox
+49 65 0.9500000 lbox
+50 64 0.9500000 lbox
+51 63 0.9500000 lbox
+52 62 0.9500000 lbox
+53 61 0.9500000 lbox
+showpage
+end
+%%EOF
diff -r 000000000000 -r 22e8485bc5f3 test-data/Anolis_caro_chrUn_GL343207.trna3_AlaAGC_ss.ps
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/Anolis_caro_chrUn_GL343207.trna3_AlaAGC_ss.ps Wed Dec 20 08:30:44 2017 -0500
@@ -0,0 +1,231 @@
+%!PS-Adobe-3.0 EPSF-3.0
+%%Creator: ViennaRNA-2.2.10
+%%CreationDate: Tue Dec 19 19:42:58 2017
+%%Title: RNA Secondary Structure Plot
+%%BoundingBox: 66 210 518 662
+%%DocumentFonts: Helvetica
+%%Pages: 1
+%%EndComments
+
+%Options:
+% to switch off outline pairs of sequence comment or
+% delete the appropriate line near the end of the file
+
+%%BeginProlog
+/RNAplot 100 dict def
+RNAplot begin
+/fsize 14 def
+/outlinecolor {0.2 setgray} bind def
+/paircolor {0.2 setgray} bind def
+/seqcolor {0 setgray} bind def
+/cshow { dup stringwidth pop -2 div fsize -3 div rmoveto show} bind def
+/min { 2 copy gt { exch } if pop } bind def
+/max { 2 copy lt { exch } if pop } bind def
+/arccoords { % i j arccoords
+ % puts optimal x1 y1 x2 y2 coordinates used in bezier curves from i to j
+ % onto the stack
+ dup 3 -1 roll dup 4 -1 roll lt dup dup 5 2 roll {exch} if
+ dup 3 -1 roll dup 3 -1 roll exch sub 1 sub dup
+ 4 -2 roll 5 -1 roll {exch} if 4 2 roll
+ sequence length dup 2 div exch 3 1 roll lt
+ {exch 5 -1 roll pop 4 -2 roll exch 4 2 roll}
+ { 4 2 roll 5 -1 roll dup 6 1 roll {exch} if
+ 4 -2 roll exch pop dup 3 -1 roll dup 4 1 roll
+ exch add 4 -1 roll dup 5 1 roll sub 1 sub
+ 5 -1 roll not {4 -2 roll exch 4 2 roll} if
+ }ifelse
+ % compute the scalingfactor and prepare (1-sf) and sf*r
+ 2 mul exch cpr 3 1 roll div dup
+ 3 -1 roll mul exch 1 exch sub exch
+ % compute the coordinates
+ 3 -1 roll 1 sub coor exch get aload pop % get coord for i
+ 4 -1 roll dup 5 1 roll mul 3 -1 roll dup 4 1 roll add exch % calculate y1
+ 4 -1 roll dup 5 1 roll mul 3 -1 roll dup 4 1 roll add exch % calculate x1
+ 5 -1 roll 1 sub coor exch get aload pop % get coord for j
+ % duplicate j coord
+ dup 3 -1 roll dup 4 1 roll exch 8 2 roll
+ 6 -1 roll dup 7 1 roll mul 5 -1 roll dup 6 1 roll add exch % calculate y2
+ 6 -1 roll mul 5 -1 roll add exch % calculate x2
+ 6 -2 roll % reorder
+} bind def
+/drawoutline {
+ gsave outlinecolor newpath
+ coor 0 get aload pop 0.8 0 360 arc % draw 5' circle of 1st sequence
+ currentdict /cutpoint known % check if cutpoint is defined
+ {coor 0 cutpoint getinterval
+ {aload pop lineto} forall % draw outline of 1st sequence
+ coor cutpoint 1 add get aload pop
+ 2 copy moveto 0.8 0 360 arc % draw 5' circle of 2nd sequence
+ coor cutpoint 1 add coor length cutpoint 1 add sub getinterval
+ {aload pop lineto} forall} % draw outline of 2nd sequence
+ {coor {aload pop lineto} forall} % draw outline as a whole
+ ifelse
+ stroke grestore
+} bind def
+/drawpairs {
+ paircolor
+ 0.7 setlinewidth
+ [9 3.01] 9 setdash
+ newpath
+ pairs {aload pop
+ currentdict (cpr) known
+ { exch dup
+ coor exch 1 sub get aload pop moveto
+ exch arccoords curveto
+ }
+ { coor exch 1 sub get aload pop moveto
+ coor exch 1 sub get aload pop lineto
+ }ifelse
+ } forall
+ stroke
+} bind def
+% draw bases
+/drawbases {
+ [] 0 setdash
+ seqcolor
+ 0
+ coor {
+ aload pop moveto
+ dup sequence exch 1 getinterval cshow
+ 1 add
+ } forall
+ pop
+} bind def
+
+/init {
+ /Helvetica findfont fsize scalefont setfont
+ 1 setlinejoin
+ 1 setlinecap
+ 0.8 setlinewidth
+ 72 216 translate
+ % find the coordinate range
+ /xmax -1000 def /xmin 10000 def
+ /ymax -1000 def /ymin 10000 def
+ coor {
+ aload pop
+ dup ymin lt {dup /ymin exch def} if
+ dup ymax gt {/ymax exch def} {pop} ifelse
+ dup xmin lt {dup /xmin exch def} if
+ dup xmax gt {/xmax exch def} {pop} ifelse
+ } forall
+ /size {xmax xmin sub ymax ymin sub max} bind def
+ 72 6 mul size div dup scale
+ size xmin sub xmax sub 2 div size ymin sub ymax sub 2 div
+ translate
+} bind def
+end
+%%EndProlog
+RNAplot begin
+% data start here
+/sequence (\
+GGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGCGAGAGGUAGCGGGAUUGAUGCCCGCAUUCUCCA\
+) def
+/coor [
+[111.04756165 225.82804871]
+[110.41094971 210.84155273]
+[109.77433014 195.85507202]
+[109.13771057 180.86859131]
+[108.50109100 165.88211060]
+[107.86447144 150.89561462]
+[107.22785950 135.90913391]
+[90.28739166 133.48460388]
+[77.11851501 123.91786957]
+[70.32070923 110.05319977]
+[55.37474823 111.32528687]
+[40.42878342 112.59737396]
+[25.48282242 113.86946106]
+[17.57515907 127.22043610]
+[3.31690264 133.34266663]
+[-11.80935574 129.88204956]
+[-21.98726082 118.16923523]
+[-23.30319977 102.70806122]
+[-15.25116920 89.44365692]
+[-0.92733771 83.47645569]
+[14.16048908 87.10096741]
+[24.21073341 98.92350006]
+[39.15669632 97.65141296]
+[54.10265732 96.37932587]
+[69.04862213 95.10723114]
+[75.20735168 80.83619690]
+[87.46604156 71.28019714]
+[84.93103027 56.49596024]
+[82.39601898 41.71172333]
+[79.86100006 26.92748451]
+[77.32598877 12.14324570]
+[63.73017883 4.41744947]
+[58.32971573 -10.25800610]
+[63.67453384 -24.95381927]
+[77.24097443 -32.73107910]
+[92.62337494 -29.91759682]
+[102.55863953 -17.84181786]
+[102.35564423 -2.20555139]
+[92.11022949 9.60823345]
+[94.64524078 24.39247131]
+[97.18025208 39.17671204]
+[99.71526337 53.96094894]
+[102.25028229 68.74518585]
+[111.61898041 69.95008087]
+[120.45154572 73.97383881]
+[127.89853668 80.59681702]
+[133.19635010 89.34370422]
+[135.74378967 99.51597595]
+[135.16680908 110.24712372]
+[150.04531860 112.15238953]
+[164.92382812 114.05766296]
+[179.80232239 115.96292877]
+[194.68083191 117.86819458]
+[206.04914856 107.13062286]
+[221.66270447 106.26418304]
+[234.14927673 115.67798615]
+[237.61306763 130.92712402]
+[230.41859436 144.81141663]
+[215.96286011 150.77513123]
+[201.07142639 146.00236511]
+[192.77557373 132.74670410]
+[177.89706421 130.84143066]
+[163.01855469 128.93617249]
+[148.14004517 127.03089905]
+[133.26153564 125.12563324]
+[122.21434021 135.27252197]
+[122.85095978 150.25900269]
+[123.48757935 165.24548340]
+[124.12419128 180.23197937]
+[124.76081085 195.21846008]
+[125.39743042 210.20494080]
+[126.03404999 225.19142151]
+[129.04023743 244.33856201]
+] def
+/pairs [
+[1 72]
+[2 71]
+[3 70]
+[4 69]
+[5 68]
+[6 67]
+[7 66]
+[10 25]
+[11 24]
+[12 23]
+[13 22]
+[27 43]
+[28 42]
+[29 41]
+[30 40]
+[31 39]
+[49 65]
+[50 64]
+[51 63]
+[52 62]
+[53 61]
+] def
+
+init
+
+% switch off outline pairs or bases by removing these lines
+drawoutline
+drawpairs
+drawbases
+% show it
+showpage
+end
+%%EOF
diff -r 000000000000 -r 22e8485bc5f3 test-data/Anolis_caro_chrUn_GL343590.trna2_AlaAGC_dp.ps
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/Anolis_caro_chrUn_GL343590.trna2_AlaAGC_dp.ps Wed Dec 20 08:30:44 2017 -0500
@@ -0,0 +1,507 @@
+%!PS-Adobe-3.0 EPSF-3.0
+%%Title: RNA Dot Plot
+%%Creator: ViennaRNA-2.2.10
+%%CreationDate: Tue Dec 19 19:42:58 2017
+%%BoundingBox: 66 211 518 662
+%%DocumentFonts: Helvetica
+%%Pages: 1
+%%EndComments
+
+%Options:
+%
+%This file contains the square roots of the base pair probabilities in the form
+% i j sqrt(p(i,j)) ubox
+
+%%BeginProlog
+/DPdict 100 dict def
+DPdict begin
+/logscale false def
+/lpmin 1e-05 log def
+
+/box { %size x y box - draws box centered on x,y
+ 2 index 0.5 mul sub % x -= 0.5
+ exch 2 index 0.5 mul sub exch % y -= 0.5
+ 3 -1 roll dup rectfill
+} bind def
+
+/ubox {
+ logscale {
+ log dup add lpmin div 1 exch sub dup 0 lt { pop 0 } if
+ } if
+ 3 1 roll
+ exch len exch sub 1 add box
+} bind def
+
+/lbox {
+ 3 1 roll
+ len exch sub 1 add box
+} bind def
+
+/drawseq {
+% print sequence along all 4 sides
+[ [0.7 -0.3 0 ]
+ [0.7 0.7 len add 0]
+ [-0.3 len sub -0.4 -90]
+ [-0.3 len sub 0.7 len add -90]
+] {
+ gsave
+ aload pop rotate translate
+ 0 1 len 1 sub {
+ dup 0 moveto
+ sequence exch 1 getinterval
+ show
+ } for
+ grestore
+ } forall
+} bind def
+
+/drawgrid{
+ 0.01 setlinewidth
+ len log 0.9 sub cvi 10 exch exp % grid spacing
+ dup 1 gt {
+ dup dup 20 div dup 2 array astore exch 40 div setdash
+ } { [0.3 0.7] 0.1 setdash } ifelse
+ 0 exch len {
+ dup dup
+ 0 moveto
+ len lineto
+ dup
+ len exch sub 0 exch moveto
+ len exch len exch sub lineto
+ stroke
+ } for
+ [] 0 setdash
+ 0.04 setlinewidth
+ currentdict /cutpoint known {
+ cutpoint 1 sub
+ dup dup -1 moveto len 1 add lineto
+ len exch sub dup
+ -1 exch moveto len 1 add exch lineto
+ stroke
+ } if
+ 0.5 neg dup translate
+} bind def
+
+end
+%%EndProlog
+DPdict begin
+%delete next line to get rid of title
+270 665 moveto /Helvetica findfont 14 scalefont setfont (Anolis_caro_chrUn_GL343590.trna2_AlaAGC) show
+
+/sequence { (\
+UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA\
+) } def
+/len { sequence length } bind def
+
+72 216 translate
+72 6 mul len 1 add div dup scale
+/Helvetica findfont 0.95 scalefont setfont
+
+drawseq
+0.5 dup translate
+% draw diagonal
+0.04 setlinewidth
+0 len moveto len 0 lineto stroke
+
+/min { 2 copy gt { exch } if pop } bind def
+
+/utri{ % i j prob utri
+ gsave
+ 1 min 2 div
+ 0.85 mul 0.15 add 0.95 0.33
+ 3 1 roll % prepare hsb color
+ sethsbcolor
+ % now produce the coordinates for lines
+ exch 1 sub dup len exch sub dup 4 -1 roll dup 3 1 roll dup len exch sub
+ moveto lineto lineto closepath fill
+ grestore
+} bind def
+/uHmotif{ % i j uHmotif
+ gsave
+ 1 min 2 div
+ 0.85 mul 0.15 add 0.95 0.99
+ 3 1 roll % prepare hsb color
+ sethsbcolor
+ % now produce the coordinates for lines
+ exch 1 sub dup len exch sub dup 4 -1 roll dup 3 1 roll dup len exch sub
+ moveto lineto lineto closepath fill
+ grestore
+} bind def
+/lHmotif{ % i j lHmotif
+ gsave
+ 1 min 2 div
+ 0.85 mul 0.15 add 0.95 0.99
+ 3 1 roll % prepare hsb color
+ sethsbcolor
+ % now produce the coordinates for lines
+ dup len exch sub dup 4 -1 roll 1 sub dup 3 1 roll dup len exch sub
+ moveto lineto lineto closepath fill
+ grestore
+} bind def
+/uImotif{ % i j k l uImotif
+ gsave
+ 1 min 2 div
+ 0.85 mul 0.15 add 0.95 0.99
+ 3 1 roll % prepare hsb color
+ sethsbcolor
+ % now produce the coordinates for lines
+ 1 sub dup 5 1 roll exch len exch sub dup 5 1 roll 3 -1 roll dup
+ 5 1 roll exch 4 1 roll 3 1 roll exch 1 sub len exch sub dup 3 1 roll
+ moveto lineto lineto lineto closepath fill
+ grestore
+} bind def
+/lImotif{ % i j k l lImotif
+ gsave
+ 1 min 2 div
+ 0.85 mul 0.15 add 0.95 0.99
+ 3 1 roll % prepare hsb color
+ sethsbcolor
+ % now produce the coordinates for lines
+ 4 -1 roll 1 sub dup 5 1 roll exch 1 sub len exch sub dup 3 -1 roll exch
+ 5 -1 roll len exch sub dup 6 -1 roll dup 3 1 roll 7 4 roll
+ moveto lineto lineto lineto closepath fill
+ grestore
+} bind def
+
+%data starts here
+
+%start of quadruplex data
+
+%start of Hmotif data
+
+%start of Imotif data
+
+%draw the grid
+drawgrid
+
+%start of base pair probability data
+1 6 0.004632238 ubox
+1 9 0.006654223 ubox
+1 14 0.116131258 ubox
+1 15 0.005506901 ubox
+1 30 0.009716645 ubox
+1 34 0.073740324 ubox
+1 37 0.006701873 ubox
+1 64 0.004871484 ubox
+1 73 0.570925214 ubox
+2 8 0.007083382 ubox
+2 11 0.008406236 ubox
+2 12 0.007044803 ubox
+2 13 0.129102832 ubox
+2 27 0.003166551 ubox
+2 29 0.016103198 ubox
+2 31 0.059809132 ubox
+2 32 0.018860727 ubox
+2 33 0.080458349 ubox
+2 36 0.007548805 ubox
+2 63 0.005718318 ubox
+2 69 0.007556179 ubox
+2 70 0.028650384 ubox
+2 71 0.546628270 ubox
+2 72 0.773685839 ubox
+3 7 0.004749417 ubox
+3 11 0.010358730 ubox
+3 12 0.129015255 ubox
+3 13 0.003933689 ubox
+3 28 0.016108727 ubox
+3 29 0.005358837 ubox
+3 31 0.020535925 ubox
+3 32 0.083122889 ubox
+3 62 0.005713974 ubox
+3 68 0.006646921 ubox
+3 69 0.031485159 ubox
+3 70 0.558919532 ubox
+3 71 0.770984265 ubox
+3 72 0.215962264 ubox
+4 8 0.003846249 ubox
+4 11 0.128681370 ubox
+4 13 0.011210848 ubox
+4 25 0.004019121 ubox
+4 27 0.015919907 ubox
+4 28 0.004907639 ubox
+4 29 0.064014656 ubox
+4 31 0.083429550 ubox
+4 61 0.005688924 ubox
+4 67 0.004381706 ubox
+4 68 0.030984314 ubox
+4 69 0.928667711 ubox
+4 70 0.171363563 ubox
+4 71 0.216620666 ubox
+4 72 0.007349484 ubox
+5 12 0.010780540 ubox
+5 28 0.062660548 ubox
+5 47 0.006856414 ubox
+5 67 0.030480480 ubox
+5 68 0.927409033 ubox
+5 70 0.201662161 ubox
+6 17 0.003163375 ubox
+6 20 0.004307680 ubox
+6 28 0.008183017 ubox
+6 47 0.073508582 ubox
+6 50 0.015670251 ubox
+6 59 0.003724079 ubox
+6 67 0.895370856 ubox
+6 68 0.033940401 ubox
+6 70 0.008321205 ubox
+7 16 0.003361849 ubox
+7 19 0.004518445 ubox
+7 22 0.015784771 ubox
+7 23 0.006061468 ubox
+7 26 0.014487017 ubox
+7 44 0.005844573 ubox
+7 45 0.012806982 ubox
+7 46 0.076342752 ubox
+7 48 0.020848970 ubox
+7 49 0.018126701 ubox
+7 58 0.004549362 ubox
+7 66 0.827624872 ubox
+8 15 0.003431379 ubox
+8 18 0.005204581 ubox
+8 21 0.036410380 ubox
+8 22 0.007907851 ubox
+8 26 0.044491013 ubox
+8 44 0.019732249 ubox
+8 45 0.085065889 ubox
+8 46 0.073831467 ubox
+8 48 0.244628685 ubox
+8 57 0.004318992 ubox
+8 64 0.004391699 ubox
+8 66 0.049191061 ubox
+9 17 0.005251011 ubox
+9 20 0.037521120 ubox
+9 47 0.253722300 ubox
+9 67 0.010690853 ubox
+9 68 0.010096246 ubox
+9 70 0.004399209 ubox
+10 20 0.026215970 ubox
+10 25 0.829289356 ubox
+10 36 0.006465083 ubox
+10 47 0.027737796 ubox
+10 63 0.004597663 ubox
+10 65 0.005017003 ubox
+10 67 0.005447271 ubox
+10 69 0.005544437 ubox
+11 18 0.038327522 ubox
+11 19 0.026908727 ubox
+11 22 0.008733209 ubox
+11 24 0.831795780 ubox
+11 35 0.006471634 ubox
+11 43 0.468132693 ubox
+11 45 0.252989051 ubox
+11 46 0.024187195 ubox
+12 18 0.023602891 ubox
+12 19 0.006232645 ubox
+12 21 0.008604981 ubox
+12 23 0.831740817 ubox
+12 34 0.006375561 ubox
+12 42 0.472749007 ubox
+12 44 0.251590986 ubox
+12 45 0.014945041 ubox
+13 18 0.013723928 ubox
+13 19 0.007497427 ubox
+13 22 0.831631273 ubox
+13 39 0.003427828 ubox
+13 41 0.473909293 ubox
+13 43 0.250370719 ubox
+14 20 0.066488520 ubox
+14 38 0.003182944 ubox
+14 40 0.457844605 ubox
+15 20 0.108308493 ubox
+15 38 0.011419523 ubox
+15 40 0.051301522 ubox
+16 20 0.015471478 ubox
+16 38 0.470000855 ubox
+16 40 0.178550335 ubox
+17 21 0.008767749 ubox
+17 26 0.003387803 ubox
+17 37 0.496886199 ubox
+17 39 0.177094176 ubox
+17 73 0.045173900 ubox
+18 25 0.004902375 ubox
+18 36 0.492816130 ubox
+18 38 0.121851863 ubox
+18 72 0.055748796 ubox
+19 25 0.003883170 ubox
+19 36 0.239923237 ubox
+19 38 0.005417278 ubox
+19 71 0.055691551 ubox
+20 24 0.003644610 ubox
+20 34 0.470810526 ubox
+20 35 0.247657199 ubox
+20 37 0.005831255 ubox
+21 32 0.009783764 ubox
+21 33 0.358241990 ubox
+21 70 0.054635624 ubox
+22 29 0.006362768 ubox
+22 31 0.013177914 ubox
+22 32 0.219551670 ubox
+22 33 0.403084545 ubox
+22 68 0.003789411 ubox
+22 69 0.055392027 ubox
+23 28 0.006024870 ubox
+23 32 0.500859862 ubox
+23 33 0.004324443 ubox
+23 47 0.031904991 ubox
+23 67 0.003787974 ubox
+23 68 0.052636256 ubox
+24 29 0.008474011 ubox
+24 31 0.549100761 ubox
+24 47 0.049197557 ubox
+24 67 0.030536001 ubox
+25 30 0.548338702 ubox
+25 41 0.004144135 ubox
+25 45 0.067140277 ubox
+25 46 0.053750180 ubox
+26 36 0.057394616 ubox
+26 40 0.012772171 ubox
+26 47 0.064315077 ubox
+26 50 0.004714852 ubox
+27 35 0.057448226 ubox
+27 39 0.013170691 ubox
+27 43 0.815569764 ubox
+27 45 0.049009957 ubox
+27 46 0.063413875 ubox
+27 49 0.005262423 ubox
+27 53 0.004564973 ubox
+28 34 0.054697757 ubox
+28 42 0.820379890 ubox
+28 44 0.048191892 ubox
+28 45 0.035895579 ubox
+28 46 0.029285776 ubox
+28 48 0.006599916 ubox
+28 52 0.004579520 ubox
+29 41 0.821245880 ubox
+29 43 0.046763735 ubox
+29 45 0.057920583 ubox
+29 46 0.006457134 ubox
+29 51 0.004606001 ubox
+30 36 0.024024302 ubox
+30 40 0.821070294 ubox
+30 47 0.027558338 ubox
+30 50 0.004615290 ubox
+31 35 0.023900118 ubox
+31 39 0.821259198 ubox
+31 41 0.031662456 ubox
+31 43 0.068739658 ubox
+31 45 0.005088084 ubox
+31 46 0.028387067 ubox
+31 49 0.004618779 ubox
+32 37 0.056070394 ubox
+32 39 0.007808716 ubox
+32 41 0.004679327 ubox
+32 42 0.069668252 ubox
+32 44 0.005113833 ubox
+32 45 0.028339924 ubox
+32 48 0.003694275 ubox
+33 37 0.084188349 ubox
+33 39 0.012554387 ubox
+33 41 0.069738589 ubox
+33 43 0.004988753 ubox
+33 44 0.028077519 ubox
+33 48 0.005052659 ubox
+34 38 0.015647295 ubox
+34 40 0.068716940 ubox
+34 47 0.005883003 ubox
+35 72 0.003223293 ubox
+36 41 0.028025736 ubox
+36 45 0.006071525 ubox
+37 47 0.004492398 ubox
+37 67 0.004929165 ubox
+38 46 0.004623641 ubox
+38 66 0.005612639 ubox
+38 73 0.096471321 ubox
+39 65 0.006372388 ubox
+39 72 0.134387529 ubox
+40 64 0.006366003 ubox
+40 73 0.044296160 ubox
+41 63 0.006315212 ubox
+41 71 0.157425382 ubox
+41 72 0.055795571 ubox
+42 47 0.003279277 ubox
+42 70 0.158258676 ubox
+43 63 0.003504831 ubox
+43 69 0.159460464 ubox
+43 71 0.083592343 ubox
+43 72 0.004963441 ubox
+44 67 0.003632562 ubox
+44 68 0.157762054 ubox
+44 70 0.122775573 ubox
+45 56 0.003216980 ubox
+45 62 0.033079448 ubox
+45 63 0.006333865 ubox
+45 65 0.005683413 ubox
+45 67 0.142807045 ubox
+45 68 0.102004762 ubox
+45 69 0.139542279 ubox
+45 70 0.038496405 ubox
+45 71 0.007227554 ubox
+45 72 0.051023600 ubox
+46 55 0.003223253 ubox
+46 61 0.033233869 ubox
+46 62 0.005934201 ubox
+46 65 0.014068389 ubox
+46 67 0.151344698 ubox
+46 68 0.117431569 ubox
+46 69 0.048110592 ubox
+46 70 0.005932615 ubox
+46 71 0.051023157 ubox
+47 60 0.033207628 ubox
+47 64 0.011567823 ubox
+47 66 0.169443202 ubox
+48 59 0.032419774 ubox
+48 67 0.054982355 ubox
+48 68 0.015912705 ubox
+48 70 0.010752649 ubox
+49 56 0.003800040 ubox
+49 59 0.006023614 ubox
+49 63 0.008508712 ubox
+49 65 0.996813137 ubox
+49 67 0.013145831 ubox
+49 69 0.007555919 ubox
+50 57 0.025044897 ubox
+50 58 0.008142900 ubox
+50 64 0.998396751 ubox
+50 66 0.013239028 ubox
+51 56 0.028984258 ubox
+51 62 0.014992485 ubox
+51 63 0.999154389 ubox
+51 65 0.013340412 ubox
+52 56 0.007696861 ubox
+52 61 0.018442907 ubox
+52 62 0.999085217 ubox
+52 63 0.014927477 ubox
+52 72 0.003975401 ubox
+53 61 0.997430929 ubox
+53 62 0.015882748 ubox
+53 71 0.003986825 ubox
+54 59 0.163009340 ubox
+54 70 0.003908232 ubox
+55 60 0.162646810 ubox
+56 60 0.056948332 ubox
+57 68 0.004617988 ubox
+58 67 0.004981508 ubox
+59 66 0.005078979 ubox
+60 65 0.005070973 ubox
+2 71 0.9500000 lbox
+3 70 0.9500000 lbox
+4 69 0.9500000 lbox
+5 68 0.9500000 lbox
+6 67 0.9500000 lbox
+7 66 0.9500000 lbox
+10 25 0.9500000 lbox
+11 24 0.9500000 lbox
+12 23 0.9500000 lbox
+13 22 0.9500000 lbox
+27 43 0.9500000 lbox
+28 42 0.9500000 lbox
+29 41 0.9500000 lbox
+30 40 0.9500000 lbox
+31 39 0.9500000 lbox
+49 65 0.9500000 lbox
+50 64 0.9500000 lbox
+51 63 0.9500000 lbox
+52 62 0.9500000 lbox
+53 61 0.9500000 lbox
+showpage
+end
+%%EOF
diff -r 000000000000 -r 22e8485bc5f3 test-data/Anolis_caro_chrUn_GL343590.trna2_AlaAGC_ss.ps
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/Anolis_caro_chrUn_GL343590.trna2_AlaAGC_ss.ps Wed Dec 20 08:30:44 2017 -0500
@@ -0,0 +1,230 @@
+%!PS-Adobe-3.0 EPSF-3.0
+%%Creator: ViennaRNA-2.2.10
+%%CreationDate: Tue Dec 19 19:42:58 2017
+%%Title: RNA Secondary Structure Plot
+%%BoundingBox: 66 210 518 662
+%%DocumentFonts: Helvetica
+%%Pages: 1
+%%EndComments
+
+%Options:
+% to switch off outline pairs of sequence comment or
+% delete the appropriate line near the end of the file
+
+%%BeginProlog
+/RNAplot 100 dict def
+RNAplot begin
+/fsize 14 def
+/outlinecolor {0.2 setgray} bind def
+/paircolor {0.2 setgray} bind def
+/seqcolor {0 setgray} bind def
+/cshow { dup stringwidth pop -2 div fsize -3 div rmoveto show} bind def
+/min { 2 copy gt { exch } if pop } bind def
+/max { 2 copy lt { exch } if pop } bind def
+/arccoords { % i j arccoords
+ % puts optimal x1 y1 x2 y2 coordinates used in bezier curves from i to j
+ % onto the stack
+ dup 3 -1 roll dup 4 -1 roll lt dup dup 5 2 roll {exch} if
+ dup 3 -1 roll dup 3 -1 roll exch sub 1 sub dup
+ 4 -2 roll 5 -1 roll {exch} if 4 2 roll
+ sequence length dup 2 div exch 3 1 roll lt
+ {exch 5 -1 roll pop 4 -2 roll exch 4 2 roll}
+ { 4 2 roll 5 -1 roll dup 6 1 roll {exch} if
+ 4 -2 roll exch pop dup 3 -1 roll dup 4 1 roll
+ exch add 4 -1 roll dup 5 1 roll sub 1 sub
+ 5 -1 roll not {4 -2 roll exch 4 2 roll} if
+ }ifelse
+ % compute the scalingfactor and prepare (1-sf) and sf*r
+ 2 mul exch cpr 3 1 roll div dup
+ 3 -1 roll mul exch 1 exch sub exch
+ % compute the coordinates
+ 3 -1 roll 1 sub coor exch get aload pop % get coord for i
+ 4 -1 roll dup 5 1 roll mul 3 -1 roll dup 4 1 roll add exch % calculate y1
+ 4 -1 roll dup 5 1 roll mul 3 -1 roll dup 4 1 roll add exch % calculate x1
+ 5 -1 roll 1 sub coor exch get aload pop % get coord for j
+ % duplicate j coord
+ dup 3 -1 roll dup 4 1 roll exch 8 2 roll
+ 6 -1 roll dup 7 1 roll mul 5 -1 roll dup 6 1 roll add exch % calculate y2
+ 6 -1 roll mul 5 -1 roll add exch % calculate x2
+ 6 -2 roll % reorder
+} bind def
+/drawoutline {
+ gsave outlinecolor newpath
+ coor 0 get aload pop 0.8 0 360 arc % draw 5' circle of 1st sequence
+ currentdict /cutpoint known % check if cutpoint is defined
+ {coor 0 cutpoint getinterval
+ {aload pop lineto} forall % draw outline of 1st sequence
+ coor cutpoint 1 add get aload pop
+ 2 copy moveto 0.8 0 360 arc % draw 5' circle of 2nd sequence
+ coor cutpoint 1 add coor length cutpoint 1 add sub getinterval
+ {aload pop lineto} forall} % draw outline of 2nd sequence
+ {coor {aload pop lineto} forall} % draw outline as a whole
+ ifelse
+ stroke grestore
+} bind def
+/drawpairs {
+ paircolor
+ 0.7 setlinewidth
+ [9 3.01] 9 setdash
+ newpath
+ pairs {aload pop
+ currentdict (cpr) known
+ { exch dup
+ coor exch 1 sub get aload pop moveto
+ exch arccoords curveto
+ }
+ { coor exch 1 sub get aload pop moveto
+ coor exch 1 sub get aload pop lineto
+ }ifelse
+ } forall
+ stroke
+} bind def
+% draw bases
+/drawbases {
+ [] 0 setdash
+ seqcolor
+ 0
+ coor {
+ aload pop moveto
+ dup sequence exch 1 getinterval cshow
+ 1 add
+ } forall
+ pop
+} bind def
+
+/init {
+ /Helvetica findfont fsize scalefont setfont
+ 1 setlinejoin
+ 1 setlinecap
+ 0.8 setlinewidth
+ 72 216 translate
+ % find the coordinate range
+ /xmax -1000 def /xmin 10000 def
+ /ymax -1000 def /ymin 10000 def
+ coor {
+ aload pop
+ dup ymin lt {dup /ymin exch def} if
+ dup ymax gt {/ymax exch def} {pop} ifelse
+ dup xmin lt {dup /xmin exch def} if
+ dup xmax gt {/xmax exch def} {pop} ifelse
+ } forall
+ /size {xmax xmin sub ymax ymin sub max} bind def
+ 72 6 mul size div dup scale
+ size xmin sub xmax sub 2 div size ymin sub ymax sub 2 div
+ translate
+} bind def
+end
+%%EndProlog
+RNAplot begin
+% data start here
+/sequence (\
+UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA\
+) def
+/coor [
+[102.34599304 225.12051392]
+[110.41094971 210.84155273]
+[109.77433014 195.85507202]
+[109.13771057 180.86859131]
+[108.50109100 165.88211060]
+[107.86447144 150.89561462]
+[107.22785950 135.90913391]
+[90.28739166 133.48460388]
+[77.11851501 123.91786957]
+[70.32070923 110.05319977]
+[55.37474823 111.32528687]
+[40.42878342 112.59737396]
+[25.48282242 113.86946106]
+[17.57515907 127.22043610]
+[3.31690264 133.34266663]
+[-11.80935574 129.88204956]
+[-21.98726082 118.16923523]
+[-23.30319977 102.70806122]
+[-15.25116920 89.44365692]
+[-0.92733771 83.47645569]
+[14.16048908 87.10096741]
+[24.21073341 98.92350006]
+[39.15669632 97.65141296]
+[54.10265732 96.37932587]
+[69.04862213 95.10723114]
+[75.20735168 80.83619690]
+[87.46604156 71.28019714]
+[84.93103027 56.49596024]
+[82.39601898 41.71172333]
+[79.86100006 26.92748451]
+[77.32598877 12.14324570]
+[63.73017883 4.41744947]
+[58.32971573 -10.25800610]
+[63.67453384 -24.95381927]
+[77.24097443 -32.73107910]
+[92.62337494 -29.91759682]
+[102.55863953 -17.84181786]
+[102.35564423 -2.20555139]
+[92.11022949 9.60823345]
+[94.64524078 24.39247131]
+[97.18025208 39.17671204]
+[99.71526337 53.96094894]
+[102.25028229 68.74518585]
+[111.61898041 69.95008087]
+[120.45154572 73.97383881]
+[127.89853668 80.59681702]
+[133.19635010 89.34370422]
+[135.74378967 99.51597595]
+[135.16680908 110.24712372]
+[150.04531860 112.15238953]
+[164.92382812 114.05766296]
+[179.80232239 115.96292877]
+[194.68083191 117.86819458]
+[206.04914856 107.13062286]
+[221.66270447 106.26418304]
+[234.14927673 115.67798615]
+[237.61306763 130.92712402]
+[230.41859436 144.81141663]
+[215.96286011 150.77513123]
+[201.07142639 146.00236511]
+[192.77557373 132.74670410]
+[177.89706421 130.84143066]
+[163.01855469 128.93617249]
+[148.14004517 127.03089905]
+[133.26153564 125.12563324]
+[122.21434021 135.27252197]
+[122.85095978 150.25900269]
+[123.48757935 165.24548340]
+[124.12419128 180.23197937]
+[124.76081085 195.21846008]
+[125.39743042 210.20494080]
+[134.64427185 223.74850464]
+[127.29573059 238.40902710]
+] def
+/pairs [
+[2 71]
+[3 70]
+[4 69]
+[5 68]
+[6 67]
+[7 66]
+[10 25]
+[11 24]
+[12 23]
+[13 22]
+[27 43]
+[28 42]
+[29 41]
+[30 40]
+[31 39]
+[49 65]
+[50 64]
+[51 63]
+[52 62]
+[53 61]
+] def
+
+init
+
+% switch off outline pairs or bases by removing these lines
+drawoutline
+drawpairs
+drawbases
+% show it
+showpage
+end
+%%EOF
diff -r 000000000000 -r 22e8485bc5f3 test-data/kinfold_input.txt
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/kinfold_input.txt Wed Dec 20 08:30:44 2017 -0500
@@ -0,0 +1,1 @@
+ACUGAUCGUAGUCAC
diff -r 000000000000 -r 22e8485bc5f3 test-data/mfe_struct_result.fasta
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/mfe_struct_result.fasta Wed Dec 20 08:30:44 2017 -0500
@@ -0,0 +1,3 @@
+>test_seq mfe: -13.6
+ACAGGUUCGCCUGUGUUGCGAACCUGCGGGUUCG
+.(((((((((.......)))))))))........
diff -r 000000000000 -r 22e8485bc5f3 test-data/rna2dfold_input1.txt
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rna2dfold_input1.txt Wed Dec 20 08:30:44 2017 -0500
@@ -0,0 +1,4 @@
+>Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC (218800-218872) Ala (AGC) 73 bp Sc: 49.55
+UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA
+.((((((..((((........)))).(((((.......))))).....(((((.......)))))))))))..
+.((((((..(((..........))).(((((.......))))).....(((((.......)))))))))))..
diff -r 000000000000 -r 22e8485bc5f3 test-data/rna2dfold_result1.txt
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rna2dfold_result1.txt Wed Dec 20 08:30:44 2017 -0500
@@ -0,0 +1,6 @@
+>Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC
+UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA
+.((((((..((((........)))).(((((.......))))).....(((((.......))))))))))).. (-22.00)
+.((((((..((((........)))).(((((.......))))).....(((((.......))))))))))).. (-22.00) [
+.((((((..(((..........))).(((((.......))))).....(((((.......))))))))))).. (-17.30) ][
+k l en structure
diff -r 000000000000 -r 22e8485bc5f3 test-data/rnaaliduplex_input1.clustal
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnaaliduplex_input1.clustal Wed Dec 20 08:30:44 2017 -0500
@@ -0,0 +1,7 @@
+CLUSTAL 2.1 multiple sequence alignment
+
+
+Anolis_carolinensis_chrUn_GL34 TGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGTGAGAGGTAGTGGGATCGATGCCCACATTCTCCA
+Anolis_carolinensis_chrUn_GL35 GGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGCGAGAGGTAGCGGGATTGATGCCCGCATTCTCCA
+ ************************************** ************** ******* *********
+
diff -r 000000000000 -r 22e8485bc5f3 test-data/rnaaliduplex_result1.txt
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnaaliduplex_result1.txt Wed Dec 20 08:30:44 2017 -0500
@@ -0,0 +1,1 @@
+(((((((..(.......((((..(..((((((..((((((.......((((((..(..(((((..(((((((.&)))))))..).......))))..)..))))))..)))))).......))))))..)..)))))..))))))). 1,73 : 1,73 (-40.30)
diff -r 000000000000 -r 22e8485bc5f3 test-data/rnaalifold_input1.clustal
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnaalifold_input1.clustal Wed Dec 20 08:30:44 2017 -0500
@@ -0,0 +1,7 @@
+CLUSTAL 2.1 multiple sequence alignment
+
+
+Anolis_carolinensis_chrUn_GL34 TGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGTGAGAGGTAGTGGGATCGATGCCCACATTCTCCA
+Anolis_carolinensis_chrUn_GL35 GGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGCGAGAGGTAGCGGGATTGATGCCCGCATTCTCCA
+ ************************************** ************** ******* *********
+
diff -r 000000000000 -r 22e8485bc5f3 test-data/rnaalifold_input1.fa
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnaalifold_input1.fa Wed Dec 20 08:30:44 2017 -0500
@@ -0,0 +1,4 @@
+>Anolis_caro_chrUn_GL34
+TGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGTGAGAGGTAGTGGGATCGATGCCCACATTCTCCA
+>Anolis_caro_chrUn_GL35
+GGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGCGAGAGGTAGCGGGATTGATGCCCGCATTCTCCA
diff -r 000000000000 -r 22e8485bc5f3 test-data/rnaalifold_input1.stk
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnaalifold_input1.stk Wed Dec 20 08:30:44 2017 -0500
@@ -0,0 +1,5 @@
+# STOCKHOLM 1.0
+#=GF SQ 2
+Anolis_carolinensis_chrUn_GL34 TGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGTGAGAGGTAGTGGGATCGATGCCCACATTCTCCA
+Anolis_carolinensis_chrUn_GL35 GGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGCGAGAGGTAGCGGGATTGATGCCCGCATTCTCCA
+//
diff -r 000000000000 -r 22e8485bc5f3 test-data/rnaalifold_result1.txt
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnaalifold_result1.txt Wed Dec 20 08:30:44 2017 -0500
@@ -0,0 +1,2 @@
+GGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGCGAGAGGUAGCGGGAUCGAUGCCCACAUUCUCCA
+(((((((..((((........)))).(((((.......))))).....(((((.......)))))))))))). (-26.45 = -26.20 + -0.25)
diff -r 000000000000 -r 22e8485bc5f3 test-data/rnaalifold_result_MEA.txt
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnaalifold_result_MEA.txt Wed Dec 20 08:30:44 2017 -0500
@@ -0,0 +1,6 @@
+GGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGCGAGAGGUAGCGGGAUCGAUGCCCACAUUCUCCA
+(((((((..((((........)))).(((((.......))))).....(((((.......)))))))))))). (-26.45 = -26.20 + -0.25)
+(((((((..((((........)))).(((((.......))))).....(((((.......)))))))))))). [-26.77]
+(((((((..((((........)))).(((((.......))))).....(((((.......)))))))))))). {-26.45 = -26.20 + -0.25 d=1.28}
+(((((((..((((........)))).(((((.......))))).....(((((.......)))))))))))). {-26.45 = -26.20 + -0.25 MEA=70.93}
+ frequency of mfe structure in ensemble 0.773705; ensemble diversity 2.40
diff -r 000000000000 -r 22e8485bc5f3 test-data/rnaalifold_resultfa.txt
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnaalifold_resultfa.txt Wed Dec 20 08:30:44 2017 -0500
@@ -0,0 +1,2 @@
+GGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGCGAGAGGUAGCGGGAUCGAUGCCCACAUUCUCCA
+(((((((..((((........)))).(((((.......))))).....(((((.......)))))))))))). (-26.45 = -26.20 + -0.25)
diff -r 000000000000 -r 22e8485bc5f3 test-data/rnaalifold_resultstk.txt
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnaalifold_resultstk.txt Wed Dec 20 08:30:44 2017 -0500
@@ -0,0 +1,2 @@
+GGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGCGAGAGGUAGCGGGAUCGAUGCCCACAUUCUCCA
+(((((((..((((........)))).(((((.......))))).....(((((.......)))))))))))). (-26.45 = -26.20 + -0.25)
diff -r 000000000000 -r 22e8485bc5f3 test-data/rnacofold_input1.fas
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnacofold_input1.fas Wed Dec 20 08:30:44 2017 -0500
@@ -0,0 +1,2 @@
+>Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC (218800-218872) Ala (AGC) 73 bp Sc: 49.55
+UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA&UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA
diff -r 000000000000 -r 22e8485bc5f3 test-data/rnacofold_result1.txt
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnacofold_result1.txt Wed Dec 20 08:30:44 2017 -0500
@@ -0,0 +1,3 @@
+>Anolis_carolinensis_chrUn_GL343590.trna2-A
+UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA&UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA
+.((((((..((((........)))).(((((.......))))).....(((((((((((.(((((((((((..&.))))))..((((........)))).(((((.......))))).....))))))))))).))))))))))).. (-55.90)
diff -r 000000000000 -r 22e8485bc5f3 test-data/rnadistance_input1.dbn
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnadistance_input1.dbn Wed Dec 20 08:30:44 2017 -0500
@@ -0,0 +1,2 @@
+.((((((..((((........)))).(((((.......))))).....(((((.......)))))))))))..
+(((((((..((((........)))).(((((.......))))).....(((((.......)))))))))))).
diff -r 000000000000 -r 22e8485bc5f3 test-data/rnadistance_result1.txt
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnadistance_result1.txt Wed Dec 20 08:30:44 2017 -0500
@@ -0,0 +1,1 @@
+f: 4
diff -r 000000000000 -r 22e8485bc5f3 test-data/rnaduplex_input1.fa
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnaduplex_input1.fa Wed Dec 20 08:30:44 2017 -0500
@@ -0,0 +1,4 @@
+>Anolis_caro_chrUn_GL343590.trna2-AlaAGC (218800-218872) Ala (AGC) 73 bp Sc: 49.55
+TGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGTGAGAGGTAGTGGGATCGATGCCCACATTCTCCA
+>Anolis_caro_chrUn_GL343207.trna3-AlaAGC (1513626-1513698) Ala (AGC) 73 bp Sc: 56.15
+GGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGCGAGAGGTAGCGGGATTGATGCCCGCATTCTCCA
diff -r 000000000000 -r 22e8485bc5f3 test-data/rnaduplex_result1.txt
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnaduplex_result1.txt Wed Dec 20 08:30:44 2017 -0500
@@ -0,0 +1,3 @@
+>Anolis_caro_chrUn_GL343590.trna2-AlaAGC
+>Anolis_caro_chrUn_GL343207.trna3-AlaAGC
+.((((((..((......((((...((((..(((.((((((.......((((((..(..((((...(((((((.&)))))))..........))))..)..))))))..))))))..)))..)))).......)))).)))))))). 1,73 : 1,72 (-40.70)
diff -r 000000000000 -r 22e8485bc5f3 test-data/rnaeval_input1.dbn
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnaeval_input1.dbn Wed Dec 20 08:30:44 2017 -0500
@@ -0,0 +1,3 @@
+>Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC (218800-218872) Ala (AGC) 73 bp Sc: 49.55
+UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA
+.((((((..((((........)))).(((((.......))))).....(((((.......)))))))))))..
diff -r 000000000000 -r 22e8485bc5f3 test-data/rnaeval_result1.txt
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnaeval_result1.txt Wed Dec 20 08:30:44 2017 -0500
@@ -0,0 +1,3 @@
+>Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC (218800-218872) Ala (AGC) 73 bp Sc: 49.55
+UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA
+.((((((..((((........)))).(((((.......))))).....(((((.......))))))))))).. (-22.00)
diff -r 000000000000 -r 22e8485bc5f3 test-data/rnafold_input1.fa
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnafold_input1.fa Wed Dec 20 08:30:44 2017 -0500
@@ -0,0 +1,4 @@
+>Anolis_caro_chrUn_GL343590.trna2_AlaAGC (218800-218872) Ala (AGC) 73 bp Sc: 49.55
+TGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGTGAGAGGTAGTGGGATCGATGCCCACATTCTCCA
+>Anolis_caro_chrUn_GL343207.trna3_AlaAGC (1513626-1513698) Ala (AGC) 73 bp Sc: 56.15
+GGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGCGAGAGGTAGCGGGATTGATGCCCGCATTCTCCA
diff -r 000000000000 -r 22e8485bc5f3 test-data/rnafold_input2.fa
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnafold_input2.fa Wed Dec 20 08:30:44 2017 -0500
@@ -0,0 +1,4 @@
+>Anolis_caro_chrUn_GL343590.trna2-AlaAGC (218800-218872) Ala (AGC) 73 bp Sc: 49.55
+TGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGTGAGAGGTAGTGGGATCGATGCCCACATTCTCCA
+>Anolis_caro_chrUn_GL343207.trna3-AlaAGC (1513626-1513698) Ala (AGC) 73 bp Sc: 56.15
+GGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGCGAGAGGTAGCGGGATTGATGCCCGCATTCTCCA
diff -r 000000000000 -r 22e8485bc5f3 test-data/rnafold_result1.txt
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnafold_result1.txt Wed Dec 20 08:30:44 2017 -0500
@@ -0,0 +1,6 @@
+>Anolis_caro_chrUn_GL343590.trna2_AlaAGC
+UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA
+.((((((..((((........)))).(((((.......))))).....(((((.......))))))))))).. (-22.00)
+>Anolis_caro_chrUn_GL343207.trna3_AlaAGC
+GGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGCGAGAGGUAGCGGGAUUGAUGCCCGCAUUCUCCA
+(((((((..((((........)))).(((((.......))))).....(((((.......)))))))))))). (-29.60)
diff -r 000000000000 -r 22e8485bc5f3 test-data/rnafold_result1_mea.txt
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnafold_result1_mea.txt Wed Dec 20 08:30:44 2017 -0500
@@ -0,0 +1,14 @@
+>Anolis_caro_chrUn_GL343590.trna2_AlaAGC
+UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA
+.((((((..((((........)))).(((((.......))))).....(((((.......))))))))))).. (-22.00)
+,((((((..((((........)))).(((((.......))))).....(((((.......))))))))),)), [-23.20]
+.((((((..((((........)))).(((((.......))))).....(((((.......))))))))).)). {-21.90 d=9.72}
+.((((((..((((........)))).(((((.......))))).....(((((.......))))))))).)). {-21.90 MEA=58.88}
+ frequency of mfe structure in ensemble 0.142309; ensemble diversity 14.51
+>Anolis_caro_chrUn_GL343207.trna3_AlaAGC
+GGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGCGAGAGGUAGCGGGAUUGAUGCCCGCAUUCUCCA
+(((((((..((((........)))).(((((.......))))).....(((((.......)))))))))))). (-29.60)
+(((((((..((((........)))).(((((.......))))).....(((((.......)))))))))))). [-29.88]
+(((((((..((((........)))).(((((.......))))).....(((((.......)))))))))))). {-29.60 d=0.64}
+(((((((..((((........)))).(((((.......))))).....(((((.......)))))))))))). {-29.60 MEA=71.81}
+ frequency of mfe structure in ensemble 0.63265; ensemble diversity 1.15
diff -r 000000000000 -r 22e8485bc5f3 test-data/rnafold_result1_pf.txt
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnafold_result1_pf.txt Wed Dec 20 08:30:44 2017 -0500
@@ -0,0 +1,12 @@
+>Anolis_caro_chrUn_GL343590.trna2_AlaAGC
+UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA
+.((((((..((((........)))).(((((.......))))).....(((((.......))))))))))).. (-22.00)
+,((((((..((((........)))).(((((.......))))).....(((((.......))))))))),)), [-23.20]
+.((((((..((((........)))).(((((.......))))).....(((((.......))))))))).)). {-21.90 d=9.72}
+ frequency of mfe structure in ensemble 0.142309; ensemble diversity 14.51
+>Anolis_caro_chrUn_GL343207.trna3_AlaAGC
+GGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGCGAGAGGUAGCGGGAUUGAUGCCCGCAUUCUCCA
+(((((((..((((........)))).(((((.......))))).....(((((.......)))))))))))). (-29.60)
+(((((((..((((........)))).(((((.......))))).....(((((.......)))))))))))). [-29.88]
+(((((((..((((........)))).(((((.......))))).....(((((.......)))))))))))). {-29.60 d=0.64}
+ frequency of mfe structure in ensemble 0.63265; ensemble diversity 1.15
diff -r 000000000000 -r 22e8485bc5f3 test-data/rnafold_result2.txt
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnafold_result2.txt Wed Dec 20 08:30:44 2017 -0500
@@ -0,0 +1,6 @@
+>Anolis_caro_chrUn_GL343590.trna2-AlaAGC
+UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA
+..(((.....((((....((..(((....)))..))...)))).....(((((.......)))))....))). ( -3.37)
+>Anolis_caro_chrUn_GL343207.trna3-AlaAGC
+GGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGCGAGAGGUAGCGGGAUUGAUGCCCGCAUUCUCCA
+(((((..((.(((.....((..(((....)))..))......))).))(((((.......)))))..))))). ( -5.02)
diff -r 000000000000 -r 22e8485bc5f3 test-data/rnafold_result3.txt
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnafold_result3.txt Wed Dec 20 08:30:44 2017 -0500
@@ -0,0 +1,3 @@
+>Sequence
+UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA
+.((((((..((((........)))).(((((.......))))).....(((((.......))))))))))).. (-22.00)
diff -r 000000000000 -r 22e8485bc5f3 test-data/rnaheat_input1.fa
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnaheat_input1.fa Wed Dec 20 08:30:44 2017 -0500
@@ -0,0 +1,2 @@
+> comment 1
+UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA
diff -r 000000000000 -r 22e8485bc5f3 test-data/rnaheat_result1.txt
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnaheat_result1.txt Wed Dec 20 08:30:44 2017 -0500
@@ -0,0 +1,102 @@
+> comment 1
+0 0.0407267
+1 0.0435052
+2 0.0470227
+3 0.0505646
+4 0.0553391
+5 0.0603894
+6 0.0662047
+7 0.0718158
+8 0.0782007
+9 0.0863514
+10 0.0950516
+11 0.10505
+12 0.115613
+13 0.128245
+14 0.141712
+15 0.157281
+16 0.17497
+17 0.195056
+18 0.216799
+19 0.241743
+20 0.270432
+21 0.302132
+22 0.337644
+23 0.377263
+24 0.421546
+25 0.470799
+26 0.525589
+27 0.587016
+28 0.653829
+29 0.726606
+30 0.806458
+31 0.892656
+32 0.984857
+33 1.08272
+34 1.18601
+35 1.29332
+36 1.40305
+37 1.51467
+38 1.62618
+39 1.73524
+40 1.84032
+41 1.9407
+42 2.03385
+43 2.11859
+44 2.19443
+45 2.26182
+46 2.31999
+47 2.36969
+48 2.41182
+49 2.44826
+50 2.47967
+51 2.50769
+52 2.534
+53 2.55942
+54 2.5851
+55 2.61217
+56 2.64151
+57 2.67329
+58 2.70759
+59 2.74465
+60 2.78458
+61 2.8279
+62 2.8742
+63 2.92425
+64 2.97698
+65 3.03283
+66 3.09163
+67 3.15591
+68 3.23033
+69 3.3067
+70 3.38122
+71 3.45791
+72 3.54606
+73 3.63843
+74 3.73392
+75 3.83847
+76 3.94646
+77 4.05462
+78 4.16571
+79 4.28366
+80 4.39944
+81 4.50863
+82 4.61035
+83 4.70186
+84 4.78345
+85 4.85204
+86 4.90509
+87 4.9392
+88 4.95425
+89 4.95214
+90 4.93688
+91 4.91166
+92 4.87691
+93 4.8314
+94 4.78561
+95 4.75271
+96 4.71866
+97 4.66056
+98 4.57671
+99 4.48395
+100 4.39006
diff -r 000000000000 -r 22e8485bc5f3 test-data/rnainverse_input1.clu
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnainverse_input1.clu Wed Dec 20 08:30:44 2017 -0500
@@ -0,0 +1,2 @@
+(((((((..((((........)))).(((((.......))))).....(((((.......)))))))))))).
+gggccccnnaauunnnnnnnnaauunGGGGcnnnnnnnAAAAAnnnnnuuuuannnnnnnuaaaaggggcccn
diff -r 000000000000 -r 22e8485bc5f3 test-data/rnalalifold_input1.clustal
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnalalifold_input1.clustal Wed Dec 20 08:30:44 2017 -0500
@@ -0,0 +1,7 @@
+CLUSTAL 2.1 multiple sequence alignment
+
+
+Anolis_carolinensis_chrUn_GL34 TGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGTGAGAGGTAGTGGGATCGATGCCCACATTCTCCA
+Anolis_carolinensis_chrUn_GL35 GGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGCGAGAGGTAGCGGGATTGATGCCCGCATTCTCCA
+ ************************************** ************** ******* *********
+
diff -r 000000000000 -r 22e8485bc5f3 test-data/rnalalifold_result1.txt
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnalalifold_result1.txt Wed Dec 20 08:30:44 2017 -0500
@@ -0,0 +1,4 @@
+(((.(((((.(((((.......)))))..)).(((((.......)))))..)))))) (-19.05) 17 - 73
+((((........)))). ( -5.10) 10 - 26
+GGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGCGAGAGGUAGCGGGAUCGAUGCCCACAUUCUCCA
+
diff -r 000000000000 -r 22e8485bc5f3 test-data/rnalfold_input1.fa
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnalfold_input1.fa Wed Dec 20 08:30:44 2017 -0500
@@ -0,0 +1,4 @@
+>Anolis_caro_chrUn_GL343590.trna2-AlaAGC (218800-218872) Ala (AGC) 73 bp Sc: 49.55
+TGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGTGAGAGGTAGTGGGATCGATGCCCACATTCTCCA
+>Anolis_caro_chrUn_GL343207.trna3-AlaAGC (1513626-1513698) Ala (AGC) 73 bp Sc: 56.15
+GGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGCGAGAGGTAGCGGGATTGATGCCCGCATTCTCCA
diff -r 000000000000 -r 22e8485bc5f3 test-data/rnalfold_result1.txt
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnalfold_result1.txt Wed Dec 20 08:30:44 2017 -0500
@@ -0,0 +1,28 @@
+>Anolis_caro_chrUn_GL343590.trna2-AlaAGC (218800-218872) Ala (AGC) 73 bp Sc: 49.55
+.((((....)))). ( -0.10) 56
+.(((..((((....)))).))). ( -3.40) 51
+.(((((.......))))). ( -7.70) 48
+.((((..(((((.......)))))..)))). (-10.30) 42
+.(((((...(((((.......))))).))))). (-11.50) 40
+.((.(((((...(((((.......))))).))))))) (-12.10) 37
+.(((((.......))))). ( -5.80) 26
+.((.(((((.......)))))..)). ( -6.70) 23
+.((((....)))). ( -3.20) 21
+.((.((((....)))).)). ( -4.70) 18
+.((((........)))). ( -5.30) 9
+.((((((..((((........)))).(((((.......))))).....(((((.......))))))))))). (-22.00) 1
+UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA
+ (-22.00)
+>Anolis_caro_chrUn_GL343207.trna3-AlaAGC (1513626-1513698) Ala (AGC) 73 bp Sc: 56.15
+.(((..((((....)))).))). ( -3.40) 51
+.(((((.......))))). ( -9.20) 48
+.((((..(((((.......)))))..)))). (-11.80) 42
+.(((((...(((((.......))))).))))). (-13.30) 40
+.((.(((((...(((((.......))))).))))))) (-13.60) 37
+.(((((.......))))). ( -7.70) 26
+.((.(((((.......)))))..)). ( -8.60) 23
+.(((.(((((.(((((.......)))))..)).(((((.......)))))..)))))) (-20.00) 16
+.((((........)))). ( -5.30) 9
+(((((((..((((........)))).(((((.......))))).....(((((.......)))))))))))). (-29.60) 1
+GGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGCGAGAGGUAGCGGGAUUGAUGCCCGCAUUCUCCA
+ (-29.60)
diff -r 000000000000 -r 22e8485bc5f3 test-data/rnapaln_input1.fa
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnapaln_input1.fa Wed Dec 20 08:30:44 2017 -0500
@@ -0,0 +1,4 @@
+>Anolis_caro_chrUn_GL343590.trna2-AlaAGC (218800-218872) Ala (AGC) 73 bp Sc: 49.55
+TGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGTGAGAGGTAGTGGGATCGATGCCCACATTCTCCA
+>Anolis_caro_chrUn_GL343207.trna3-AlaAGC (1513626-1513698) Ala (AGC) 73 bp Sc: 56.15
+GGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGCGAGAGGTAGCGGGATTGATGCCCGCATTCTCCA
diff -r 000000000000 -r 22e8485bc5f3 test-data/rnapaln_input1.fas
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnapaln_input1.fas Wed Dec 20 08:30:44 2017 -0500
@@ -0,0 +1,1 @@
+UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA&UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA
diff -r 000000000000 -r 22e8485bc5f3 test-data/rnapaln_result1.txt
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnapaln_result1.txt Wed Dec 20 08:30:44 2017 -0500
@@ -0,0 +1,7 @@
+>Anolis_caro_chrUn_GL343590.trna2-AlaAGC (218800-218872) Ala (AGC) 73 bp Sc: 49.55
+>Anolis_caro_chrUn_GL343207.trna3-AlaAGC (1513626-1513698) Ala (AGC) 73 bp Sc: 56.15
+68.8844
+UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA
+,((((((..((((........)))).(((((.......))))).....(((((.......))))))))),)),
+GGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGCGAGAGGUAGCGGGAUUGAUGCCCGCAUUCUCCA
+(((((((..((((........)))).(((((.......))))).....(((((.......)))))))))))).
diff -r 000000000000 -r 22e8485bc5f3 test-data/rnapdist_input1.fa
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnapdist_input1.fa Wed Dec 20 08:30:44 2017 -0500
@@ -0,0 +1,4 @@
+>Anolis_caro_chrUn_GL343590.trna2-AlaAGC (218800-218872) Ala (AGC) 73 bp Sc: 49.55
+TGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGTGAGAGGTAGTGGGATCGATGCCCACATTCTCCA
+>Anolis_caro_chrUn_GL343207.trna3-AlaAGC (1513626-1513698) Ala (AGC) 73 bp Sc: 56.15
+GGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGCGAGAGGTAGCGGGATTGATGCCCGCATTCTCCA
diff -r 000000000000 -r 22e8485bc5f3 test-data/rnapdist_result1.txt
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnapdist_result1.txt Wed Dec 20 08:30:44 2017 -0500
@@ -0,0 +1,3 @@
+>Anolis_caro_chrUn_GL343590.trna2-AlaAGC (218800-218872) Ala (AGC) 73 bp Sc: 49.55
+>Anolis_caro_chrUn_GL343207.trna3-AlaAGC (1513626-1513698) Ala (AGC) 73 bp Sc: 56.15
+8.66253
diff -r 000000000000 -r 22e8485bc5f3 test-data/rnapkplex_input1.fa
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnapkplex_input1.fa Wed Dec 20 08:30:44 2017 -0500
@@ -0,0 +1,4 @@
+>Anolis_caro_chrUn_GL343590.trna2-AlaAGC (218800-218872) Ala (AGC) 73 bp Sc: 49.55
+TGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGTGAGAGGTAGTGGGATCGATGCCCACATTCTCCA
+>Anolis_caro_chrUn_GL343207.trna3-AlaAGC (1513626-1513698) Ala (AGC) 73 bp Sc: 56.15
+GGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGCGAGAGGTAGCGGGATTGATGCCCGCATTCTCCA
diff -r 000000000000 -r 22e8485bc5f3 test-data/rnapkplex_result1.txt
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnapkplex_result1.txt Wed Dec 20 08:30:44 2017 -0500
@@ -0,0 +1,6 @@
+>Anolis_caro_chrUn_GL343590.trna2-AlaAGC (218800-218872) Ala (AGC) 73 bp Sc: 49.55
+UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA
+.((((((..((((........)))).(((((.......))))).[[[.(((((]]]....))))))))))).. (-31.90)
+>Anolis_caro_chrUn_GL343207.trna3-AlaAGC (1513626-1513698) Ala (AGC) 73 bp Sc: 56.15
+GGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGCGAGAGGUAGCGGGAUUGAUGCCCGCAUUCUCCA
+(((((((..((((..[[[.[[)))).(((((.]].]]]))))).....(((((.......)))))))))))). (-38.54)
diff -r 000000000000 -r 22e8485bc5f3 test-data/rnaplex_input1.fa
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnaplex_input1.fa Wed Dec 20 08:30:44 2017 -0500
@@ -0,0 +1,4 @@
+>Anolis_caro_chrUn_GL343590.trna2-AlaAGC (218800-218872) Ala (AGC) 73 bp Sc: 49.55
+TGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGTGAGAGGTAGTGGGATCGATGCCCACATTCTCCA
+>Anolis_caro_chrUn_GL343207.trna3-AlaAGC (1513626-1513698) Ala (AGC) 73 bp Sc: 56.15
+GGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGCGAGAGGTAGCGGGATTGATGCCCGCATTCTCCA
diff -r 000000000000 -r 22e8485bc5f3 test-data/rnaplex_result1.txt
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnaplex_result1.txt Wed Dec 20 08:30:44 2017 -0500
@@ -0,0 +1,4 @@
+>Anolis_caro_chrUn_GL343590.trna2-AlaAGC (218800-218872) Ala (AGC) 73 bp Sc: 49.55
+>Anolis_caro_chrUn_GL343207.trna3-AlaAGC (1513626-1513698) Ala (AGC) 73 bp Sc: 56.15
+.((((((..((......((((...((((..(((.((((((.......((((((..(..((((...(((((((.&)))))))..........))))..)..))))))..))))))..)))..)))).......)))).)))))))). 1,73 : 1,72 (-40.70) i:72,j:1 <-41.26>
+
diff -r 000000000000 -r 22e8485bc5f3 test-data/rnaplfold_input1.fa
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnaplfold_input1.fa Wed Dec 20 08:30:44 2017 -0500
@@ -0,0 +1,4 @@
+>Anolis_caro_chrUn_GL343590.trna2-A (218800-218872) Ala (AGC) 73 bp Sc: 49.55
+TGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGTGAGAGGTAGTGGGATCGATGCCCACATTCTCCA
+>Anolis_caro_chrUn_GL343207.trna3-A (1513626-1513698) Ala (AGC) 73 bp Sc: 56.15
+GGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGCGAGAGGTAGCGGGATTGATGCCCGCATTCTCCA
diff -r 000000000000 -r 22e8485bc5f3 test-data/rnaplfold_result1.ps
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnaplfold_result1.ps Wed Dec 20 08:30:44 2017 -0500
@@ -0,0 +1,242 @@
+%!PS-Adobe-3.0 EPSF-3.0
+%%Title: RNA Dot Plot
+%%Creator: ViennaRNA-2.2.10
+%%CreationDate: Tue Oct 4 14:45:55 2016
+%%BoundingBox: 66 530 520 650
+%%DocumentFonts: Helvetica
+%%Pages: 1
+%%EndComments
+
+%Options:
+%This file contains the square roots of the base pair probabilities in the form
+% i j sqrt(p(i,j)) ubox
+
+%%BeginProlog
+/DPdict 100 dict def
+DPdict begin
+/logscale false def
+/lpmin 1e-05 log def
+
+/box { %size x y box - draws box centered on x,y
+ 2 index 0.5 mul sub % x -= 0.5
+ exch 2 index 0.5 mul sub exch % y -= 0.5
+ 3 -1 roll dup rectfill
+} bind def
+
+/ubox {
+ logscale {
+ log dup add lpmin div 1 exch sub dup 0 lt { pop 0 } if
+ } if
+ 3 1 roll
+ exch len exch sub 1 add box
+} bind def
+
+/lbox {
+ 3 1 roll
+ len exch sub 1 add box
+} bind def
+
+/drawseq {
+% print sequence along all 4 sides
+[ [0.7 -0.3 0 ]
+ [0.7 0.7 len add 0]
+ [-0.3 len sub -0.4 -90]
+ [-0.3 len sub 0.7 len add -90]
+] {
+ gsave
+ aload pop rotate translate
+ 0 1 len 1 sub {
+ dup 0 moveto
+ sequence exch 1 getinterval
+ show
+ } for
+ grestore
+ } forall
+} bind def
+
+/drawgrid{
+ 0.01 setlinewidth
+ len log 0.9 sub cvi 10 exch exp % grid spacing
+ dup 1 gt {
+ dup dup 20 div dup 2 array astore exch 40 div setdash
+ } { [0.3 0.7] 0.1 setdash } ifelse
+ 0 exch len {
+ dup dup
+ 0 moveto
+ len lineto
+ dup
+ len exch sub 0 exch moveto
+ len exch len exch sub lineto
+ stroke
+ } for
+ [] 0 setdash
+ 0.04 setlinewidth
+ currentdict /cutpoint known {
+ cutpoint 1 sub
+ dup dup -1 moveto len 1 add lineto
+ len exch sub dup
+ -1 exch moveto len 1 add exch lineto
+ stroke
+ } if
+ 0.5 neg dup translate
+} bind def
+
+end
+%%EndProlog
+DPdict begin
+%delete next line to get rid of title
+270 665 moveto /Helvetica findfont 14 scalefont setfont (Anolis_carolinensis_chrUn_GL343590.trna2-A) show
+
+/sequence { (\
+UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA\
+) } def
+/winSize 70 def
+/len { sequence length } bind def
+
+292 416 translate
+72 6 mul len 1 add winSize add 2 sqrt mul div dup scale
+/Helvetica findfont 0.95 scalefont setfont
+
+/drawseq_turn {% print sequence at bottom
+ gsave
+ len 2 sqrt div dup neg 0.28 add exch 0.78 sub translate
+ 0 1 len 1 sub {
+ dup dup 2 sqrt mul 0 moveto
+ sequence exch 1 getinterval
+ show
+ } for
+ grestore
+} bind def
+/drawgrid_turn{
+ 0.01 setlinewidth
+ len log 0.9 sub cvi 10 exch exp % grid spacing
+ dup 1 gt {
+ dup dup 20 div dup 2 array astore exch 40 div setdash
+ } { [0.3 0.7] 0.1 setdash } ifelse
+ 0 exch len { %for (0, gridspacing, len)
+ dup dup %duplicate what - gridspacing??
+ dup len exch sub moveto %moveto diagonal?
+ dup winSize gt
+ {dup dup len exch sub winSize add lineto}
+ {dup len lineto}ifelse
+ dup len exch sub moveto %moveto diagonal?
+ dup len winSize sub le
+ {dup dup len exch sub dup winSize exch sub len add exch lineto}
+ {dup dup len exch sub len exch lineto}ifelse stroke pop pop
+ } for
+ len log 0.9 sub cvi 10 exch exp % grid spacing
+ dup 1 gt {
+ dup dup 20 div dup 2 array astore exch 40 div setdash
+ } { [0.3 0.7] 0.1 setdash } ifelse
+ 0 exch len { %for (0, gridspacing, len)
+ dup dup %duplicate what - gridspacing??
+ dup len exch sub moveto %moveto diagonal?
+ len exch sub 0.7 sub exch 0.7 sub exch lineto
+ stroke
+ }for
+ winSize len moveto len winSize lineto stroke
+ [] 0 setdash
+ 0.04 setlinewidth
+ currentdict /cutpoint known {
+ cutpoint 1 sub
+ dup dup -1 moveto len 1 add lineto
+ len exch sub dup
+ -1 exch moveto len 1 add exch lineto
+ stroke
+ } if
+ 0.5 neg dup translate
+} bind def
+
+0.5 dup translate
+drawseq_turn
+45 rotate
+
+
+%draw the grid
+drawgrid_turn
+
+%start of base pair probability data
+2 70 0.1568 ubox
+2 71 0.9619 ubox
+3 69 0.1395 ubox
+3 70 0.7414 ubox
+3 72 0.8060 ubox
+4 68 0.1157 ubox
+4 69 0.6748 ubox
+4 71 0.4682 ubox
+5 67 0.1065 ubox
+5 68 0.6724 ubox
+5 70 0.3765 ubox
+6 47 0.1250 ubox
+6 67 0.6497 ubox
+7 46 0.1273 ubox
+7 66 0.6008 ubox
+8 45 0.1294 ubox
+8 48 0.2252 ubox
+9 47 0.2335 ubox
+10 25 0.7863 ubox
+11 24 0.7884 ubox
+11 43 0.5215 ubox
+11 45 0.2330 ubox
+12 23 0.7883 ubox
+12 42 0.5493 ubox
+12 44 0.2317 ubox
+13 22 0.7882 ubox
+13 41 0.5528 ubox
+13 43 0.2306 ubox
+14 40 0.5338 ubox
+15 20 0.1027 ubox
+16 38 0.5325 ubox
+16 40 0.1646 ubox
+17 37 0.5639 ubox
+17 39 0.1633 ubox
+18 36 0.5591 ubox
+18 38 0.1125 ubox
+19 36 0.2406 ubox
+20 34 0.5341 ubox
+20 35 0.2514 ubox
+21 33 0.4064 ubox
+22 32 0.2491 ubox
+22 33 0.4413 ubox
+23 32 0.5541 ubox
+24 31 0.6100 ubox
+25 30 0.6092 ubox
+26 36 0.2144 ubox
+27 35 0.2146 ubox
+27 43 0.7269 ubox
+28 34 0.2043 ubox
+28 42 0.7445 ubox
+29 41 0.7467 ubox
+30 40 0.7468 ubox
+31 39 0.7470 ubox
+38 73 0.3242 ubox
+39 72 0.3055 ubox
+40 73 0.1211 ubox
+41 71 0.2953 ubox
+41 72 0.1146 ubox
+42 70 0.2588 ubox
+43 69 0.2613 ubox
+43 71 0.2848 ubox
+44 68 0.2587 ubox
+44 70 0.3418 ubox
+45 67 0.2339 ubox
+45 68 0.1772 ubox
+45 69 0.3617 ubox
+45 70 0.1014 ubox
+45 72 0.3111 ubox
+46 67 0.2550 ubox
+46 68 0.3039 ubox
+46 69 0.1150 ubox
+46 71 0.2540 ubox
+47 66 0.2925 ubox
+48 67 0.1378 ubox
+49 65 0.9938 ubox
+50 64 0.9971 ubox
+51 63 0.9980 ubox
+52 62 0.9980 ubox
+53 61 0.9963 ubox
+54 59 0.1628 ubox
+55 60 0.1625 ubox
+showpage
+end
+%%EOF
diff -r 000000000000 -r 22e8485bc5f3 test-data/rnaplfold_result2.ps
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnaplfold_result2.ps Wed Dec 20 08:30:44 2017 -0500
@@ -0,0 +1,212 @@
+%!PS-Adobe-3.0 EPSF-3.0
+%%Title: RNA Dot Plot
+%%Creator: ViennaRNA-2.2.10
+%%CreationDate: Tue Oct 4 14:45:55 2016
+%%BoundingBox: 66 530 520 650
+%%DocumentFonts: Helvetica
+%%Pages: 1
+%%EndComments
+
+%Options:
+%This file contains the square roots of the base pair probabilities in the form
+% i j sqrt(p(i,j)) ubox
+
+%%BeginProlog
+/DPdict 100 dict def
+DPdict begin
+/logscale false def
+/lpmin 1e-05 log def
+
+/box { %size x y box - draws box centered on x,y
+ 2 index 0.5 mul sub % x -= 0.5
+ exch 2 index 0.5 mul sub exch % y -= 0.5
+ 3 -1 roll dup rectfill
+} bind def
+
+/ubox {
+ logscale {
+ log dup add lpmin div 1 exch sub dup 0 lt { pop 0 } if
+ } if
+ 3 1 roll
+ exch len exch sub 1 add box
+} bind def
+
+/lbox {
+ 3 1 roll
+ len exch sub 1 add box
+} bind def
+
+/drawseq {
+% print sequence along all 4 sides
+[ [0.7 -0.3 0 ]
+ [0.7 0.7 len add 0]
+ [-0.3 len sub -0.4 -90]
+ [-0.3 len sub 0.7 len add -90]
+] {
+ gsave
+ aload pop rotate translate
+ 0 1 len 1 sub {
+ dup 0 moveto
+ sequence exch 1 getinterval
+ show
+ } for
+ grestore
+ } forall
+} bind def
+
+/drawgrid{
+ 0.01 setlinewidth
+ len log 0.9 sub cvi 10 exch exp % grid spacing
+ dup 1 gt {
+ dup dup 20 div dup 2 array astore exch 40 div setdash
+ } { [0.3 0.7] 0.1 setdash } ifelse
+ 0 exch len {
+ dup dup
+ 0 moveto
+ len lineto
+ dup
+ len exch sub 0 exch moveto
+ len exch len exch sub lineto
+ stroke
+ } for
+ [] 0 setdash
+ 0.04 setlinewidth
+ currentdict /cutpoint known {
+ cutpoint 1 sub
+ dup dup -1 moveto len 1 add lineto
+ len exch sub dup
+ -1 exch moveto len 1 add exch lineto
+ stroke
+ } if
+ 0.5 neg dup translate
+} bind def
+
+end
+%%EndProlog
+DPdict begin
+%delete next line to get rid of title
+270 665 moveto /Helvetica findfont 14 scalefont setfont (Anolis_carolinensis_chrUn_GL343207.trna3-A) show
+
+/sequence { (\
+GGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGCGAGAGGUAGCGGGAUUGAUGCCCGCAUUCUCCA\
+) } def
+/winSize 70 def
+/len { sequence length } bind def
+
+292 416 translate
+72 6 mul len 1 add winSize add 2 sqrt mul div dup scale
+/Helvetica findfont 0.95 scalefont setfont
+
+/drawseq_turn {% print sequence at bottom
+ gsave
+ len 2 sqrt div dup neg 0.28 add exch 0.78 sub translate
+ 0 1 len 1 sub {
+ dup dup 2 sqrt mul 0 moveto
+ sequence exch 1 getinterval
+ show
+ } for
+ grestore
+} bind def
+/drawgrid_turn{
+ 0.01 setlinewidth
+ len log 0.9 sub cvi 10 exch exp % grid spacing
+ dup 1 gt {
+ dup dup 20 div dup 2 array astore exch 40 div setdash
+ } { [0.3 0.7] 0.1 setdash } ifelse
+ 0 exch len { %for (0, gridspacing, len)
+ dup dup %duplicate what - gridspacing??
+ dup len exch sub moveto %moveto diagonal?
+ dup winSize gt
+ {dup dup len exch sub winSize add lineto}
+ {dup len lineto}ifelse
+ dup len exch sub moveto %moveto diagonal?
+ dup len winSize sub le
+ {dup dup len exch sub dup winSize exch sub len add exch lineto}
+ {dup dup len exch sub len exch lineto}ifelse stroke pop pop
+ } for
+ len log 0.9 sub cvi 10 exch exp % grid spacing
+ dup 1 gt {
+ dup dup 20 div dup 2 array astore exch 40 div setdash
+ } { [0.3 0.7] 0.1 setdash } ifelse
+ 0 exch len { %for (0, gridspacing, len)
+ dup dup %duplicate what - gridspacing??
+ dup len exch sub moveto %moveto diagonal?
+ len exch sub 0.7 sub exch 0.7 sub exch lineto
+ stroke
+ }for
+ winSize len moveto len winSize lineto stroke
+ [] 0 setdash
+ 0.04 setlinewidth
+ currentdict /cutpoint known {
+ cutpoint 1 sub
+ dup dup -1 moveto len 1 add lineto
+ len exch sub dup
+ -1 exch moveto len 1 add exch lineto
+ stroke
+ } if
+ 0.5 neg dup translate
+} bind def
+
+0.5 dup translate
+drawseq_turn
+45 rotate
+
+
+%draw the grid
+drawgrid_turn
+
+%start of base pair probability data
+2 70 0.1914 ubox
+2 71 0.9787 ubox
+3 69 0.1660 ubox
+3 70 0.7676 ubox
+3 72 0.8449 ubox
+4 68 0.1377 ubox
+4 69 0.7113 ubox
+4 71 0.4928 ubox
+5 67 0.1266 ubox
+5 68 0.7090 ubox
+5 70 0.3955 ubox
+6 67 0.6860 ubox
+7 66 0.6345 ubox
+10 25 0.9888 ubox
+11 24 0.9915 ubox
+12 23 0.9914 ubox
+13 22 0.9913 ubox
+15 20 0.1291 ubox
+17 73 0.1217 ubox
+18 72 0.1091 ubox
+27 43 0.9522 ubox
+28 42 0.9836 ubox
+29 41 0.9874 ubox
+30 40 0.9886 ubox
+31 39 0.9883 ubox
+33 37 0.1014 ubox
+38 73 0.1170 ubox
+39 72 0.1080 ubox
+41 71 0.1523 ubox
+42 70 0.1341 ubox
+43 69 0.1387 ubox
+43 71 0.2800 ubox
+44 68 0.1392 ubox
+44 70 0.3364 ubox
+45 67 0.1266 ubox
+45 68 0.1838 ubox
+45 69 0.3586 ubox
+45 72 0.3252 ubox
+46 67 0.2524 ubox
+46 68 0.3007 ubox
+46 69 0.1142 ubox
+46 71 0.2655 ubox
+47 66 0.2807 ubox
+48 67 0.1394 ubox
+49 65 0.9981 ubox
+50 64 0.9997 ubox
+51 63 0.9997 ubox
+52 62 0.9997 ubox
+53 61 0.9981 ubox
+54 59 0.1565 ubox
+55 60 0.3242 ubox
+showpage
+end
+%%EOF
diff -r 000000000000 -r 22e8485bc5f3 test-data/rnaplot_input1.dbn
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnaplot_input1.dbn Wed Dec 20 08:30:44 2017 -0500
@@ -0,0 +1,3 @@
+>Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC (218800-218872) Ala (AGC) 73 bp Sc: 49.55
+UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA
+.((((((..((((........)))).(((((.......))))).....(((((.......))))))))))).. (-21.90)
diff -r 000000000000 -r 22e8485bc5f3 test-data/rnaplot_input1.fa
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnaplot_input1.fa Wed Dec 20 08:30:44 2017 -0500
@@ -0,0 +1,4 @@
+>Anolis_caro_chrUn_GL343590.trna2-AlaAGC (218800-218872) Ala (AGC) 73 bp Sc: 49.55
+TGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGTGAGAGGTAGTGGGATCGATGCCCACATTCTCCA
+>Anolis_caro_chrUn_GL343207.trna3-AlaAGC (1513626-1513698) Ala (AGC) 73 bp Sc: 56.15
+GGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGCGAGAGGTAGCGGGATTGATGCCCGCATTCTCCA
diff -r 000000000000 -r 22e8485bc5f3 test-data/rnasnoop_input1a.fa
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnasnoop_input1a.fa Wed Dec 20 08:30:44 2017 -0500
@@ -0,0 +1,2 @@
+>homo
+CGCGACCUCAGAUCAGACGUGGCGACCCGCUGAAUUUAAGCAUAUUAGUCAGCGGAGGAAAAGAAACUAACCAGGAUUCCCUCAGUAACGGCGAGUGAACAGGGAAGAGCCCAGCGCCGAAUCCCCGCCCCGCGGGGCGCGGGACAUGUGGCGUACGGAAGACCCGCUCCCCGGCGCCGCUCGUGGGGGGCCCAAGUCCUUCUGAUCGAGGCCCAGCCCGUGGACGGUGUGAGGCCGGUAGCGGCCGGCGCGCGCCCGGGUCUUCCCGGAGUCGGGUUGCUUGGGAAUGCAGCCCAAAGCGGGUGGUAAACUCCAUCUAAGGCUAAAUACCGGCACGAGACCGAUAGUCAACAAGUACCGUAAGGGAAAGUUGAAAAGAACUUUGAAGAGAGAGUUCAAGAGGGCGUGAAACCGUUAAGAGGUAAACGGGUGGGGUCCGCGCAGUCCGCCCGGAGGAUUCAACCCGGCGGCGGGUCCGGCCGUGUCGGCGGCCCGGCGGAUCUUUCCCGCCCCCCGUUCCUCCCGACCCCUCCACCCGCCCUCCCUUCCCCCGCCGCCCCUCCUCCUCCUCCCCGGAGGGGGCGGGCUCCGGCGGGUGCGGGGGUGGGCGGGCGGGGCCGGGGGUGGGGUCGGCGGGGGACCGUCCCCCGACCGGCGACCGGCCGCCGCCGGGCGCAUUUCCACCGCGGCGGUGCGCCGCGACCGGCUCCGGGACGGCUGGGAAGGCCCGGCGGGGAAGGUGGCUCGGGGGGCCCCGUCCGUCCGUCCGUCCUCCUCCUCCCCCGUCUCCGCCCCCCGGCCCCGCGUCCUCCCUCGGGAGGGCGCGCGGGUCGGGGCGGCGGCGGCGGCGGCGGUGGCGGCGGCGGCGGGGGCGGCGGGACCGAAACCCCCCCCGAGUGUUACAGCCCCCCCGGCAGCAGCACUCGCCGAAUCCCGGGGCCGAGGGAGCGAGACCCGUCGCCGCGCUCUCCCCCCUCCCGGCGCCCACCCCCGCGGGGAAUCCCCCGCGAGGGGGGUCUCCCCCGCGGGGGCGCGCCGGCGUCUCCUCGUGGGGGGGCCGGGCCACCCCUCCCACGGCGCGACCGCUCUCCCACCCCUCCUCCCCGCGCCCCCGCCCCGGCGACGGGGGGGGUGCCGCGCGCGGGUCGGGGGGCGGGGCGGACUGUCCCCAGUGCGCCCCGGGCGGGUCGCGCCGUCGGGCCCGGGGGAGGUUCUCUCGGGGCCACGCGCGCGUCCCCCGAAGAGGGGGACGGCGGAGCGAGCGCACGGGGUCGGCGGCGACGUCGGCUACCCACCCGACCCGUCUUGAAACACGGACCAAGGAGUCUAACACGUGCGCGAGUCGGGGGCUCGCACGAAAGCCGCCGUGGCGCAAUGAAGGUGAAGGCCGGCGCGCUCGCCGGCCGAGGUGGGAUCCCGAGGCCUCUCCAGUCCGCCGAGGGCGCACCACCGGCCCGUCUCGCCCGCCGCGCCGGGGAGGUGGAGCACGAGCGCACGUGUUAGGACCCGAAAGAUGGUGAACUAUGCCUGGGCAGGGCGAAGCCAGAGGAAACUCUGGUGGAGGUCCGUAGCGGUCCUGACGUGCAAAUCGGUCGUCCGACCUGGGUAUAGGGGCGAAAGACUAAUCGAACCAUCUAGUAGCUGGUUCCCUCCGAAGUUUCCCUCAGGAUAGCUGGCGCUCUCGCAGACCCGACGCACCCCCGCCACGCAGUUUUAUCCGGUAAAGCGAAUGAUUAGAGGUCUUGGGGCCGAAACGAUCUCAACCUAUUCUCAAACUUUAAAUGGGUAAGAAGCCCGGCUCGCUGGCGUGGAGCCGGGCGUGGAAUGCGAGUGCCUAGUGGGCCACUUUUGGUAAGCAGAACUGGCGCUGCGGGAUGAACCGAACGCCGGGUUAAGGCGCCCGAUGCCGACGCUCAUCAGACCCCAGAAAAGGUGUUGGUUGAUAUAGACAGCAGGACGGUGGCCAUGGAAGUCGGAAUCCGCUAAGGAGUGUGUAACAACUCACCUGCCGAAUCAACUAGCCCUGAAAAUGGAUGGCGCUGGAGCGUCGGGCCCAUACCCGGCCGUCGCCGGCAGUCGAGAGUGGACGGGAGCGGCGGGGGCGGCGCGCGCGCGCGCGCGUGUGGUGUGCGUCGGAGGGCGGCGGCGGCGGCGGCGGCGGGGGUGUGGGGUCCUUCCCCCGCCCCCCCCCCCACGCCUCCUCCCCUCCUCCCGCCCACGCCCCGCUCCCCGCCCCCGGAGCCCCGCGGACGCUACGCCGCGACGAGUAGGAGGGCCGCUGCGGUGAGCCUUGAAGCCUAGGGCGCGGGCCCGGGUGGAGCCGCCGCAGGUGCAGAUCUUGGUGGUAGUAGCAAAUAUUCAAACGAGAACUUUGAAGGCCGAAGUGGAGAAGGGUUCCAUGUGAACAGCAGUUGAACAUGGGUCAGUCGGUCCUGAGAGAUGGGCGAGCGCCGUUCCGAAGGGACGGGCGAUGGCCUCCGUUGCCCUCGGCCGAUCGAAAGGGAGUCGGGUUCAGAUCCCCGAAUCCGGAGUGGCGGAGAUGGGCGCCGCGAGGCGUCCAGUGCGGUAACGCGACCGAUCCCGGAGAAGCCGGCGGGAGCCCCGGGGAGAGUUCUCUUUUCUUUGUGAAGGGCAGGGCGCCCUGGAAUGGGUUCGCCCCGAGAGAGGGGCCCGUGCCUUGGAAAGCGUCGCGGUUCCGGCGGCGUCCGGUGAGCUCUCGCUGGCCCUUGAAAAUCCGGGGGAGAGGGUGUAAAUCUCGCGCCGGGCCGUACCCAUAUCCGCAGCAGGUCUCCAAGGUGAACAGCCUCUGGCAUGUUGGAACAAUGUAGGUAAGGGAAGUCGGCAAGCCGGAUCCGUAACUUCGGGAUAAGGAUUGGCUCUAAGGGCUGGGUCGGUCGGGCUGGGGCGCGAAGCGGGGCUGGGCGCGCGCCGCGGCUGGACGAGGCGCGCGCCCCCCCCACGCCCGGGGCACCCCCCUCGCGGCCCUCCCCCGCCCCACCCGCGCGCGCCGCUCGCUCCCUCCCCACCCCGCGCCCUCUCUCUCUCUCUCUCCCCCGCUCCCCGUCCUCCCCCCUCCCCGGGGGAGCGCCGCGUGGGGGCGCGGCGGGGGGAGAAGGGUCGGGGCGGCAGGGGCCGCGCGGCGGCCGCCGGGGCGGCCGGCGGGGGCAGGUCCCCGCGAGGGGGGCCCCGGGGACCCGGGGGGCCGGCGGCGGCGCGGACUCUGGACGCGAGCCGGGCCCUUCCCGUGGAUCGCCCCAGCUGCGGCGGGCGUCGCGGCCGCCCCCGGGGAGCCCGGCGGCGGCGCGGCGCGCCCCCCACCCCCACCCCACGUCUCGGUCGCGCGCGCGUCCGCUGGGGGCGGGAGCGGUCGGGCGGCGGCGGUCGGCGGGCGGCGGGGCGGGGCGGUUCGUCCCCCCGCCCUACCCCCCCGGCCCCGUCCGCCCCCCGUUCCCCCCUCCUCCUCGGCGCGCGGCGGCGGCGGCGGCAGGCGGCGGAGGGGCCGCGGGCCGGUCCCCCCCGCCGGGUCCGCCCCCGGGGCCGCGGUUCCGCGCGCGCCUCGCCUCGGCCGGCGCCUAGCAGCCGACUUAGAACUGGUGCGGACCAGGGGAAUCCGACUGUUUAAUUAAAACAAAGCAUCGCGAAGGCCCGCGGCGGGUGUUGACGCGAUGUGAUUUCUGCCCAGUGCUCUGAAUGUCAAAGUGAAGAAAUUCAAUGAAGCGCGGGUAAACGGCGGGAGUAACUAUGACUCUCUUAAGGUAGCCAAAUGCCUCGUCAUCUAAUUAGUGACGCGCAUGAAUGGAUGAACGAGAUUCCCACUGUCCCUACCUACUAUCCAGCGAAACCACAGCCAAGGGAACGGGCUUGGCGGAAUCAGCGGGGAAAGAAGACCCUGUUGAGCUUGACUCUAGUCUGGCACGGUGAAGAGACAUGAGAGGUGUAGAAUAAGUGGGAGGCCCCCGGCGCCCCCCCGGUGUCCCCGCGAGGGGCCCGGGGCGGGGUCCGCGGCCCUGCGGGCCGCCGGUGAAAUACCACUACUCUGAUCGUUUUUUCACUGACCCGGUGAGGCGGGGGGGCGAGCCCGAGGGGCUCUCGCUUCUGGCGCCAAGCGCCCGCCCGGCCGGGCGCGACCCGCUCCGGGGACAGUGCCAGGUGGGGAGUUUGACUGGGGCGGUACACCUGUCAAACGGUAACGCAGGUGUCCUAAGGCGAGCUCAGGGAGGACAGAAACCUCCCGUGGAGCAGAAGGGCAAAAGCUCGCUUGAUCUUGAUUUUCAGUACGAAUACAGACCGUGAAAGCGGGGCCUCACGAUCCUUCUGACCUUUUGGGUUUUAAGCAGGAGGUGUCAGAAAAGUUACCACAGGGAUAACUGGCUUGUGGCGGCCAAGCGUUCAUAGCGACGUCGCUUUUUGAUCCUUCGAUGUCGGCUCUUCCUAUCAUUGUGAAGCAGAAUUCGCCAAGCGUUGGAUUGUUCACCCACUAAUAGGGAACGUGAGCUGGGUUUAGACCGUCGUGAGACAGGUUAGUUUUACCCUACUGAUGAUGUGUUGUUGCCAUGGUAAUCCUGCUCAGUACGAGAGGAACCGCAGGUUCAGACAUUUGGUGUAUGUGCUUGGCUGAGGAGCCAAUGGGGCGAAGCUACCAUCUGUGGGAUUAUGACUGAACGCCUCUAAGUCAGAAUCCCGCCCAGGCGAACGAUACGGCAGCGCCGCGGAGCCUCGGUUGGCCUCGGAUAGCCGGUCCCCCGCCUGUCCCCGCCGGCGGGCCGCCCCCCCCUCCACGCGCCCCGCCGCGGGAGGGCGCGUGCCCCGCCGCGCGCCGGGACCGGGGUCCGGUGCGGAGUGCCCUUCGUCCUGGGAAACGGGGCGCGGCCGGAAAGGCGGCCGCCCCCUCGCCCGUCACGCACCGCACGUUCGUGGGGAACCUGGCGCUAAACCAUUCGUAGACGACCUGCUUCUGGGUCGGGGUUUCGUACGUAGCAGAGCAGCUCCCUCGCUGCGAUCUAUUGAAAGUCAGCCCUCGACACAAGGGUUUGUC
diff -r 000000000000 -r 22e8485bc5f3 test-data/rnasnoop_input1b.fa
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnasnoop_input1b.fa Wed Dec 20 08:30:44 2017 -0500
@@ -0,0 +1,2 @@
+>ACA51
+AACCTACCCCATATACACCTCAGCTCAGGCCCTGTGCCTGGTCTGTATTGTGAATGGGGGAACATAG
diff -r 000000000000 -r 22e8485bc5f3 test-data/rnasnoop_result1.txt
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnasnoop_result1.txt Wed Dec 20 08:30:44 2017 -0500
@@ -0,0 +1,4 @@
+>ACA51
+>homo
+<<<<<.<<<<.|.<<.<<<&...(((>>>.>>.((((...............................))))..>>>>.>>>>>))) 4468,4486;4479 : 8,65 (-35.60 = -16.10 + -7.60 + -12.40 + -3.60 + 4.1 ) (-23.60)
+UGUUCACCCACUAAUAGGG&AACCUACCCCAUAUACACCUCAGCUCAGGCCCUGUGCCUGGUCUGUAUUGUGAAUGGGGGAACAUAG
diff -r 000000000000 -r 22e8485bc5f3 test-data/rnasubopt_input1.fa
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnasubopt_input1.fa Wed Dec 20 08:30:44 2017 -0500
@@ -0,0 +1,4 @@
+>Anolis_caro_chrUn_GL343590.trna2-AlaAGC (218800-218872) Ala (AGC) 73 bp Sc: 49.55
+TGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGTGAGAGGTAGTGGGATCGATGCCCACATTCTCCA
+>Anolis_caro_chrUn_GL343207.trna3-AlaAGC (1513626-1513698) Ala (AGC) 73 bp Sc: 56.15
+GGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGCGAGAGGTAGCGGGATTGATGCCCGCATTCTCCA
diff -r 000000000000 -r 22e8485bc5f3 test-data/rnasubopt_result1.txt
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnasubopt_result1.txt Wed Dec 20 08:30:44 2017 -0500
@@ -0,0 +1,7 @@
+>Anolis_caro_chrUn_GL343590.trna2-AlaAGC [0]
+UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA -22.00 0.00
+(((((((..((((........)))).(((((.......))))).....(((((.......))))))))).))) -22.00
+.((((((..((((........)))).(((((.......))))).....(((((.......))))))))))).. -22.00
+>Anolis_caro_chrUn_GL343207.trna3-AlaAGC [0]
+GGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGCGAGAGGUAGCGGGAUUGAUGCCCGCAUUCUCCA -29.60 0.00
+(((((((..((((........)))).(((((.......))))).....(((((.......)))))))))))). -29.60
diff -r 000000000000 -r 22e8485bc5f3 test-data/rnaup_input1.fa
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnaup_input1.fa Wed Dec 20 08:30:44 2017 -0500
@@ -0,0 +1,4 @@
+>Anolis_caro_chrUn_GL343590.trna2-AlaAGC (218800-218872) Ala (AGC) 73 bp Sc: 49.55
+TGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGTGAGAGGTAGTGGGATCGATGCCCACATTCTCCA
+>Anolis_caro_chrUn_GL343207.trna3-AlaAGC (1513626-1513698) Ala (AGC) 73 bp Sc: 56.15
+GGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGCGAGAGGTAGCGGGATTGATGCCCGCATTCTCCA
diff -r 000000000000 -r 22e8485bc5f3 test-data/rnaup_result1.txt
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnaup_result1.txt Wed Dec 20 08:30:44 2017 -0500
@@ -0,0 +1,6 @@
+>Anolis_caro_chrUn_GL343590.trna2-AlaAGC
+ 55, 58 (0.019) for u= 4
+RNAup output in file: Anolis_caro_chrUn_GL343590.trna2-AlaAGC_u1.out
+>Anolis_caro_chrUn_GL343207.trna3-AlaAGC
+ 16, 19 (0.004) for u= 4
+RNAup output in file: Anolis_caro_chrUn_GL343207.trna3-AlaAGC_u1.out
diff -r 000000000000 -r 22e8485bc5f3 test-data/sample_3.fa
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/sample_3.fa Wed Dec 20 08:30:44 2017 -0500
@@ -0,0 +1,6 @@
+>SECIS_1 test
+AUUUUAUCCAUGAAAGUGUUUCCUCUAAACCUAUGUGGAGGAACACCUGAUGUCCAGGAAAAU
+>6S_1 test1
+GAAACCCUAAUGUAUUCGAUAUAGUUCCUGAUAUUUUUGAACCGAACAAUUUUUUAUACCUAGGGAGCUUGGAGUUCCGGCGCGGCGCACAUGCCUUCACACGAGGAAGUGCAAACCGUUAGACAGAGCACCCACCUGCUUUAAUUGAGAGCGGGUUCAAAGGAAGGGAAUCCUAAACGGUACGAUUGGGGUUUCU
+>6S_2
+UUGUCCCUGCCGUGCUCGUGACUUGGCCAUACAUUCUCUGAACCUAUGUCUUACGGCAUAUGGGUUGCGGGAGUGUAGAGCUGGAGUGAUCGUCUACUCGUAGACGAACCCGAUGCUCUUCGGAUCGCGACCACCUUGAACCUCAGGGUUCGAGAUGCCGGCCUUGACGGCACAGGCGGGGCAUC
diff -r 000000000000 -r 22e8485bc5f3 test-data/sample_3.react
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/sample_3.react Wed Dec 20 08:30:44 2017 -0500
@@ -0,0 +1,447 @@
+>SECIS_1
+1 0.0657466222
+2 0.1280448842
+3 0.2786665403
+4 0.1391216354
+5 0.0272299574
+6 0.1717063095
+7 0.488732281
+8 3.3015172695
+9 0.414494604
+10 0.1957445189
+11 0.4670328791
+12 0.1943420556
+13 0.2099109521
+14 0.5846784488
+15 0.1296563697
+16 0.0359267698
+17 0.0438238841
+18 1.6364597431
+19 1.72206594665E-17
+20 0.0099928394
+21 0.0475042774
+22 0.0065948845
+23 0.0574522715
+24 0.2126102485
+25 1.2006488448
+26 0.6040825271
+27 0.4114049219
+28 1.1514597937
+29 1.216707413
+30 0.0186005737
+31 0.0841609069
+32 0.086771667
+33 1.1672973211
+34 0.8144419625
+35 0.2583987716
+36 0.0182542709
+37 0.0875979754
+38 0.094456587
+39 0.5206337515
+40 0.000517531
+41 0.0253820905
+42 0.2076338063
+43 0.0087295599
+44 0.0129264641
+45 0.0127365182
+46 0.1193338151
+47 0.0186183812
+48 0.3581141112
+49 0.0941009884
+50 0.2050905673
+51 0.0209195644
+52 0.6030952711
+53 5.2129588113
+54 0.1747678483
+55 1.2231479801
+56 0.4978854319
+57 0.5711590135
+58 0.2793524314
+59 0.0037936012
+60 0.2158137729
+61 0.5646393912
+62 0.6229186627
+63 0.0193621982
+>6S_1
+1 0.1158690877
+2 0.0774028501
+3 0.2349947573
+4 1.72206594665E-17
+5 0.0926174169
+6 0.0505177415
+7 0.0457131819
+8 0.0194615986
+9 2.1495069267
+10 0.0409639397
+11 0.2185631969
+12 0.1776745985
+13 0.0086422926
+14 0.0241577615
+15 0.0092855631
+16 0.3453240509
+17 0.1535840586
+18 0.0180643958
+19 0.1188776616
+20 0.3091581196
+21 0.3748109806
+22 0.6187506508
+23 0.3511511383
+24 0.6512026704
+25 0.3096370415
+26 0.5283368492
+27 0.7500060952
+28 0.0352720444
+29 0.3776026196
+30 0.3489100484
+31 1.3035405919
+32 0.1023638167
+33 0.133082988
+34 0.0024118398
+35 0.0281166587
+36 0.2818828676
+37 0.1316060603
+38 0.1813992598
+39 0.0047490217
+40 0.0204058553
+41 0.0675891142
+42 0.045119933
+43 0.0266727645
+44 0.0673921107
+45 0.0085752561
+46 0.495476266
+47 0.8224799434
+48 0.5574272341
+49 0.2431151153
+50 0.256015696
+51 0.0386339787
+52 0.6618567864
+53 0.0707284393
+54 1.1215284869
+55 0.0463423016
+56 0.3338809513
+57 0.3987796157
+58 1.1046527917
+59 0.6156154318
+60 0.1179259769
+61 2.0333569471
+62 0.1224421595
+63 0.0266055429
+64 0.0298356423
+65 0.3004015135
+66 2.1966900004
+67 0.0222153137
+68 0.0095300422
+69 0.0503009918
+70 0.0418994997
+71 0.0384566069
+72 2.6211662666
+73 0.1704872628
+74 0.8386436572
+75 0.6961218859
+76 0.1995308419
+77 0.0552442152
+78 0.1937915065
+79 0.1239592493
+80 0.0782601391
+81 0.0138965117
+82 0.0231978646
+83 0.0150709773
+84 0.4084290821
+85 0.0792668417
+86 1.0630476211
+87 0.2524739666
+88 0.0229636507
+89 0.1153934877
+90 0.2693801005
+91 0.0071337145
+92 1.0279231796
+93 0.0574241281
+94 0.103312087
+95 0.2100864561
+96 0.0252070712
+97 0.6067864142
+98 0.0607860625
+99 0.5416948523
+100 0.7090251541
+101 2.0470096713
+102 0.0368697578
+103 0.1221648319
+104 0.0484836208
+105 0.7188621431
+106 0.2405585888
+107 0.1071170724
+108 0.6859305671
+109 0.0997679124
+110 0.0342400356
+111 0.0201635
+112 0.4527960874
+113 0.7018417748
+114 0.2561295384
+115 0.2788440973
+116 0.2437240042
+117 0.0984135237
+118 0.1146045041
+119 0.2116296362
+120 0.0360702095
+121 0.2006613525
+122 0.0635994434
+123 0.8384420629
+124 0.3546527057
+125 0.014380068
+126 0.0041004554
+127 0.2404132813
+128 0.0016204246
+129 0.016365643
+130 0.0025333389
+131 0.0207130798
+132 0.2199275512
+133 0.2973627433
+134 1.7680018464
+135 0.3120917444
+136 0.854288287
+137 0.4309335923
+138 2.3003988746
+139 0.047166557
+140 0.7391255635
+141 0.1357653755
+142 0.4672659386
+143 0.3601080698
+144 0.9111911856
+145 0.7435427597
+146 0.3353115579
+147 1.0513358906
+148 0.1406855309
+149 0.3543459659
+150 0.0561408821
+151 0.563013834
+152 0.1549691284
+153 0.7460309808
+154 0.0486849156
+155 0.1080587915
+156 0.0699642772
+157 0.4423435657
+158 0.0171555252
+159 0.0064557797
+160 0.4739275466
+161 0.2617128164
+162 0.0879369647
+163 0.0062762841
+164 0.1060085461
+165 0.0971932081
+166 0.3139785044
+167 0.0771649003
+168 0.0753029618
+169 0.5676607679
+170 0.9836368904
+171 0.6193661835
+172 0.3890022353
+173 0.3304911731
+174 0.9354752573
+175 2.5683088408
+176 0.6777050636
+177 0.0195000778
+178 0.0532349161
+179 0.0993391181
+180 0.0667310411
+181 0.0123690861
+182 0.0165201319
+183 0.2056431695
+184 0.0114477122
+185 0.1684423923
+186 0.6236165725
+187 0.2533573459
+188 7.4644850979
+189 1.72206594665E-17
+190 0.0510513818
+191 0.071993023
+192 0.093087642
+193 0.026770297
+194 0.1003921418
+195 0.731799564
+196 0.3882654324
+>6S_2
+1 5.135077189
+2 0.0137794619
+3 0.0198585136
+4 0.0394762621
+5 0.1032256038
+6 0.0124879331
+7 0.050343991
+8 0.0266906427
+9 0.0867862234
+10 0.0250443701
+11 0.1241682715
+12 0.0888505404
+13 1.72206594665E-17
+14 0.0443782398
+15 0.0331749933
+16 1.190843321
+17 0.0083605324
+18 0.1025127456
+19 0.0318835351
+20 0.6764653014
+21 1.6659553696
+22 0.0532195755
+23 0.1306535914
+24 3.2368938797
+25 0.2999875752
+26 0.1771608894
+27 0.0735275063
+28 1.1463641343
+29 0.3436951718
+30 0.6339043401
+31 0.8229568123
+32 0.0567986298
+33 0.3413998482
+34 0.1291037675
+35 0.561127074
+36 0.0076983354
+37 0.147000237
+38 0.0214390185
+39 0.5304305785
+40 0.0785507542
+41 0.0483731004
+42 0.0976091996
+43 1.2125480978
+44 0.1865263845
+45 0.6312459899
+46 0.1817958047
+47 2.8617198725
+48 0.2055922577
+49 1.3068827801
+50 0.2629492567
+51 0.8571308379
+52 0.2726647331
+53 1.129084224
+54 0.275119436
+55 0.5874419445
+56 0.3657294569
+57 0.2500734975
+58 1.0443534711
+59 4.5331285532
+60 0.2551985691
+61 0.1800315837
+62 1.2079574507
+63 0.1377332438
+64 0.034281766
+65 0.0098202871
+66 0.9938878178
+67 0.0331980613
+68 0.2884058117
+69 0.1471099733
+70 0.0250835628
+71 0.0040433138
+72 2.1207460501
+73 0.7413016698
+74 0.2856087978
+75 0.1043896327
+76 2.5426831833
+77 0.024753755
+78 0.0197741979
+79 0.0256614712
+80 0.0931195919
+81 0.2341548619
+82 0.9442989
+83 0.6902004027
+84 0.2615426874
+85 0.1968596889
+86 0.1317761893
+87 0.3101105886
+88 0.3109082689
+89 0.6036478733
+90 0.1383132052
+91 1.72206594665E-17
+92 1.3701244222
+93 0.0259262955
+94 0.0427849321
+95 0.0059202715
+96 0.4620195968
+97 1.1627066739
+98 0.1193652803
+99 0.5039174355
+100 0.7685843498
+101 3.3504451177
+102 0.0156110762
+103 0.0405202895
+104 0.0448853051
+105 0.1130352336
+106 0.0128895533
+107 0.0140152443
+108 0.8487385272
+109 0.5411302314
+110 0.1921994675
+111 0.0804367301
+112 2.1393979849
+113 0.657192459
+114 0.9680746376
+115 0.0181673032
+116 0.1293355582
+117 0.0385348779
+118 0.0599847607
+119 0.0286153267
+120 0.0529816257
+121 0.0738905329
+122 1.9826160191
+123 0.6850277412
+124 0.0240149916
+125 0.1003714264
+126 0.0282377438
+127 0.016091267
+128 0.0654324545
+129 1.3672926211
+130 0.3123897874
+131 0.0125997931
+132 0.0326682275
+133 0.8141700098
+134 2.7208263459
+135 0.9376426669
+136 0.2104407859
+137 0.9213456642
+138 0.9496557623
+139 0.0158974709
+140 1.0394051723
+141 3.395502997
+142 0.2786545217
+143 0.0944673368
+144 0.1658691067
+145 1.5138095878
+146 0.2388473327
+147 0.0071582802
+148 0.0399196127
+149 0.0269685694
+150 0.0343298406
+151 0.0260244978
+152 0.1131275763
+153 0.0217325853
+154 0.1015784545
+155 0.0991349861
+156 1.4195713543
+157 0.5085589945
+158 0.1250938659
+159 0.788081555
+160 0.1135816768
+161 0.0633806979
+162 2.7826494
+163 1.8003487205
+164 0.7686439584
+165 0.0397996113
+166 0.8340757785
+167 0.0060961894
+168 0.0003936337
+169 0.0179660084
+170 0.033466093
+171 0.0469772809
+172 0.1070226766
+173 0.3447929483
+174 0.8559366126
+175 0.1279778477
+176 0.2188243998
+177 0.0449863446
+178 0.0382790499
+179 0.0022221768
+180 0.0311889472
+181 0.0257878168
+182 0.0172539125
+183 0.2710934097
+184 0.0914500662
+185 0.208503114
\ No newline at end of file
diff -r 000000000000 -r 22e8485bc5f3 test-data/sample_3_result.txt
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/sample_3_result.txt Wed Dec 20 08:30:44 2017 -0500
@@ -0,0 +1,9 @@
+>SECIS_1
+AUUUUAUCCAUGAAAGUGUUUCCUCUAAACCUAUGUGGAGGAACACCUGAUGUCCAGGAAAAU
+.((((...(((.(..(((.((((((((........))))))))))).).))).....)))).. (-27.97)
+>6S_1
+GAAACCCUAAUGUAUUCGAUAUAGUUCCUGAUAUUUUUGAACCGAACAAUUUUUUAUACCUAGGGAGCUUGGAGUUCCGGCGCGGCGCACAUGCCUUCACACGAGGAAGUGCAAACCGUUAGACAGAGCACCCACCUGCUUUAAUUGAGAGCGGGUUCAAAGGAAGGGAAUCCUAAACGGUACGAUUGGGGUUUCU
+(((((((...(((((.((.....((((((....((((((((((...................(((.((((.....((.((((.(..((((.(.((((.....))))).))))...))))).))..)))).)))....(((((.....))))).))))))))))..))))))......)))))))....))))))). (-110.38)
+>6S_2
+UUGUCCCUGCCGUGCUCGUGACUUGGCCAUACAUUCUCUGAACCUAUGUCUUACGGCAUAUGGGUUGCGGGAGUGUAGAGCUGGAGUGAUCGUCUACUCGUAGACGAACCCGAUGCUCUUCGGAUCGCGACCACCUUGAACCUCAGGGUUCGAGAUGCCGGCCUUGACGGCACAGGCGGGGCAUC
+.((.(((((((((((.(((.(...((((...((.((((.((((((..(((....))).....((((((((...((.(((((.((.((..((((((......))))))))))...))))).))..)))))))).............))))))))))))..)))).).))))))).))))))))).. (-129.27)
diff -r 000000000000 -r 22e8485bc5f3 test-data/test_sequence_input.fasta
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/test_sequence_input.fasta Wed Dec 20 08:30:44 2017 -0500
@@ -0,0 +1,2 @@
+>test_seq
+ACAGGUUCGCCUGUGUUGCGAACCUGCGGGUUCG
diff -r 000000000000 -r 22e8485bc5f3 test-data/trajectory_result.tabular
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/trajectory_result.tabular Wed Dec 20 08:30:44 2017 -0500
@@ -0,0 +1,10 @@
+..(((....))) -0.4 0.0550686 3.9 6.46108 12
+.((((....)))) -3 0.0600001 5.96046e-09 6.46108 13
+(((((....))))) -4.7 0.065 0 6.46108 14
+(((((....)))))..((((....)))) -5.3 0.135069 3.9 6.46108 28
+(((((....))))).(((((....))))) -5.8 0.14 1.90735e-07 6.46108 29
+(((((....))))).......(((....)))... -6.9 0.17246 6.7 7.46108 34
+(((((....)))))......((((....)))).. -7.8 0.17246 9.53674e-08 7.46108 34
+(((((....))))).....(((((....))))). -10.7 0.17246 1.90735e-07 7.46108 34
+(((((....)))))....((((((....)))))) -13.1 0.17246 -1.90735e-07 7.46108 34
+.(((((((((.......)))))))))........ -13.6 123.457 12.5 13 34
diff -r 000000000000 -r 22e8485bc5f3 vienna_rna.tar.gz
Binary file vienna_rna.tar.gz has changed
]