# HG changeset patch
# User rnateam
# Date 1481045830 18000
# Node ID 58fe85fe08be54e1f0850222c920f88e1b3ccb93
planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/rna_tools/vienna_rna commit 0065dafe7bbd382bb995b28cc4089c9e4f4eeeb9
diff -r 000000000000 -r 58fe85fe08be macros.xml
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/macros.xml Tue Dec 06 12:37:10 2016 -0500
@@ -0,0 +1,26 @@
+
+
+
+ viennarna
+
+
+ 2.2.10
+
+ @EXECUTABLE@ --version
+
+
+
+
+
+
+
+
+
+
+
+
+
+ 10.1186/1748-7188-6-26
+
+
+
diff -r 000000000000 -r 58fe85fe08be rnasubopt.xml
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/rnasubopt.xml Tue Dec 06 12:37:10 2016 -0500
@@ -0,0 +1,235 @@
+
+ Calculates suboptimal secondary structures of RNAs
+
+ RNAsubopt
+ macros.xml
+
+
+
+
+
+ '$output'
+ -T$temperature
+ --dangles=$dangling
+ #if $methodOption.methodSelector == "range"
+ --deltaEnergy=$methodOption.deltaenergy
+ #else
+ --stochBT=$methodOption.stochastic
+ #end if
+ #if $outputOption.outputSelector == "yes"
+ --deltaEnergyPost=$deltaenergypost
+ #end if
+ $sorted
+ $dos
+ $zuker
+ #if $varExists('$advancedOptions.nolp')
+ $advancedOptions.noconversion
+ $advancedOptions.nolp
+ $advancedOptions.nogu
+ $advancedOptions.noclosinggu
+ $advancedOptions.notetra
+ $advancedOptions.logml
+ #end if
+ #if $constraints.maxBPspan <> -1
+ --maxBPspan=$constraints.maxBPspan
+ #end if
+ #if str($constraints.constraintLocation.constraintSelector) == "fromFile"
+ --constraint='$constraints.constraintLocation.constraintsFile'
+ $constraints.constraintLocation.canonicalBPonly
+ $constraints.constraintLocation.enforceConstraint
+ #end if
+ #if str($constraints.shapeOption.shapeSelector) == "isUsed"
+ --shape='$constraints.shapeOption.shapeFile'
+ #if str($constraints.shapeOption.shapeMethod.methodSelector) == "W"
+ #set $s="W"
+ --shapeMethod=$s
+ #else if str($constraints.shapeOption.shapeMethod.methodSelector) == "Z"
+ #set $s="Zb"+str($constraints.shapeOption.shapeMethod.b)
+ --shapeMethod=$s
+ #if str($constraints.shapeOption.shapeMethod.shapeConversion.conversionSelector) == "C"
+ #set $c="C"+str($constraints.shapeOption.shapeMethod.shapeConversion.c)
+ --shapeConversion=$c
+ #else if str($constraints.shapeOption.shapeMethod.shapeConversion.conversionSelector) == "L"
+ #set $c="Ls"+str($constraints.shapeOption.shapeMethod.shapeConversion.s)+"i"+ str($constraints.shapeOption.shapeMethod.shapeConversion.i)
+ --shapeConversion=$c
+ #else if str($constraints.shapeOption.shapeMethod.shapeConversion.conversionSelector) == "O"
+ #set $c="Os"+str($constraints.shapeOption.shapeMethod.shapeConversion.s)+"i"+ str($constraints.shapeOption.shapeMethod.shapeConversion.i)
+ --shapeConversion=$c
+ #else
+ #set $c=str($constraints.shapeOption.shapeMethod.shapeConversion.conversionSelector)
+ --shapeConversion=$c
+ #end if
+ #else if str($constraints.shapeOption.shapeMethod.methodSelector) == "D"
+ #set $s="Dm"+str($constraints.shapeOption.shapeMethod.m)+"b"+str($constraints.shapeOption.shapeMethod.b)
+ --shapeMethod=$s
+ #end if
+ #end if
+]]>
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
diff -r 000000000000 -r 58fe85fe08be test-data/kinfold_input.txt
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/kinfold_input.txt Tue Dec 06 12:37:10 2016 -0500
@@ -0,0 +1,1 @@
+ACUGAUCGUAGUCAC
diff -r 000000000000 -r 58fe85fe08be test-data/rna2dfold_input1.txt
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rna2dfold_input1.txt Tue Dec 06 12:37:10 2016 -0500
@@ -0,0 +1,4 @@
+>Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC (218800-218872) Ala (AGC) 73 bp Sc: 49.55
+UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA
+.((((((..((((........)))).(((((.......))))).....(((((.......)))))))))))..
+.((((((..(((..........))).(((((.......))))).....(((((.......)))))))))))..
diff -r 000000000000 -r 58fe85fe08be test-data/rna2dfold_result1.txt
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rna2dfold_result1.txt Tue Dec 06 12:37:10 2016 -0500
@@ -0,0 +1,6 @@
+>Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC
+UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA
+.((((((..((((........)))).(((((.......))))).....(((((.......))))))))))).. (-22.00)
+.((((((..((((........)))).(((((.......))))).....(((((.......))))))))))).. (-22.00) [
+.((((((..(((..........))).(((((.......))))).....(((((.......))))))))))).. (-17.30) ][
+k l en structure
diff -r 000000000000 -r 58fe85fe08be test-data/rnaaliduplex_input1.clustal
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnaaliduplex_input1.clustal Tue Dec 06 12:37:10 2016 -0500
@@ -0,0 +1,7 @@
+CLUSTAL 2.1 multiple sequence alignment
+
+
+Anolis_carolinensis_chrUn_GL34 TGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGTGAGAGGTAGTGGGATCGATGCCCACATTCTCCA
+Anolis_carolinensis_chrUn_GL35 GGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGCGAGAGGTAGCGGGATTGATGCCCGCATTCTCCA
+ ************************************** ************** ******* *********
+
diff -r 000000000000 -r 58fe85fe08be test-data/rnaaliduplex_result1.txt
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnaaliduplex_result1.txt Tue Dec 06 12:37:10 2016 -0500
@@ -0,0 +1,1 @@
+(((((((..(.......((((..(..((((((..((((((.......((((((..(..(((((..(((((((.&)))))))..).......))))..)..))))))..)))))).......))))))..)..)))))..))))))). 1,73 : 1,73 (-40.30)
diff -r 000000000000 -r 58fe85fe08be test-data/rnaalifold_input1.clustal
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnaalifold_input1.clustal Tue Dec 06 12:37:10 2016 -0500
@@ -0,0 +1,7 @@
+CLUSTAL 2.1 multiple sequence alignment
+
+
+Anolis_carolinensis_chrUn_GL34 TGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGTGAGAGGTAGTGGGATCGATGCCCACATTCTCCA
+Anolis_carolinensis_chrUn_GL35 GGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGCGAGAGGTAGCGGGATTGATGCCCGCATTCTCCA
+ ************************************** ************** ******* *********
+
diff -r 000000000000 -r 58fe85fe08be test-data/rnaalifold_result1.txt
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnaalifold_result1.txt Tue Dec 06 12:37:10 2016 -0500
@@ -0,0 +1,2 @@
+GGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGCGAGAGGUAGCGGGAUCGAUGCCCACAUUCUCCA
+(((((((..((((........)))).(((((.......))))).....(((((.......)))))))))))). (-26.45 = -26.20 + -0.25)
diff -r 000000000000 -r 58fe85fe08be test-data/rnacofold_input1.fas
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnacofold_input1.fas Tue Dec 06 12:37:10 2016 -0500
@@ -0,0 +1,2 @@
+>Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC (218800-218872) Ala (AGC) 73 bp Sc: 49.55
+UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA&UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA
diff -r 000000000000 -r 58fe85fe08be test-data/rnacofold_result1.txt
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnacofold_result1.txt Tue Dec 06 12:37:10 2016 -0500
@@ -0,0 +1,3 @@
+>Anolis_carolinensis_chrUn_GL343590.trna2-A
+UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA&UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA
+.((((((..((((........)))).(((((.......))))).....(((((((((((.(((((((((((..&.))))))..((((........)))).(((((.......))))).....))))))))))).))))))))))).. (-55.90)
diff -r 000000000000 -r 58fe85fe08be test-data/rnadistance_input1.dbn
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnadistance_input1.dbn Tue Dec 06 12:37:10 2016 -0500
@@ -0,0 +1,2 @@
+.((((((..((((........)))).(((((.......))))).....(((((.......)))))))))))..
+(((((((..((((........)))).(((((.......))))).....(((((.......)))))))))))).
diff -r 000000000000 -r 58fe85fe08be test-data/rnadistance_result1.txt
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnadistance_result1.txt Tue Dec 06 12:37:10 2016 -0500
@@ -0,0 +1,1 @@
+f: 4
diff -r 000000000000 -r 58fe85fe08be test-data/rnaduplex_input1.fa
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnaduplex_input1.fa Tue Dec 06 12:37:10 2016 -0500
@@ -0,0 +1,4 @@
+>Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC (218800-218872) Ala (AGC) 73 bp Sc: 49.55
+TGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGTGAGAGGTAGTGGGATCGATGCCCACATTCTCCA
+>Anolis_carolinensis_chrUn_GL343207.trna3-AlaAGC (1513626-1513698) Ala (AGC) 73 bp Sc: 56.15
+GGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGCGAGAGGTAGCGGGATTGATGCCCGCATTCTCCA
diff -r 000000000000 -r 58fe85fe08be test-data/rnaduplex_result1.txt
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnaduplex_result1.txt Tue Dec 06 12:37:10 2016 -0500
@@ -0,0 +1,3 @@
+>Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC
+>Anolis_carolinensis_chrUn_GL343207.trna3-AlaAGC
+.((((((..((......((((...((((..(((.((((((.......((((((..(..((((...(((((((.&)))))))..........))))..)..))))))..))))))..)))..)))).......)))).)))))))). 1,73 : 1,72 (-40.70)
diff -r 000000000000 -r 58fe85fe08be test-data/rnaeval_input1.dbn
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnaeval_input1.dbn Tue Dec 06 12:37:10 2016 -0500
@@ -0,0 +1,3 @@
+>Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC (218800-218872) Ala (AGC) 73 bp Sc: 49.55
+UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA
+.((((((..((((........)))).(((((.......))))).....(((((.......)))))))))))..
diff -r 000000000000 -r 58fe85fe08be test-data/rnaeval_result1.txt
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnaeval_result1.txt Tue Dec 06 12:37:10 2016 -0500
@@ -0,0 +1,3 @@
+>Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC (218800-218872) Ala (AGC) 73 bp Sc: 49.55
+UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA
+.((((((..((((........)))).(((((.......))))).....(((((.......))))))))))).. (-22.00)
diff -r 000000000000 -r 58fe85fe08be test-data/rnafold_input1.fa
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnafold_input1.fa Tue Dec 06 12:37:10 2016 -0500
@@ -0,0 +1,4 @@
+>Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC (218800-218872) Ala (AGC) 73 bp Sc: 49.55
+TGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGTGAGAGGTAGTGGGATCGATGCCCACATTCTCCA
+>Anolis_carolinensis_chrUn_GL343207.trna3-AlaAGC (1513626-1513698) Ala (AGC) 73 bp Sc: 56.15
+GGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGCGAGAGGTAGCGGGATTGATGCCCGCATTCTCCA
diff -r 000000000000 -r 58fe85fe08be test-data/rnafold_input2.fa
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnafold_input2.fa Tue Dec 06 12:37:10 2016 -0500
@@ -0,0 +1,4 @@
+>Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC (218800-218872) Ala (AGC) 73 bp Sc: 49.55
+TGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGTGAGAGGTAGTGGGATCGATGCCCACATTCTCCA
+>Anolis_carolinensis_chrUn_GL343207.trna3-AlaAGC (1513626-1513698) Ala (AGC) 73 bp Sc: 56.15
+GGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGCGAGAGGTAGCGGGATTGATGCCCGCATTCTCCA
diff -r 000000000000 -r 58fe85fe08be test-data/rnafold_result1.txt
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnafold_result1.txt Tue Dec 06 12:37:10 2016 -0500
@@ -0,0 +1,6 @@
+>Anolis_carolinensis_chrUn_GL343590.trna2-A
+UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA
+.((((((..((((........)))).(((((.......))))).....(((((.......))))))))))).. (-22.00)
+>Anolis_carolinensis_chrUn_GL343207.trna3-A
+GGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGCGAGAGGUAGCGGGAUUGAUGCCCGCAUUCUCCA
+(((((((..((((........)))).(((((.......))))).....(((((.......)))))))))))). (-29.60)
diff -r 000000000000 -r 58fe85fe08be test-data/rnafold_result2.txt
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnafold_result2.txt Tue Dec 06 12:37:10 2016 -0500
@@ -0,0 +1,6 @@
+>Anolis_carolinensis_chrUn_GL343590.trna2-A
+UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA
+..(((.....((((....((..(((....)))..))...)))).....(((((.......)))))....))). ( -3.37)
+>Anolis_carolinensis_chrUn_GL343207.trna3-A
+GGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGCGAGAGGUAGCGGGAUUGAUGCCCGCAUUCUCCA
+(((((..((.(((.....((..(((....)))..))......))).))(((((.......)))))..))))). ( -5.02)
diff -r 000000000000 -r 58fe85fe08be test-data/rnafold_result3.txt
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnafold_result3.txt Tue Dec 06 12:37:10 2016 -0500
@@ -0,0 +1,3 @@
+>Sequence
+UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA
+.((((((..((((........)))).(((((.......))))).....(((((.......))))))))))).. (-22.00)
diff -r 000000000000 -r 58fe85fe08be test-data/rnaheat_input1.fa
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnaheat_input1.fa Tue Dec 06 12:37:10 2016 -0500
@@ -0,0 +1,2 @@
+> comment 1
+UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA
diff -r 000000000000 -r 58fe85fe08be test-data/rnaheat_result1.txt
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnaheat_result1.txt Tue Dec 06 12:37:10 2016 -0500
@@ -0,0 +1,102 @@
+> comment 1
+0 0.0407267
+1 0.0435052
+2 0.0470227
+3 0.0505646
+4 0.0553391
+5 0.0603894
+6 0.0662047
+7 0.0718158
+8 0.0782007
+9 0.0863514
+10 0.0950516
+11 0.10505
+12 0.115613
+13 0.128245
+14 0.141712
+15 0.157281
+16 0.17497
+17 0.195056
+18 0.216799
+19 0.241743
+20 0.270432
+21 0.302132
+22 0.337644
+23 0.377263
+24 0.421546
+25 0.470799
+26 0.525589
+27 0.587016
+28 0.653829
+29 0.726606
+30 0.806458
+31 0.892656
+32 0.984857
+33 1.08272
+34 1.18601
+35 1.29332
+36 1.40305
+37 1.51467
+38 1.62618
+39 1.73524
+40 1.84032
+41 1.9407
+42 2.03385
+43 2.11859
+44 2.19443
+45 2.26182
+46 2.31999
+47 2.36969
+48 2.41182
+49 2.44826
+50 2.47967
+51 2.50769
+52 2.534
+53 2.55942
+54 2.5851
+55 2.61217
+56 2.64151
+57 2.67329
+58 2.70759
+59 2.74465
+60 2.78458
+61 2.8279
+62 2.8742
+63 2.92425
+64 2.97698
+65 3.03283
+66 3.09163
+67 3.15591
+68 3.23033
+69 3.3067
+70 3.38122
+71 3.45791
+72 3.54606
+73 3.63843
+74 3.73392
+75 3.83847
+76 3.94646
+77 4.05462
+78 4.16571
+79 4.28366
+80 4.39944
+81 4.50863
+82 4.61035
+83 4.70186
+84 4.78345
+85 4.85204
+86 4.90509
+87 4.9392
+88 4.95425
+89 4.95214
+90 4.93688
+91 4.91166
+92 4.87691
+93 4.8314
+94 4.78561
+95 4.75271
+96 4.71866
+97 4.66056
+98 4.57671
+99 4.48395
+100 4.39006
diff -r 000000000000 -r 58fe85fe08be test-data/rnainverse_input1.clu
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnainverse_input1.clu Tue Dec 06 12:37:10 2016 -0500
@@ -0,0 +1,2 @@
+(((((((..((((........)))).(((((.......))))).....(((((.......)))))))))))).
+gggccccnnaauunnnnnnnnaauunGGGGcnnnnnnnAAAAAnnnnnuuuuannnnnnnuaaaaggggcccn
diff -r 000000000000 -r 58fe85fe08be test-data/rnalalifold_input1.clustal
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnalalifold_input1.clustal Tue Dec 06 12:37:10 2016 -0500
@@ -0,0 +1,7 @@
+CLUSTAL 2.1 multiple sequence alignment
+
+
+Anolis_carolinensis_chrUn_GL34 TGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGTGAGAGGTAGTGGGATCGATGCCCACATTCTCCA
+Anolis_carolinensis_chrUn_GL35 GGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGCGAGAGGTAGCGGGATTGATGCCCGCATTCTCCA
+ ************************************** ************** ******* *********
+
diff -r 000000000000 -r 58fe85fe08be test-data/rnalalifold_result1.txt
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnalalifold_result1.txt Tue Dec 06 12:37:10 2016 -0500
@@ -0,0 +1,4 @@
+(((.(((((.(((((.......)))))..)).(((((.......)))))..)))))) (-19.05) 17 - 73
+((((........)))). ( -5.10) 10 - 26
+GGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGCGAGAGGUAGCGGGAUCGAUGCCCACAUUCUCCA
+
diff -r 000000000000 -r 58fe85fe08be test-data/rnalfold_input1.fa
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnalfold_input1.fa Tue Dec 06 12:37:10 2016 -0500
@@ -0,0 +1,4 @@
+>Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC (218800-218872) Ala (AGC) 73 bp Sc: 49.55
+TGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGTGAGAGGTAGTGGGATCGATGCCCACATTCTCCA
+>Anolis_carolinensis_chrUn_GL343207.trna3-AlaAGC (1513626-1513698) Ala (AGC) 73 bp Sc: 56.15
+GGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGCGAGAGGTAGCGGGATTGATGCCCGCATTCTCCA
diff -r 000000000000 -r 58fe85fe08be test-data/rnalfold_result1.txt
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnalfold_result1.txt Tue Dec 06 12:37:10 2016 -0500
@@ -0,0 +1,28 @@
+>Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC (218800-218872) Ala (AGC) 73 bp Sc: 49.55
+.((((....)))). ( -0.10) 56
+.(((..((((....)))).))). ( -3.40) 51
+.(((((.......))))). ( -7.70) 48
+.((((..(((((.......)))))..)))). (-10.30) 42
+.(((((...(((((.......))))).))))). (-11.50) 40
+.((.(((((...(((((.......))))).))))))) (-12.10) 37
+.(((((.......))))). ( -5.80) 26
+.((.(((((.......)))))..)). ( -6.70) 23
+.((((....)))). ( -3.20) 21
+.((.((((....)))).)). ( -4.70) 18
+.((((........)))). ( -5.30) 9
+.((((((..((((........)))).(((((.......))))).....(((((.......))))))))))). (-22.00) 1
+UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA
+ (-22.00)
+>Anolis_carolinensis_chrUn_GL343207.trna3-AlaAGC (1513626-1513698) Ala (AGC) 73 bp Sc: 56.15
+.(((..((((....)))).))). ( -3.40) 51
+.(((((.......))))). ( -9.20) 48
+.((((..(((((.......)))))..)))). (-11.80) 42
+.(((((...(((((.......))))).))))). (-13.30) 40
+.((.(((((...(((((.......))))).))))))) (-13.60) 37
+.(((((.......))))). ( -7.70) 26
+.((.(((((.......)))))..)). ( -8.60) 23
+.(((.(((((.(((((.......)))))..)).(((((.......)))))..)))))) (-20.00) 16
+.((((........)))). ( -5.30) 9
+(((((((..((((........)))).(((((.......))))).....(((((.......)))))))))))). (-29.60) 1
+GGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGCGAGAGGUAGCGGGAUUGAUGCCCGCAUUCUCCA
+ (-29.60)
diff -r 000000000000 -r 58fe85fe08be test-data/rnapaln_input1.fa
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnapaln_input1.fa Tue Dec 06 12:37:10 2016 -0500
@@ -0,0 +1,4 @@
+>Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC (218800-218872) Ala (AGC) 73 bp Sc: 49.55
+TGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGTGAGAGGTAGTGGGATCGATGCCCACATTCTCCA
+>Anolis_carolinensis_chrUn_GL343207.trna3-AlaAGC (1513626-1513698) Ala (AGC) 73 bp Sc: 56.15
+GGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGCGAGAGGTAGCGGGATTGATGCCCGCATTCTCCA
diff -r 000000000000 -r 58fe85fe08be test-data/rnapaln_input1.fas
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnapaln_input1.fas Tue Dec 06 12:37:10 2016 -0500
@@ -0,0 +1,1 @@
+UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA&UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA
diff -r 000000000000 -r 58fe85fe08be test-data/rnapaln_result1.txt
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnapaln_result1.txt Tue Dec 06 12:37:10 2016 -0500
@@ -0,0 +1,7 @@
+>Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC (218800-218872) Ala (AGC) 73 bp Sc: 49.55
+>Anolis_carolinensis_chrUn_GL343207.trna3-AlaAGC (1513626-1513698) Ala (AGC) 73 bp Sc: 56.15
+68.8844
+UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA
+,((((((..((((........)))).(((((.......))))).....(((((.......))))))))),)),
+GGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGCGAGAGGUAGCGGGAUUGAUGCCCGCAUUCUCCA
+(((((((..((((........)))).(((((.......))))).....(((((.......)))))))))))).
diff -r 000000000000 -r 58fe85fe08be test-data/rnapdist_input1.fa
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnapdist_input1.fa Tue Dec 06 12:37:10 2016 -0500
@@ -0,0 +1,4 @@
+>Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC (218800-218872) Ala (AGC) 73 bp Sc: 49.55
+TGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGTGAGAGGTAGTGGGATCGATGCCCACATTCTCCA
+>Anolis_carolinensis_chrUn_GL343207.trna3-AlaAGC (1513626-1513698) Ala (AGC) 73 bp Sc: 56.15
+GGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGCGAGAGGTAGCGGGATTGATGCCCGCATTCTCCA
diff -r 000000000000 -r 58fe85fe08be test-data/rnapdist_result1.txt
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnapdist_result1.txt Tue Dec 06 12:37:10 2016 -0500
@@ -0,0 +1,3 @@
+>Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC (218800-218872) Ala (AGC) 73 bp Sc: 49.55
+>Anolis_carolinensis_chrUn_GL343207.trna3-AlaAGC (1513626-1513698) Ala (AGC) 73 bp Sc: 56.15
+8.66253
diff -r 000000000000 -r 58fe85fe08be test-data/rnapkplex_input1.fa
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnapkplex_input1.fa Tue Dec 06 12:37:10 2016 -0500
@@ -0,0 +1,4 @@
+>Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC (218800-218872) Ala (AGC) 73 bp Sc: 49.55
+TGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGTGAGAGGTAGTGGGATCGATGCCCACATTCTCCA
+>Anolis_carolinensis_chrUn_GL343207.trna3-AlaAGC (1513626-1513698) Ala (AGC) 73 bp Sc: 56.15
+GGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGCGAGAGGTAGCGGGATTGATGCCCGCATTCTCCA
diff -r 000000000000 -r 58fe85fe08be test-data/rnapkplex_result1.txt
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnapkplex_result1.txt Tue Dec 06 12:37:10 2016 -0500
@@ -0,0 +1,6 @@
+>Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC (218800-218872) Ala (AGC) 73 bp Sc: 49.55
+UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA
+.((((((..((((........)))).(((((.......))))).[[[.(((((]]]....))))))))))).. (-31.90)
+>Anolis_carolinensis_chrUn_GL343207.trna3-AlaAGC (1513626-1513698) Ala (AGC) 73 bp Sc: 56.15
+GGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGCGAGAGGUAGCGGGAUUGAUGCCCGCAUUCUCCA
+(((((((..((((..[[[.[[)))).(((((.]].]]]))))).....(((((.......)))))))))))). (-38.54)
diff -r 000000000000 -r 58fe85fe08be test-data/rnaplex_input1.fa
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnaplex_input1.fa Tue Dec 06 12:37:10 2016 -0500
@@ -0,0 +1,4 @@
+>Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC (218800-218872) Ala (AGC) 73 bp Sc: 49.55
+TGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGTGAGAGGTAGTGGGATCGATGCCCACATTCTCCA
+>Anolis_carolinensis_chrUn_GL343207.trna3-AlaAGC (1513626-1513698) Ala (AGC) 73 bp Sc: 56.15
+GGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGCGAGAGGTAGCGGGATTGATGCCCGCATTCTCCA
diff -r 000000000000 -r 58fe85fe08be test-data/rnaplex_result1.txt
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnaplex_result1.txt Tue Dec 06 12:37:10 2016 -0500
@@ -0,0 +1,4 @@
+>Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC (218800-218872) Ala (AGC) 73 bp Sc: 49.55
+>Anolis_carolinensis_chrUn_GL343207.trna3-AlaAGC (1513626-1513698) Ala (AGC) 73 bp Sc: 56.15
+.((((((..((......((((...((((..(((.((((((.......((((((..(..((((...(((((((.&)))))))..........))))..)..))))))..))))))..)))..)))).......)))).)))))))). 1,73 : 1,72 (-40.70) i:72,j:1 <-41.26>
+
diff -r 000000000000 -r 58fe85fe08be test-data/rnaplfold_input1.fa
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnaplfold_input1.fa Tue Dec 06 12:37:10 2016 -0500
@@ -0,0 +1,4 @@
+>Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC (218800-218872) Ala (AGC) 73 bp Sc: 49.55
+TGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGTGAGAGGTAGTGGGATCGATGCCCACATTCTCCA
+>Anolis_carolinensis_chrUn_GL343207.trna3-AlaAGC (1513626-1513698) Ala (AGC) 73 bp Sc: 56.15
+GGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGCGAGAGGTAGCGGGATTGATGCCCGCATTCTCCA
diff -r 000000000000 -r 58fe85fe08be test-data/rnaplfold_result1.ps
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnaplfold_result1.ps Tue Dec 06 12:37:10 2016 -0500
@@ -0,0 +1,242 @@
+%!PS-Adobe-3.0 EPSF-3.0
+%%Title: RNA Dot Plot
+%%Creator: ViennaRNA-2.2.10
+%%CreationDate: Tue Oct 4 14:45:55 2016
+%%BoundingBox: 66 530 520 650
+%%DocumentFonts: Helvetica
+%%Pages: 1
+%%EndComments
+
+%Options:
+%This file contains the square roots of the base pair probabilities in the form
+% i j sqrt(p(i,j)) ubox
+
+%%BeginProlog
+/DPdict 100 dict def
+DPdict begin
+/logscale false def
+/lpmin 1e-05 log def
+
+/box { %size x y box - draws box centered on x,y
+ 2 index 0.5 mul sub % x -= 0.5
+ exch 2 index 0.5 mul sub exch % y -= 0.5
+ 3 -1 roll dup rectfill
+} bind def
+
+/ubox {
+ logscale {
+ log dup add lpmin div 1 exch sub dup 0 lt { pop 0 } if
+ } if
+ 3 1 roll
+ exch len exch sub 1 add box
+} bind def
+
+/lbox {
+ 3 1 roll
+ len exch sub 1 add box
+} bind def
+
+/drawseq {
+% print sequence along all 4 sides
+[ [0.7 -0.3 0 ]
+ [0.7 0.7 len add 0]
+ [-0.3 len sub -0.4 -90]
+ [-0.3 len sub 0.7 len add -90]
+] {
+ gsave
+ aload pop rotate translate
+ 0 1 len 1 sub {
+ dup 0 moveto
+ sequence exch 1 getinterval
+ show
+ } for
+ grestore
+ } forall
+} bind def
+
+/drawgrid{
+ 0.01 setlinewidth
+ len log 0.9 sub cvi 10 exch exp % grid spacing
+ dup 1 gt {
+ dup dup 20 div dup 2 array astore exch 40 div setdash
+ } { [0.3 0.7] 0.1 setdash } ifelse
+ 0 exch len {
+ dup dup
+ 0 moveto
+ len lineto
+ dup
+ len exch sub 0 exch moveto
+ len exch len exch sub lineto
+ stroke
+ } for
+ [] 0 setdash
+ 0.04 setlinewidth
+ currentdict /cutpoint known {
+ cutpoint 1 sub
+ dup dup -1 moveto len 1 add lineto
+ len exch sub dup
+ -1 exch moveto len 1 add exch lineto
+ stroke
+ } if
+ 0.5 neg dup translate
+} bind def
+
+end
+%%EndProlog
+DPdict begin
+%delete next line to get rid of title
+270 665 moveto /Helvetica findfont 14 scalefont setfont (Anolis_carolinensis_chrUn_GL343590.trna2-A) show
+
+/sequence { (\
+UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA\
+) } def
+/winSize 70 def
+/len { sequence length } bind def
+
+292 416 translate
+72 6 mul len 1 add winSize add 2 sqrt mul div dup scale
+/Helvetica findfont 0.95 scalefont setfont
+
+/drawseq_turn {% print sequence at bottom
+ gsave
+ len 2 sqrt div dup neg 0.28 add exch 0.78 sub translate
+ 0 1 len 1 sub {
+ dup dup 2 sqrt mul 0 moveto
+ sequence exch 1 getinterval
+ show
+ } for
+ grestore
+} bind def
+/drawgrid_turn{
+ 0.01 setlinewidth
+ len log 0.9 sub cvi 10 exch exp % grid spacing
+ dup 1 gt {
+ dup dup 20 div dup 2 array astore exch 40 div setdash
+ } { [0.3 0.7] 0.1 setdash } ifelse
+ 0 exch len { %for (0, gridspacing, len)
+ dup dup %duplicate what - gridspacing??
+ dup len exch sub moveto %moveto diagonal?
+ dup winSize gt
+ {dup dup len exch sub winSize add lineto}
+ {dup len lineto}ifelse
+ dup len exch sub moveto %moveto diagonal?
+ dup len winSize sub le
+ {dup dup len exch sub dup winSize exch sub len add exch lineto}
+ {dup dup len exch sub len exch lineto}ifelse stroke pop pop
+ } for
+ len log 0.9 sub cvi 10 exch exp % grid spacing
+ dup 1 gt {
+ dup dup 20 div dup 2 array astore exch 40 div setdash
+ } { [0.3 0.7] 0.1 setdash } ifelse
+ 0 exch len { %for (0, gridspacing, len)
+ dup dup %duplicate what - gridspacing??
+ dup len exch sub moveto %moveto diagonal?
+ len exch sub 0.7 sub exch 0.7 sub exch lineto
+ stroke
+ }for
+ winSize len moveto len winSize lineto stroke
+ [] 0 setdash
+ 0.04 setlinewidth
+ currentdict /cutpoint known {
+ cutpoint 1 sub
+ dup dup -1 moveto len 1 add lineto
+ len exch sub dup
+ -1 exch moveto len 1 add exch lineto
+ stroke
+ } if
+ 0.5 neg dup translate
+} bind def
+
+0.5 dup translate
+drawseq_turn
+45 rotate
+
+
+%draw the grid
+drawgrid_turn
+
+%start of base pair probability data
+2 70 0.1568 ubox
+2 71 0.9619 ubox
+3 69 0.1395 ubox
+3 70 0.7414 ubox
+3 72 0.8060 ubox
+4 68 0.1157 ubox
+4 69 0.6748 ubox
+4 71 0.4682 ubox
+5 67 0.1065 ubox
+5 68 0.6724 ubox
+5 70 0.3765 ubox
+6 47 0.1250 ubox
+6 67 0.6497 ubox
+7 46 0.1273 ubox
+7 66 0.6008 ubox
+8 45 0.1294 ubox
+8 48 0.2252 ubox
+9 47 0.2335 ubox
+10 25 0.7863 ubox
+11 24 0.7884 ubox
+11 43 0.5215 ubox
+11 45 0.2330 ubox
+12 23 0.7883 ubox
+12 42 0.5493 ubox
+12 44 0.2317 ubox
+13 22 0.7882 ubox
+13 41 0.5528 ubox
+13 43 0.2306 ubox
+14 40 0.5338 ubox
+15 20 0.1027 ubox
+16 38 0.5325 ubox
+16 40 0.1646 ubox
+17 37 0.5639 ubox
+17 39 0.1633 ubox
+18 36 0.5591 ubox
+18 38 0.1125 ubox
+19 36 0.2406 ubox
+20 34 0.5341 ubox
+20 35 0.2514 ubox
+21 33 0.4064 ubox
+22 32 0.2491 ubox
+22 33 0.4413 ubox
+23 32 0.5541 ubox
+24 31 0.6100 ubox
+25 30 0.6092 ubox
+26 36 0.2144 ubox
+27 35 0.2146 ubox
+27 43 0.7269 ubox
+28 34 0.2043 ubox
+28 42 0.7445 ubox
+29 41 0.7467 ubox
+30 40 0.7468 ubox
+31 39 0.7470 ubox
+38 73 0.3242 ubox
+39 72 0.3055 ubox
+40 73 0.1211 ubox
+41 71 0.2953 ubox
+41 72 0.1146 ubox
+42 70 0.2588 ubox
+43 69 0.2613 ubox
+43 71 0.2848 ubox
+44 68 0.2587 ubox
+44 70 0.3418 ubox
+45 67 0.2339 ubox
+45 68 0.1772 ubox
+45 69 0.3617 ubox
+45 70 0.1014 ubox
+45 72 0.3111 ubox
+46 67 0.2550 ubox
+46 68 0.3039 ubox
+46 69 0.1150 ubox
+46 71 0.2540 ubox
+47 66 0.2925 ubox
+48 67 0.1378 ubox
+49 65 0.9938 ubox
+50 64 0.9971 ubox
+51 63 0.9980 ubox
+52 62 0.9980 ubox
+53 61 0.9963 ubox
+54 59 0.1628 ubox
+55 60 0.1625 ubox
+showpage
+end
+%%EOF
diff -r 000000000000 -r 58fe85fe08be test-data/rnaplfold_result2.ps
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnaplfold_result2.ps Tue Dec 06 12:37:10 2016 -0500
@@ -0,0 +1,212 @@
+%!PS-Adobe-3.0 EPSF-3.0
+%%Title: RNA Dot Plot
+%%Creator: ViennaRNA-2.2.10
+%%CreationDate: Tue Oct 4 14:45:55 2016
+%%BoundingBox: 66 530 520 650
+%%DocumentFonts: Helvetica
+%%Pages: 1
+%%EndComments
+
+%Options:
+%This file contains the square roots of the base pair probabilities in the form
+% i j sqrt(p(i,j)) ubox
+
+%%BeginProlog
+/DPdict 100 dict def
+DPdict begin
+/logscale false def
+/lpmin 1e-05 log def
+
+/box { %size x y box - draws box centered on x,y
+ 2 index 0.5 mul sub % x -= 0.5
+ exch 2 index 0.5 mul sub exch % y -= 0.5
+ 3 -1 roll dup rectfill
+} bind def
+
+/ubox {
+ logscale {
+ log dup add lpmin div 1 exch sub dup 0 lt { pop 0 } if
+ } if
+ 3 1 roll
+ exch len exch sub 1 add box
+} bind def
+
+/lbox {
+ 3 1 roll
+ len exch sub 1 add box
+} bind def
+
+/drawseq {
+% print sequence along all 4 sides
+[ [0.7 -0.3 0 ]
+ [0.7 0.7 len add 0]
+ [-0.3 len sub -0.4 -90]
+ [-0.3 len sub 0.7 len add -90]
+] {
+ gsave
+ aload pop rotate translate
+ 0 1 len 1 sub {
+ dup 0 moveto
+ sequence exch 1 getinterval
+ show
+ } for
+ grestore
+ } forall
+} bind def
+
+/drawgrid{
+ 0.01 setlinewidth
+ len log 0.9 sub cvi 10 exch exp % grid spacing
+ dup 1 gt {
+ dup dup 20 div dup 2 array astore exch 40 div setdash
+ } { [0.3 0.7] 0.1 setdash } ifelse
+ 0 exch len {
+ dup dup
+ 0 moveto
+ len lineto
+ dup
+ len exch sub 0 exch moveto
+ len exch len exch sub lineto
+ stroke
+ } for
+ [] 0 setdash
+ 0.04 setlinewidth
+ currentdict /cutpoint known {
+ cutpoint 1 sub
+ dup dup -1 moveto len 1 add lineto
+ len exch sub dup
+ -1 exch moveto len 1 add exch lineto
+ stroke
+ } if
+ 0.5 neg dup translate
+} bind def
+
+end
+%%EndProlog
+DPdict begin
+%delete next line to get rid of title
+270 665 moveto /Helvetica findfont 14 scalefont setfont (Anolis_carolinensis_chrUn_GL343207.trna3-A) show
+
+/sequence { (\
+GGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGCGAGAGGUAGCGGGAUUGAUGCCCGCAUUCUCCA\
+) } def
+/winSize 70 def
+/len { sequence length } bind def
+
+292 416 translate
+72 6 mul len 1 add winSize add 2 sqrt mul div dup scale
+/Helvetica findfont 0.95 scalefont setfont
+
+/drawseq_turn {% print sequence at bottom
+ gsave
+ len 2 sqrt div dup neg 0.28 add exch 0.78 sub translate
+ 0 1 len 1 sub {
+ dup dup 2 sqrt mul 0 moveto
+ sequence exch 1 getinterval
+ show
+ } for
+ grestore
+} bind def
+/drawgrid_turn{
+ 0.01 setlinewidth
+ len log 0.9 sub cvi 10 exch exp % grid spacing
+ dup 1 gt {
+ dup dup 20 div dup 2 array astore exch 40 div setdash
+ } { [0.3 0.7] 0.1 setdash } ifelse
+ 0 exch len { %for (0, gridspacing, len)
+ dup dup %duplicate what - gridspacing??
+ dup len exch sub moveto %moveto diagonal?
+ dup winSize gt
+ {dup dup len exch sub winSize add lineto}
+ {dup len lineto}ifelse
+ dup len exch sub moveto %moveto diagonal?
+ dup len winSize sub le
+ {dup dup len exch sub dup winSize exch sub len add exch lineto}
+ {dup dup len exch sub len exch lineto}ifelse stroke pop pop
+ } for
+ len log 0.9 sub cvi 10 exch exp % grid spacing
+ dup 1 gt {
+ dup dup 20 div dup 2 array astore exch 40 div setdash
+ } { [0.3 0.7] 0.1 setdash } ifelse
+ 0 exch len { %for (0, gridspacing, len)
+ dup dup %duplicate what - gridspacing??
+ dup len exch sub moveto %moveto diagonal?
+ len exch sub 0.7 sub exch 0.7 sub exch lineto
+ stroke
+ }for
+ winSize len moveto len winSize lineto stroke
+ [] 0 setdash
+ 0.04 setlinewidth
+ currentdict /cutpoint known {
+ cutpoint 1 sub
+ dup dup -1 moveto len 1 add lineto
+ len exch sub dup
+ -1 exch moveto len 1 add exch lineto
+ stroke
+ } if
+ 0.5 neg dup translate
+} bind def
+
+0.5 dup translate
+drawseq_turn
+45 rotate
+
+
+%draw the grid
+drawgrid_turn
+
+%start of base pair probability data
+2 70 0.1914 ubox
+2 71 0.9787 ubox
+3 69 0.1660 ubox
+3 70 0.7676 ubox
+3 72 0.8449 ubox
+4 68 0.1377 ubox
+4 69 0.7113 ubox
+4 71 0.4928 ubox
+5 67 0.1266 ubox
+5 68 0.7090 ubox
+5 70 0.3955 ubox
+6 67 0.6860 ubox
+7 66 0.6345 ubox
+10 25 0.9888 ubox
+11 24 0.9915 ubox
+12 23 0.9914 ubox
+13 22 0.9913 ubox
+15 20 0.1291 ubox
+17 73 0.1217 ubox
+18 72 0.1091 ubox
+27 43 0.9522 ubox
+28 42 0.9836 ubox
+29 41 0.9874 ubox
+30 40 0.9886 ubox
+31 39 0.9883 ubox
+33 37 0.1014 ubox
+38 73 0.1170 ubox
+39 72 0.1080 ubox
+41 71 0.1523 ubox
+42 70 0.1341 ubox
+43 69 0.1387 ubox
+43 71 0.2800 ubox
+44 68 0.1392 ubox
+44 70 0.3364 ubox
+45 67 0.1266 ubox
+45 68 0.1838 ubox
+45 69 0.3586 ubox
+45 72 0.3252 ubox
+46 67 0.2524 ubox
+46 68 0.3007 ubox
+46 69 0.1142 ubox
+46 71 0.2655 ubox
+47 66 0.2807 ubox
+48 67 0.1394 ubox
+49 65 0.9981 ubox
+50 64 0.9997 ubox
+51 63 0.9997 ubox
+52 62 0.9997 ubox
+53 61 0.9981 ubox
+54 59 0.1565 ubox
+55 60 0.3242 ubox
+showpage
+end
+%%EOF
diff -r 000000000000 -r 58fe85fe08be test-data/rnaplot_input1.dbn
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnaplot_input1.dbn Tue Dec 06 12:37:10 2016 -0500
@@ -0,0 +1,3 @@
+>Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC (218800-218872) Ala (AGC) 73 bp Sc: 49.55
+UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA
+.((((((..((((........)))).(((((.......))))).....(((((.......))))))))))).. (-21.90)
diff -r 000000000000 -r 58fe85fe08be test-data/rnaplot_input1.fa
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnaplot_input1.fa Tue Dec 06 12:37:10 2016 -0500
@@ -0,0 +1,4 @@
+>Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC (218800-218872) Ala (AGC) 73 bp Sc: 49.55
+TGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGTGAGAGGTAGTGGGATCGATGCCCACATTCTCCA
+>Anolis_carolinensis_chrUn_GL343207.trna3-AlaAGC (1513626-1513698) Ala (AGC) 73 bp Sc: 56.15
+GGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGCGAGAGGTAGCGGGATTGATGCCCGCATTCTCCA
diff -r 000000000000 -r 58fe85fe08be test-data/rnasnoop_input1a.fa
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnasnoop_input1a.fa Tue Dec 06 12:37:10 2016 -0500
@@ -0,0 +1,2 @@
+>homo
+CGCGACCUCAGAUCAGACGUGGCGACCCGCUGAAUUUAAGCAUAUUAGUCAGCGGAGGAAAAGAAACUAACCAGGAUUCCCUCAGUAACGGCGAGUGAACAGGGAAGAGCCCAGCGCCGAAUCCCCGCCCCGCGGGGCGCGGGACAUGUGGCGUACGGAAGACCCGCUCCCCGGCGCCGCUCGUGGGGGGCCCAAGUCCUUCUGAUCGAGGCCCAGCCCGUGGACGGUGUGAGGCCGGUAGCGGCCGGCGCGCGCCCGGGUCUUCCCGGAGUCGGGUUGCUUGGGAAUGCAGCCCAAAGCGGGUGGUAAACUCCAUCUAAGGCUAAAUACCGGCACGAGACCGAUAGUCAACAAGUACCGUAAGGGAAAGUUGAAAAGAACUUUGAAGAGAGAGUUCAAGAGGGCGUGAAACCGUUAAGAGGUAAACGGGUGGGGUCCGCGCAGUCCGCCCGGAGGAUUCAACCCGGCGGCGGGUCCGGCCGUGUCGGCGGCCCGGCGGAUCUUUCCCGCCCCCCGUUCCUCCCGACCCCUCCACCCGCCCUCCCUUCCCCCGCCGCCCCUCCUCCUCCUCCCCGGAGGGGGCGGGCUCCGGCGGGUGCGGGGGUGGGCGGGCGGGGCCGGGGGUGGGGUCGGCGGGGGACCGUCCCCCGACCGGCGACCGGCCGCCGCCGGGCGCAUUUCCACCGCGGCGGUGCGCCGCGACCGGCUCCGGGACGGCUGGGAAGGCCCGGCGGGGAAGGUGGCUCGGGGGGCCCCGUCCGUCCGUCCGUCCUCCUCCUCCCCCGUCUCCGCCCCCCGGCCCCGCGUCCUCCCUCGGGAGGGCGCGCGGGUCGGGGCGGCGGCGGCGGCGGCGGUGGCGGCGGCGGCGGGGGCGGCGGGACCGAAACCCCCCCCGAGUGUUACAGCCCCCCCGGCAGCAGCACUCGCCGAAUCCCGGGGCCGAGGGAGCGAGACCCGUCGCCGCGCUCUCCCCCCUCCCGGCGCCCACCCCCGCGGGGAAUCCCCCGCGAGGGGGGUCUCCCCCGCGGGGGCGCGCCGGCGUCUCCUCGUGGGGGGGCCGGGCCACCCCUCCCACGGCGCGACCGCUCUCCCACCCCUCCUCCCCGCGCCCCCGCCCCGGCGACGGGGGGGGUGCCGCGCGCGGGUCGGGGGGCGGGGCGGACUGUCCCCAGUGCGCCCCGGGCGGGUCGCGCCGUCGGGCCCGGGGGAGGUUCUCUCGGGGCCACGCGCGCGUCCCCCGAAGAGGGGGACGGCGGAGCGAGCGCACGGGGUCGGCGGCGACGUCGGCUACCCACCCGACCCGUCUUGAAACACGGACCAAGGAGUCUAACACGUGCGCGAGUCGGGGGCUCGCACGAAAGCCGCCGUGGCGCAAUGAAGGUGAAGGCCGGCGCGCUCGCCGGCCGAGGUGGGAUCCCGAGGCCUCUCCAGUCCGCCGAGGGCGCACCACCGGCCCGUCUCGCCCGCCGCGCCGGGGAGGUGGAGCACGAGCGCACGUGUUAGGACCCGAAAGAUGGUGAACUAUGCCUGGGCAGGGCGAAGCCAGAGGAAACUCUGGUGGAGGUCCGUAGCGGUCCUGACGUGCAAAUCGGUCGUCCGACCUGGGUAUAGGGGCGAAAGACUAAUCGAACCAUCUAGUAGCUGGUUCCCUCCGAAGUUUCCCUCAGGAUAGCUGGCGCUCUCGCAGACCCGACGCACCCCCGCCACGCAGUUUUAUCCGGUAAAGCGAAUGAUUAGAGGUCUUGGGGCCGAAACGAUCUCAACCUAUUCUCAAACUUUAAAUGGGUAAGAAGCCCGGCUCGCUGGCGUGGAGCCGGGCGUGGAAUGCGAGUGCCUAGUGGGCCACUUUUGGUAAGCAGAACUGGCGCUGCGGGAUGAACCGAACGCCGGGUUAAGGCGCCCGAUGCCGACGCUCAUCAGACCCCAGAAAAGGUGUUGGUUGAUAUAGACAGCAGGACGGUGGCCAUGGAAGUCGGAAUCCGCUAAGGAGUGUGUAACAACUCACCUGCCGAAUCAACUAGCCCUGAAAAUGGAUGGCGCUGGAGCGUCGGGCCCAUACCCGGCCGUCGCCGGCAGUCGAGAGUGGACGGGAGCGGCGGGGGCGGCGCGCGCGCGCGCGCGUGUGGUGUGCGUCGGAGGGCGGCGGCGGCGGCGGCGGCGGGGGUGUGGGGUCCUUCCCCCGCCCCCCCCCCCACGCCUCCUCCCCUCCUCCCGCCCACGCCCCGCUCCCCGCCCCCGGAGCCCCGCGGACGCUACGCCGCGACGAGUAGGAGGGCCGCUGCGGUGAGCCUUGAAGCCUAGGGCGCGGGCCCGGGUGGAGCCGCCGCAGGUGCAGAUCUUGGUGGUAGUAGCAAAUAUUCAAACGAGAACUUUGAAGGCCGAAGUGGAGAAGGGUUCCAUGUGAACAGCAGUUGAACAUGGGUCAGUCGGUCCUGAGAGAUGGGCGAGCGCCGUUCCGAAGGGACGGGCGAUGGCCUCCGUUGCCCUCGGCCGAUCGAAAGGGAGUCGGGUUCAGAUCCCCGAAUCCGGAGUGGCGGAGAUGGGCGCCGCGAGGCGUCCAGUGCGGUAACGCGACCGAUCCCGGAGAAGCCGGCGGGAGCCCCGGGGAGAGUUCUCUUUUCUUUGUGAAGGGCAGGGCGCCCUGGAAUGGGUUCGCCCCGAGAGAGGGGCCCGUGCCUUGGAAAGCGUCGCGGUUCCGGCGGCGUCCGGUGAGCUCUCGCUGGCCCUUGAAAAUCCGGGGGAGAGGGUGUAAAUCUCGCGCCGGGCCGUACCCAUAUCCGCAGCAGGUCUCCAAGGUGAACAGCCUCUGGCAUGUUGGAACAAUGUAGGUAAGGGAAGUCGGCAAGCCGGAUCCGUAACUUCGGGAUAAGGAUUGGCUCUAAGGGCUGGGUCGGUCGGGCUGGGGCGCGAAGCGGGGCUGGGCGCGCGCCGCGGCUGGACGAGGCGCGCGCCCCCCCCACGCCCGGGGCACCCCCCUCGCGGCCCUCCCCCGCCCCACCCGCGCGCGCCGCUCGCUCCCUCCCCACCCCGCGCCCUCUCUCUCUCUCUCUCCCCCGCUCCCCGUCCUCCCCCCUCCCCGGGGGAGCGCCGCGUGGGGGCGCGGCGGGGGGAGAAGGGUCGGGGCGGCAGGGGCCGCGCGGCGGCCGCCGGGGCGGCCGGCGGGGGCAGGUCCCCGCGAGGGGGGCCCCGGGGACCCGGGGGGCCGGCGGCGGCGCGGACUCUGGACGCGAGCCGGGCCCUUCCCGUGGAUCGCCCCAGCUGCGGCGGGCGUCGCGGCCGCCCCCGGGGAGCCCGGCGGCGGCGCGGCGCGCCCCCCACCCCCACCCCACGUCUCGGUCGCGCGCGCGUCCGCUGGGGGCGGGAGCGGUCGGGCGGCGGCGGUCGGCGGGCGGCGGGGCGGGGCGGUUCGUCCCCCCGCCCUACCCCCCCGGCCCCGUCCGCCCCCCGUUCCCCCCUCCUCCUCGGCGCGCGGCGGCGGCGGCGGCAGGCGGCGGAGGGGCCGCGGGCCGGUCCCCCCCGCCGGGUCCGCCCCCGGGGCCGCGGUUCCGCGCGCGCCUCGCCUCGGCCGGCGCCUAGCAGCCGACUUAGAACUGGUGCGGACCAGGGGAAUCCGACUGUUUAAUUAAAACAAAGCAUCGCGAAGGCCCGCGGCGGGUGUUGACGCGAUGUGAUUUCUGCCCAGUGCUCUGAAUGUCAAAGUGAAGAAAUUCAAUGAAGCGCGGGUAAACGGCGGGAGUAACUAUGACUCUCUUAAGGUAGCCAAAUGCCUCGUCAUCUAAUUAGUGACGCGCAUGAAUGGAUGAACGAGAUUCCCACUGUCCCUACCUACUAUCCAGCGAAACCACAGCCAAGGGAACGGGCUUGGCGGAAUCAGCGGGGAAAGAAGACCCUGUUGAGCUUGACUCUAGUCUGGCACGGUGAAGAGACAUGAGAGGUGUAGAAUAAGUGGGAGGCCCCCGGCGCCCCCCCGGUGUCCCCGCGAGGGGCCCGGGGCGGGGUCCGCGGCCCUGCGGGCCGCCGGUGAAAUACCACUACUCUGAUCGUUUUUUCACUGACCCGGUGAGGCGGGGGGGCGAGCCCGAGGGGCUCUCGCUUCUGGCGCCAAGCGCCCGCCCGGCCGGGCGCGACCCGCUCCGGGGACAGUGCCAGGUGGGGAGUUUGACUGGGGCGGUACACCUGUCAAACGGUAACGCAGGUGUCCUAAGGCGAGCUCAGGGAGGACAGAAACCUCCCGUGGAGCAGAAGGGCAAAAGCUCGCUUGAUCUUGAUUUUCAGUACGAAUACAGACCGUGAAAGCGGGGCCUCACGAUCCUUCUGACCUUUUGGGUUUUAAGCAGGAGGUGUCAGAAAAGUUACCACAGGGAUAACUGGCUUGUGGCGGCCAAGCGUUCAUAGCGACGUCGCUUUUUGAUCCUUCGAUGUCGGCUCUUCCUAUCAUUGUGAAGCAGAAUUCGCCAAGCGUUGGAUUGUUCACCCACUAAUAGGGAACGUGAGCUGGGUUUAGACCGUCGUGAGACAGGUUAGUUUUACCCUACUGAUGAUGUGUUGUUGCCAUGGUAAUCCUGCUCAGUACGAGAGGAACCGCAGGUUCAGACAUUUGGUGUAUGUGCUUGGCUGAGGAGCCAAUGGGGCGAAGCUACCAUCUGUGGGAUUAUGACUGAACGCCUCUAAGUCAGAAUCCCGCCCAGGCGAACGAUACGGCAGCGCCGCGGAGCCUCGGUUGGCCUCGGAUAGCCGGUCCCCCGCCUGUCCCCGCCGGCGGGCCGCCCCCCCCUCCACGCGCCCCGCCGCGGGAGGGCGCGUGCCCCGCCGCGCGCCGGGACCGGGGUCCGGUGCGGAGUGCCCUUCGUCCUGGGAAACGGGGCGCGGCCGGAAAGGCGGCCGCCCCCUCGCCCGUCACGCACCGCACGUUCGUGGGGAACCUGGCGCUAAACCAUUCGUAGACGACCUGCUUCUGGGUCGGGGUUUCGUACGUAGCAGAGCAGCUCCCUCGCUGCGAUCUAUUGAAAGUCAGCCCUCGACACAAGGGUUUGUC
diff -r 000000000000 -r 58fe85fe08be test-data/rnasnoop_input1b.fa
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnasnoop_input1b.fa Tue Dec 06 12:37:10 2016 -0500
@@ -0,0 +1,2 @@
+>ACA51
+AACCTACCCCATATACACCTCAGCTCAGGCCCTGTGCCTGGTCTGTATTGTGAATGGGGGAACATAG
diff -r 000000000000 -r 58fe85fe08be test-data/rnasnoop_result1.txt
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnasnoop_result1.txt Tue Dec 06 12:37:10 2016 -0500
@@ -0,0 +1,4 @@
+>ACA51
+>homo
+<<<<<.<<<<.|.<<.<<<&...(((>>>.>>.((((...............................))))..>>>>.>>>>>))) 4468,4486;4479 : 8,65 (-35.60 = -16.10 + -7.60 + -12.40 + -3.60 + 4.1 ) (-23.60)
+UGUUCACCCACUAAUAGGG&AACCUACCCCAUAUACACCUCAGCUCAGGCCCUGUGCCUGGUCUGUAUUGUGAAUGGGGGAACAUAG
diff -r 000000000000 -r 58fe85fe08be test-data/rnasubopt_input1.fa
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnasubopt_input1.fa Tue Dec 06 12:37:10 2016 -0500
@@ -0,0 +1,4 @@
+>Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC (218800-218872) Ala (AGC) 73 bp Sc: 49.55
+TGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGTGAGAGGTAGTGGGATCGATGCCCACATTCTCCA
+>Anolis_carolinensis_chrUn_GL343207.trna3-AlaAGC (1513626-1513698) Ala (AGC) 73 bp Sc: 56.15
+GGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGCGAGAGGTAGCGGGATTGATGCCCGCATTCTCCA
diff -r 000000000000 -r 58fe85fe08be test-data/rnasubopt_result1.txt
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnasubopt_result1.txt Tue Dec 06 12:37:10 2016 -0500
@@ -0,0 +1,7 @@
+>Anolis_carolinensis_chrUn_GL343590.trna2-A [0]
+UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA -22.00 0.00
+(((((((..((((........)))).(((((.......))))).....(((((.......))))))))).))) -22.00
+.((((((..((((........)))).(((((.......))))).....(((((.......))))))))))).. -22.00
+>Anolis_carolinensis_chrUn_GL343207.trna3-A [0]
+GGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGCGAGAGGUAGCGGGAUUGAUGCCCGCAUUCUCCA -29.60 0.00
+(((((((..((((........)))).(((((.......))))).....(((((.......)))))))))))). -29.60
diff -r 000000000000 -r 58fe85fe08be test-data/rnaup_input1.fa
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnaup_input1.fa Tue Dec 06 12:37:10 2016 -0500
@@ -0,0 +1,4 @@
+>Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC (218800-218872) Ala (AGC) 73 bp Sc: 49.55
+TGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGTGAGAGGTAGTGGGATCGATGCCCACATTCTCCA
+>Anolis_carolinensis_chrUn_GL343207.trna3-AlaAGC (1513626-1513698) Ala (AGC) 73 bp Sc: 56.15
+GGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGCGAGAGGTAGCGGGATTGATGCCCGCATTCTCCA
diff -r 000000000000 -r 58fe85fe08be test-data/rnaup_result1.txt
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnaup_result1.txt Tue Dec 06 12:37:10 2016 -0500
@@ -0,0 +1,6 @@
+>Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC
+ 55, 58 (0.019) for u= 4
+RNAup output in file: Anolis_carolinensis_chrUn_GL343590.trna2-A_u1.out
+>Anolis_carolinensis_chrUn_GL343207.trna3-AlaAGC
+ 16, 19 (0.004) for u= 4
+RNAup output in file: Anolis_carolinensis_chrUn_GL343207.trna3-A_u1.out
diff -r 000000000000 -r 58fe85fe08be vienna_rna.tar.gz
Binary file vienna_rna.tar.gz has changed
]