--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/Anolis_caro_chrUn_GL343207.trna3_AlaAGC_ss.ps	Wed Dec 20 08:34:12 2017 -0500
@@ -0,0 +1,231 @@
+%!PS-Adobe-3.0 EPSF-3.0
+%%Creator: ViennaRNA-2.2.10
+%%CreationDate: Tue Dec 19 19:42:58 2017
+%%Title: RNA Secondary Structure Plot
+%%BoundingBox: 66 210 518 662
+%%DocumentFonts: Helvetica
+%%Pages: 1
+%%EndComments
+
+%Options: 
+% to switch off outline pairs of sequence comment or
+% delete the appropriate line near the end of the file
+
+%%BeginProlog
+/RNAplot 100 dict def
+RNAplot begin
+/fsize  14 def
+/outlinecolor {0.2 setgray} bind def
+/paircolor    {0.2 setgray} bind def
+/seqcolor     {0   setgray} bind def
+/cshow  { dup stringwidth pop -2 div fsize -3 div rmoveto show} bind def
+/min { 2 copy gt { exch } if pop } bind def
+/max { 2 copy lt { exch } if pop } bind def
+/arccoords { % i j arccoords
+  % puts optimal x1 y1 x2 y2 coordinates used in bezier curves from i to j
+  % onto the stack
+  dup 3 -1 roll dup 4 -1 roll lt dup dup 5 2 roll {exch} if
+  dup 3 -1 roll dup 3 -1 roll exch sub 1 sub dup
+  4 -2 roll 5 -1 roll {exch} if 4 2 roll
+  sequence length dup 2 div exch 3 1 roll lt 
+  {exch 5 -1 roll pop 4 -2 roll exch 4 2 roll}
+  { 4 2 roll 5 -1 roll dup 6 1 roll {exch} if
+    4 -2 roll exch pop dup 3 -1 roll dup 4 1 roll
+    exch add 4 -1 roll dup 5 1 roll sub 1 sub
+    5 -1 roll not {4 -2 roll exch 4 2 roll} if
+  }ifelse
+   % compute the scalingfactor and prepare (1-sf) and sf*r
+  2 mul exch cpr 3 1 roll div dup
+  3 -1 roll mul exch 1 exch sub exch
+   % compute the coordinates
+  3 -1 roll 1 sub coor exch get aload pop % get coord for i
+  4 -1 roll dup 5 1 roll mul 3 -1 roll dup 4 1 roll add exch % calculate y1
+  4 -1 roll dup 5 1 roll mul 3 -1 roll dup 4 1 roll add exch % calculate x1
+  5 -1 roll 1 sub coor exch get aload pop % get coord for j
+  % duplicate j coord
+  dup 3 -1 roll dup 4 1 roll exch 8 2 roll
+  6 -1 roll dup 7 1 roll mul 5 -1 roll dup 6 1 roll add exch % calculate y2
+  6 -1 roll mul 5 -1 roll add exch % calculate x2
+  6 -2 roll % reorder
+} bind def
+/drawoutline {
+  gsave outlinecolor newpath
+  coor 0 get aload pop 0.8 0 360 arc % draw 5' circle of 1st sequence
+  currentdict /cutpoint known        % check if cutpoint is defined
+  {coor 0 cutpoint getinterval
+   {aload pop lineto} forall         % draw outline of 1st sequence
+   coor cutpoint 1 add get aload pop
+   2 copy moveto 0.8 0 360 arc       % draw 5' circle of 2nd sequence
+   coor cutpoint 1 add coor length cutpoint 1 add sub getinterval
+   {aload pop lineto} forall}        % draw outline of 2nd sequence
+  {coor {aload pop lineto} forall}   % draw outline as a whole
+  ifelse
+  stroke grestore
+} bind def
+/drawpairs {
+  paircolor
+  0.7 setlinewidth
+  [9 3.01] 9 setdash
+  newpath
+  pairs {aload pop
+      currentdict (cpr) known
+      { exch dup
+        coor  exch 1 sub get aload pop moveto
+        exch arccoords curveto
+      }
+      { coor exch 1 sub get aload pop moveto
+        coor exch 1 sub get aload pop lineto
+      }ifelse
+  } forall
+  stroke
+} bind def
+% draw bases
+/drawbases {
+  [] 0 setdash
+  seqcolor
+  0
+  coor {
+    aload pop moveto
+    dup sequence exch 1 getinterval cshow
+    1 add
+  } forall
+  pop
+} bind def
+
+/init {
+  /Helvetica findfont fsize scalefont setfont
+  1 setlinejoin
+  1 setlinecap
+  0.8 setlinewidth
+  72 216 translate
+  % find the coordinate range
+  /xmax -1000 def /xmin 10000 def
+  /ymax -1000 def /ymin 10000 def
+  coor {
+      aload pop
+      dup ymin lt {dup /ymin exch def} if
+      dup ymax gt {/ymax exch def} {pop} ifelse
+      dup xmin lt {dup /xmin exch def} if
+      dup xmax gt {/xmax exch def} {pop} ifelse
+  } forall
+  /size {xmax xmin sub ymax ymin sub max} bind def
+  72 6 mul size div dup scale
+  size xmin sub xmax sub 2 div size ymin sub ymax sub 2 div
+  translate
+} bind def
+end
+%%EndProlog
+RNAplot begin
+% data start here
+/sequence (\
+GGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGCGAGAGGUAGCGGGAUUGAUGCCCGCAUUCUCCA\
+) def
+/coor [
+[111.04756165 225.82804871]
+[110.41094971 210.84155273]
+[109.77433014 195.85507202]
+[109.13771057 180.86859131]
+[108.50109100 165.88211060]
+[107.86447144 150.89561462]
+[107.22785950 135.90913391]
+[90.28739166 133.48460388]
+[77.11851501 123.91786957]
+[70.32070923 110.05319977]
+[55.37474823 111.32528687]
+[40.42878342 112.59737396]
+[25.48282242 113.86946106]
+[17.57515907 127.22043610]
+[3.31690264 133.34266663]
+[-11.80935574 129.88204956]
+[-21.98726082 118.16923523]
+[-23.30319977 102.70806122]
+[-15.25116920 89.44365692]
+[-0.92733771 83.47645569]
+[14.16048908 87.10096741]
+[24.21073341 98.92350006]
+[39.15669632 97.65141296]
+[54.10265732 96.37932587]
+[69.04862213 95.10723114]
+[75.20735168 80.83619690]
+[87.46604156 71.28019714]
+[84.93103027 56.49596024]
+[82.39601898 41.71172333]
+[79.86100006 26.92748451]
+[77.32598877 12.14324570]
+[63.73017883 4.41744947]
+[58.32971573 -10.25800610]
+[63.67453384 -24.95381927]
+[77.24097443 -32.73107910]
+[92.62337494 -29.91759682]
+[102.55863953 -17.84181786]
+[102.35564423 -2.20555139]
+[92.11022949 9.60823345]
+[94.64524078 24.39247131]
+[97.18025208 39.17671204]
+[99.71526337 53.96094894]
+[102.25028229 68.74518585]
+[111.61898041 69.95008087]
+[120.45154572 73.97383881]
+[127.89853668 80.59681702]
+[133.19635010 89.34370422]
+[135.74378967 99.51597595]
+[135.16680908 110.24712372]
+[150.04531860 112.15238953]
+[164.92382812 114.05766296]
+[179.80232239 115.96292877]
+[194.68083191 117.86819458]
+[206.04914856 107.13062286]
+[221.66270447 106.26418304]
+[234.14927673 115.67798615]
+[237.61306763 130.92712402]
+[230.41859436 144.81141663]
+[215.96286011 150.77513123]
+[201.07142639 146.00236511]
+[192.77557373 132.74670410]
+[177.89706421 130.84143066]
+[163.01855469 128.93617249]
+[148.14004517 127.03089905]
+[133.26153564 125.12563324]
+[122.21434021 135.27252197]
+[122.85095978 150.25900269]
+[123.48757935 165.24548340]
+[124.12419128 180.23197937]
+[124.76081085 195.21846008]
+[125.39743042 210.20494080]
+[126.03404999 225.19142151]
+[129.04023743 244.33856201]
+] def
+/pairs [
+[1 72]
+[2 71]
+[3 70]
+[4 69]
+[5 68]
+[6 67]
+[7 66]
+[10 25]
+[11 24]
+[12 23]
+[13 22]
+[27 43]
+[28 42]
+[29 41]
+[30 40]
+[31 39]
+[49 65]
+[50 64]
+[51 63]
+[52 62]
+[53 61]
+] def
+
+init
+
+% switch off outline pairs or bases by removing these lines
+drawoutline
+drawpairs
+drawbases
+% show it
+showpage
+end
+%%EOF