--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnaplfold_result2.ps	Tue Dec 06 12:34:24 2016 -0500
@@ -0,0 +1,212 @@
+%!PS-Adobe-3.0 EPSF-3.0
+%%Title: RNA Dot Plot
+%%Creator: ViennaRNA-2.2.10
+%%CreationDate: Tue Oct  4 14:45:55 2016
+%%BoundingBox: 66 530 520 650
+%%DocumentFonts: Helvetica
+%%Pages: 1
+%%EndComments
+
+%Options: 
+%This file contains the square roots of the base pair probabilities in the form
+% i  j  sqrt(p(i,j)) ubox
+
+%%BeginProlog
+/DPdict 100 dict def
+DPdict begin
+/logscale false def
+/lpmin 1e-05 log def
+
+/box { %size x y box - draws box centered on x,y
+   2 index 0.5 mul sub            % x -= 0.5
+   exch 2 index 0.5 mul sub exch  % y -= 0.5
+   3 -1 roll dup rectfill
+} bind def
+
+/ubox {
+   logscale {
+      log dup add lpmin div 1 exch sub dup 0 lt { pop 0 } if
+   } if
+   3 1 roll
+   exch len exch sub 1 add box
+} bind def
+
+/lbox {
+   3 1 roll
+   len exch sub 1 add box
+} bind def
+
+/drawseq {
+% print sequence along all 4 sides
+[ [0.7 -0.3 0 ]
+  [0.7 0.7 len add 0]
+  [-0.3 len sub -0.4 -90]
+  [-0.3 len sub 0.7 len add -90]
+] {
+   gsave
+    aload pop rotate translate
+    0 1 len 1 sub {
+     dup 0 moveto
+     sequence exch 1 getinterval
+     show
+    } for
+   grestore
+  } forall
+} bind def
+
+/drawgrid{
+  0.01 setlinewidth
+  len log 0.9 sub cvi 10 exch exp  % grid spacing
+  dup 1 gt {
+     dup dup 20 div dup 2 array astore exch 40 div setdash
+  } { [0.3 0.7] 0.1 setdash } ifelse
+  0 exch len {
+     dup dup
+     0 moveto
+     len lineto
+     dup
+     len exch sub 0 exch moveto
+     len exch len exch sub lineto
+     stroke
+  } for
+  [] 0 setdash
+  0.04 setlinewidth
+  currentdict /cutpoint known {
+    cutpoint 1 sub
+    dup dup -1 moveto len 1 add lineto
+    len exch sub dup
+    -1 exch moveto len 1 add exch lineto
+    stroke
+  } if
+  0.5 neg dup translate
+} bind def
+
+end
+%%EndProlog
+DPdict begin
+%delete next line to get rid of title
+270 665 moveto /Helvetica findfont 14 scalefont setfont (Anolis_carolinensis_chrUn_GL343207.trna3-A) show
+
+/sequence { (\
+GGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGCGAGAGGUAGCGGGAUUGAUGCCCGCAUUCUCCA\
+) } def
+/winSize 70 def
+/len { sequence length } bind def
+
+292 416 translate
+72 6 mul len 1 add winSize add 2 sqrt mul div dup scale
+/Helvetica findfont 0.95 scalefont setfont
+
+/drawseq_turn {% print sequence at bottom
+   gsave
+   len 2 sqrt div dup neg 0.28 add exch 0.78 sub translate
+    0 1 len 1 sub {
+     dup dup 2 sqrt mul 0 moveto
+     sequence exch 1 getinterval
+     show
+    } for
+   grestore
+} bind def
+/drawgrid_turn{
+  0.01 setlinewidth
+  len log 0.9 sub cvi 10 exch exp  % grid spacing
+  dup 1 gt {
+     dup dup 20 div dup 2 array astore exch 40 div setdash
+  } { [0.3 0.7] 0.1 setdash } ifelse
+  0 exch len {    %for (0, gridspacing, len) 
+     dup dup      %duplicate what - gridspacing??
+     dup len exch sub moveto     %moveto diagonal?
+     dup winSize gt
+     {dup dup len exch sub winSize add lineto}
+     {dup len lineto}ifelse
+     dup len exch sub moveto  %moveto diagonal?
+     dup len winSize sub le
+     {dup dup len exch sub dup winSize exch sub len add exch lineto}
+     {dup dup len exch sub len exch lineto}ifelse     stroke pop pop
+  } for
+  len log 0.9 sub cvi 10 exch exp  % grid spacing
+      dup 1 gt {
+          dup dup 20 div dup 2 array astore exch 40 div setdash
+      } { [0.3 0.7] 0.1 setdash } ifelse
+      0 exch len {    %for (0, gridspacing, len) 
+     dup dup      %duplicate what - gridspacing??
+     dup len exch sub moveto     %moveto diagonal?
+     len exch sub 0.7 sub exch 0.7 sub exch lineto
+     stroke
+   }for
+ winSize len moveto  len winSize  lineto stroke
+  [] 0 setdash
+  0.04 setlinewidth 
+  currentdict /cutpoint known {
+    cutpoint 1 sub
+    dup dup -1 moveto len 1 add lineto
+    len exch sub dup
+    -1 exch moveto len 1 add exch lineto
+   stroke
+  } if
+  0.5 neg dup translate
+} bind def 
+
+0.5 dup translate
+drawseq_turn
+45 rotate
+
+
+%draw the grid
+drawgrid_turn
+
+%start of base pair probability data
+2 70 0.1914 ubox
+2 71 0.9787 ubox
+3 69 0.1660 ubox
+3 70 0.7676 ubox
+3 72 0.8449 ubox
+4 68 0.1377 ubox
+4 69 0.7113 ubox
+4 71 0.4928 ubox
+5 67 0.1266 ubox
+5 68 0.7090 ubox
+5 70 0.3955 ubox
+6 67 0.6860 ubox
+7 66 0.6345 ubox
+10 25 0.9888 ubox
+11 24 0.9915 ubox
+12 23 0.9914 ubox
+13 22 0.9913 ubox
+15 20 0.1291 ubox
+17 73 0.1217 ubox
+18 72 0.1091 ubox
+27 43 0.9522 ubox
+28 42 0.9836 ubox
+29 41 0.9874 ubox
+30 40 0.9886 ubox
+31 39 0.9883 ubox
+33 37 0.1014 ubox
+38 73 0.1170 ubox
+39 72 0.1080 ubox
+41 71 0.1523 ubox
+42 70 0.1341 ubox
+43 69 0.1387 ubox
+43 71 0.2800 ubox
+44 68 0.1392 ubox
+44 70 0.3364 ubox
+45 67 0.1266 ubox
+45 68 0.1838 ubox
+45 69 0.3586 ubox
+45 72 0.3252 ubox
+46 67 0.2524 ubox
+46 68 0.3007 ubox
+46 69 0.1142 ubox
+46 71 0.2655 ubox
+47 66 0.2807 ubox
+48 67 0.1394 ubox
+49 65 0.9981 ubox
+50 64 0.9997 ubox
+51 63 0.9997 ubox
+52 62 0.9997 ubox
+53 61 0.9981 ubox
+54 59 0.1565 ubox
+55 60 0.3242 ubox
+showpage
+end
+%%EOF