Mercurial > repos > ryanmorin > nextgen_variant_identification
changeset 0:74f5ea818cea
Uploaded
line wrap: on
line diff
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/SNV/README Wed Oct 12 19:50:38 2011 -0400 @@ -0,0 +1,28 @@ +Various Galaxy tools for running SNVMix and filtering/annotating the SNVMix output files + +Installation +------------ + +1) Place these files in $GALAXY_HOME/tools +2) Modify your configuration files appropriately, for example, add the tools to $GALAXY_HOME/tool_conf.xml (under the NGS analysis section, create a "variant calling" section) + +Requirements +------------ +1) SNP list (can be user-provided), an example for hg18 is provided at the FTP site below +2) Codon-lookup table (used for annotation), an example based on Ensembl 54 and hg18 is also provided at the FTP site provided + +ftp://ftp03.bcgsc.ca/public/rmorin/resources/ +(also see README.txt in that directory) + +3) SNVMix binary version 0.12.* or later (source can be downloaded at the link provided) +-follow installation instructions and put SNVMix2 binary in a location on the galaxy user's PATH + +http://compbio.bccrc.ca/?page_id=204 + +Contacts: +Rodrigo Goya for problems with SNVMix2 binary +rgoya@bcgsc.ca + +Ryan Morin for other problems +rmorin@bcgsc.ca +
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/SNV/SNVMix2_source/SNVMix2-v0.12.1-rc1/CHANGELOG Wed Oct 12 19:50:38 2011 -0400 @@ -0,0 +1,65 @@ +//v0.12.1-rc1 +Added BAM file reading + +//v0.11.8 +Nov, 2009 +Added -M option to read alpha, beta and delta from a space separated text file + alpha 1 2 3 + beta 1 2 3 + delta 1 2 3 + +Added alpha, beta and delta command line parameters. + +BUGFIX: a variable was not being initialized in readModel() which caused segmentation faults randomly. + +//v0.11.7 +29 October, 2009 +Changed behaviour of SNVmix1 mode to allow map quality filtering, this was previously done at MAQ's pileup +generation which samtools does not support. + +-t SNVMix1 will now threshold on -q BASEQ and -Q MAPQ , consider the passing qualities to be perfect. + +The default values for -q and -Q were changed to more reasonable levels anything Q19 and below is ignored +unless the user provides -q and -Q values. + +//v0.11.5 +16 September, 2009 +rgoya: changed some type definitions from int to unsigned/signed chars, less memory footprint when training + +//v0.11.4 +16 September, 2009 +rgoya: Added checks and perrors in some malloc that were missing it + +//v0.11.3 +15 September, 2009 +rgoya: Added SNVMix1 functionality with '-t SNVMix1' + +//v0.11.2 +24 July, 2009 +rgoya: Fixed a bug that would crash when encountering undercase 'n' as base call in new pileups + +21 July, 2009 +// v0.11.1 +rgoya: Fixed a bug that would reset qualitiy settings '-Q' and '-q' to zero if they were specified before '-t', + specifying -t before -Q and -q (as was used when testing) had no adverse effects. + +16 July, 2009 +// v0.11 +rgoya: Modified train (-T) functionality to check for convergence instead of just continuing for max-iter + +Output was changed to include coverage +// v0.10 +rgoya: Dependency on getline() only for linux, when compiled in MacOSX it uses fgetln() + Depends on gcc defining either: __linux__ or __APPLE__ + +June 2009 +// v0.8 +rgoya: This version of SNVMix2 depends on GNU libraries for function getline(), thus libc >= 4.6.27 is needed. + This dependency will be fixed in the future. + +// +Rodrigo Goya, 2009 +rgoya@bcgsc.ca + +Sohrab Shah, 2009 +sshah@bccrc.ca
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/SNV/SNVMix2_source/SNVMix2-v0.12.1-rc1/Makefile Wed Oct 12 19:50:38 2011 -0400 @@ -0,0 +1,17 @@ +all: SNVMix2-devel + +SNVMix2-devel.o: SNVMix2.c SNVMix2.h + gcc -O2 -Isamtools-0.1.6/ -o SNVMix2-devel.o -c SNVMix2.c -funroll-loops + +SNVMix2-devel: SNVMix2-devel.o $(LOBJS) + gcc -O2 -Isamtools-0.1.6/ -Lsamtools-0.1.6/ -lbam -lm -lz SNVMix2-devel.o $(LOBJS) -o SNVMix2-devel + + +clean: + rm -f SNVMix2-devel SNVMix2-devel.o + + +LOBJS= samtools-0.1.6/bgzf.o samtools-0.1.6/kstring.o samtools-0.1.6/bam_aux.o samtools-0.1.6/bam.o samtools-0.1.6/bam_import.o samtools-0.1.6/sam.o samtools-0.1.6/bam_index.o\ + samtools-0.1.6/bam_pileup.o samtools-0.1.6/bam_lpileup.o samtools-0.1.6/bam_md.o samtools-0.1.6/glf.o samtools-0.1.6/razf.o samtools-0.1.6/faidx.o samtools-0.1.6/knetfile.o\ + samtools-0.1.6/bam_sort.o +
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/SNV/SNVMix2_source/SNVMix2-v0.12.1-rc1/README Wed Oct 12 19:50:38 2011 -0400 @@ -0,0 +1,70 @@ +*** SNVMix2 *** + +This version of SNVMix2 has has been tested under Linux and Mac OS X. + +To build: + +> unzip -x ../SNVMix2-v{VERSION}.zip +> cd SNVmix2-v{VERSION}/ +> make + +Binary file is called "SNVMix2", for help run with -h flag + +> ./SNVMix2 -h + +You can copy that file to a preferred location. + +SNVMix2 defaults to reading from standard input if flag '-i' is not specified, +so you can use it in pipe mode next to a MAQ or samtools pileup command, saving +storage space. Same applies for standard output and the "-o" flag while Classifying. + +Parameter '-m <file>' is used to read the model parameters when Classifying (-C) +or write them in Train mode (-T) + +Different models for base and mapping qualities are available using the "-t" flag, +SNVMix1 mode can be accessed by selecting "-t SNVMix1" + +Pileup file should be generated with base and mapping qualities but without consensus, +such as the one obtained when running, with samtools-0.1.4: + samtools pileup -s -l <in_list.txt> -f <ref.fa> <in.bam> + +or with maq-0.7.0: + maq pileup -v <ref.bfa> <in.map> + + +A perl script is provided to filter SNVMix2 result according to a specified +threshold, help on this script can be found running: + +> ./misc/snvmix2summary.pl -h + +This script can filter candidate SNVs using two methods specified by the '-c <TYPE>' +flag: + +'-c 2' Will consider only two classes, either homozygote for the reference allele + ( p(AA) ) or not ( p(AB) + p(BB) ) + +'-c 3' Will consider the three clases p(AA), p(AB), p(BB) separately + + +The output still still retains the unmodified probability values, so p_AB can still +be distinguished from p_BB in case '-c 2' is used. + + + + + +Notes: + +A working gcc compiler is needed and under Linux libc >= 4.6.27 is required. + +Be careful if you copy & paste pileup files, as some text editors tend to change +"tabs" for spaces, which is needed as the field delimiter. This can cause problems +in the parser. + +// +Comments and Questions: +Sohrab Shah sshah@bccrc.ca +Rodrigo Goya rgoya@bcgsc.ca + +// +LICENSE: this software is distributed under the MIT license
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/SNV/SNVMix2_source/SNVMix2-v0.12.1-rc1/SNVMix2.c Wed Oct 12 19:50:38 2011 -0400 @@ -0,0 +1,1828 @@ +/* The MIT License + + Copyright (c) 2009, by Sohrab Shah <sshah@bccrc.ca> and Rodrigo Goya <rgoya@bcgsc.ca> + + Permission is hereby granted, free of charge, to any person obtaining + a copy of this software and associated documentation files (the + "Software"), to deal in the Software without restriction, including + without limitation the rights to use, copy, modify, merge, publish, + distribute, sublicense, and/or sell copies of the Software, and to + permit persons to whom the Software is furnished to do so, subject to + the following conditions: + + The above copyright notice and this permission notice shall be + included in all copies or substantial portions of the Software. + + THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, + EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF + MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND + NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS + BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN + ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN + CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE + SOFTWARE. +*/ + +/* +C Implementation of SNVMix2 +*/ + +#define VERSION "0.12.1-rc1" + +#include <stdio.h> +#include <stdlib.h> +#include <string.h> +#include <math.h> +#include "SNVMix2.h" + +#include "bam.h" + +#define START_QNUM 1000 + +int main(int argc, char **argv) { + + param_struct params;// = {NULL, NULL, NULL, NULL, NULL, 0, 0, 0, 0, 0}; + + initSNVMix(argc, argv, ¶ms); + + if(params.classify || params.filter) { + if(params.input_type == Q_PILEUP) + snvmixClassify_qualities(¶ms); + else if(params.input_type == M_PILEUP || params.input_type == S_PILEUP) + snvmixClassify_pileup(¶ms); + else if(params.input_type == BAM_FILE) { + fprintf(stderr,"Output is:\n"); + fprintf(stderr,"\tchr:pos ref nref ref:ref_count,nref:nref_count,pAA,pAB,pBB,maxP"); + fprintf(stderr,"\tref_fwd ref_rev"); + fprintf(stderr,"\tnref_fwd nref_rev"); + fprintf(stderr,"\tnref_center nref_edges"); + fprintf(stderr,"\tindel_pos"); + fprintf(stderr,"\tref_clean nref_clean"); + fprintf(stderr,"\tref_bad_pair nref_bad_pair"); + fprintf(stderr,"\tref_ins nref_ins"); + fprintf(stderr,"\tref_del nref_del"); + fprintf(stderr,"\tref_junc nref_junc"); + fprintf(stderr,"\tnref_in_unique_pos"); + fprintf(stderr,"\traw[A,C,G,T,N]"); + fprintf(stderr,"\tthr[A,C,G,T,N]\n"); + snvmixClassify_bamfile(¶ms); + } + } else if(params.train) { + if(params.input_type == M_PILEUP || params.input_type == S_PILEUP) + snvmixTrain_pileup(¶ms); + else if(params.input_type == Q_PILEUP) { + fprintf(stderr,"Sorry, Training with quality-type input is not yet implemented\n"); + exit(1); + } + } + return(0); +} + +/* + void snvmixClassify_qualities + Arguments: + *params : pointer to model parameters and command line options + Function: + Reads a pilep-style file that has been preprocessed to include the quality of + calls being the reference allele and the maping quality both in decimal values. + + For each line it evaluates de model according to the parameters in *params and + outputs the corresponding SNV prediction values. + + This function may come in handy when filtering of calls is done by a + different program or the base-calling and maping quality information is not + in a pileup/phred format. + + The file read is a tab-separated file where the columns are: + - target sequence (e.g. chromosome) + - sequence position + - reference base + - non-reference base + - comma separated probabilities of the call being the reference + - comma separated mapping qualities, one for each base call + +*/ +void snvmixClassify_qualities(param_struct *params) { + FILE *fptrIN, *fptrOUT; + + char *line = NULL; + size_t line_len = 0, prev_len = 0; + int read_len = 0; + + int qual_num = 0, col_num = 0; + + char *col, *qual; + char *col_sep = "\t", *col_str, *col_ptr; + char *qual_sep = ",", *qual_str, *qual_ptr; + char *chr, *pos, *ref, *nref; + + long double *bQ, *mQ, *tmpQ; + int pos_int, depth = 0, maxp; + long int depth_allocated = 0; + + long double bsum = 0, msum = 0, *b, *mu, *notmu, *pi, *log_pi, z = 0; + int i, k, states; + + states = params->states; + + // Initialize local values of parameters + mu = params->mu; + pi = params->pi; + + if( ( b = malloc(states * sizeof(long double)) ) == NULL) { perror("[snvmixClassify_qualities] Could not allocate b\n"); exit(1); } + if( ( notmu = malloc(states * sizeof(long double)) ) == NULL) { perror("[snvmixClassify_qualities] Could not allocate notmu\n"); exit(1); } + if( ( log_pi = malloc(states * sizeof(long double)) ) == NULL) { perror("[snvmixClassify_qualities] Could not allocate log_pi\n"); exit(1); } + + for(k = 0; k < states; k++) { + notmu[k] = 1 - mu[k]; + log_pi[k] = logl(pi[k]); + } + fptrIN = params->input; + fptrOUT = params->output; + + + if( (bQ = malloc(START_QNUM * sizeof (long double))) == NULL) { + perror("ERROR allocating initial space for bQ"); exit(1); + } + if( (mQ = malloc(START_QNUM * sizeof (long double))) == NULL) { + perror("ERROR allocating initial space for mQ"); exit(1); + } + depth_allocated = START_QNUM; +#if defined __linux__ || defined _GNU_SOURCE + while( (read_len = getline(&line,&line_len,fptrIN)) != -1 ) +#endif +#ifdef __APPLE__ + while( (line = fgetln(fptrIN,&line_len)) != NULL ) +#endif + { + line[line_len-1] = '\0'; + depth = 0; + col_ptr = NULL; + for(col_num = 0, col_str = line; ; col_num++, col_str = NULL) { + col = strtok_r(col_str, "\t", &col_ptr); + if(col == NULL) { + break; + } + if(col_num == 0) { + chr = col; + } else if(col_num == 1) { + pos = col; + pos_int = strtol(pos, NULL, 10); + } else if(col_num == 2) { + ref = col; + } else if(col_num == 3) { + nref = col; + } else if(col_num == 4) { + for(qual_num = 0, qual_str = col; ; qual_num++, qual_str = NULL) { + qual = strtok_r(qual_str, ",", &qual_ptr); + if(qual == NULL) { + break; + } + if(qual_num >= depth_allocated) { + if( (bQ = realloc(bQ, sizeof(long double) * (depth_allocated + START_QNUM))) == NULL) { + perror("ERROR allocating bQ"); exit(1); + } + if( (mQ = realloc(mQ, sizeof(long double) * (depth_allocated + START_QNUM))) == NULL) { + perror("ERROR allocating mQ"); exit(1); + } + depth_allocated = depth_allocated + START_QNUM; + } + bQ[qual_num] = atof(qual); + } + depth = qual_num; + } else if(col_num == 5) { + for(qual_num = 0, qual_str = col; ; qual_num++, qual_str = NULL) { + qual = strtok_r(qual_str, ",", &qual_ptr); + if(qual == NULL) { + break; + } + if(qual_num >= depth_allocated) { + fprintf(stderr, "FATAL ERROR: should not have more mapping qualities than base qualities\n"); + exit(1); + } + mQ[qual_num] = atof(qual); + } + if(depth != qual_num) { + fprintf(stderr, "FATAL ERROR: should not have more base qualities than mapping qualities\n"); + exit(1); + } + } + } + + + for(k = 0; k < states; k++) + b[k] = 0; + + //b = sum(log(notm*0.5 + m.*(yr.*mur+notyr.*notmur)),2); + for(qual_num = 0; qual_num < depth; qual_num++) + for(k = 0; k < states; k++) + b[k] = b[k] + logl((1- mQ[qual_num])*0.5 + mQ[qual_num] * (bQ[qual_num]*mu[k]+(1-bQ[qual_num])*notmu[k])); + + z = 0; + for(k = 0; k < states; k++) { + b[k] = expl(b[k] + log_pi[k]); + z += b[k]; + } + if(!z) { z = 1; } + for(k = 0; k < states; k++) + b[k] = b[k] / z; + maxp = 0; + z = b[0]; + for(k = 0; k < states; k++) + if( b[k] > z) { + maxp = k; + z = b[k]; + } + + fprintf(fptrOUT,"%s\t%s\t%s\t%s",chr, pos, ref, nref); + for(k = 0; k , states; k++) + fprintf(fptrOUT,"%0.10Lf,",b[k]); + fprintf(fptrOUT,"%d\n",maxp+1); + } + fclose(fptrIN); + fclose(fptrOUT); + free(line); + + free(b); free(notmu); free(log_pi); +} + + +/* + void snvmixClassify_pileup + Arguments: + *params : pointer to model parameters and command line options + Function: + Reads a MAQ or Samtools pileup format. For required formatting we refer the user + to the corresponding websites: + http://maq.sourceforge.net/ + http://samtools.sourceforge.net/ + + In general the format of both files can be described as a tab separated file + where columns are: + - target sequence (e.g. chromosome) + - sequence position + - reference base + - depth + - stream of base calls + - stream of base call PHRED-scaled qualities + - stream of mapping PHRED-scaled qualities + + Note: when handling pileup files, care should be taken when doing copy-paste + operations not to transform 'tabs' into streams of spaces. + + For each line it evaluates de model according to the parameters in *params and + outputs the corresponding SNV prediction values. + + Predictions can be output either only for positions where when non-reference values + are observed or, when run with '-f' flag, for all positions. The -f flag is useful + when the resulting calls are being compared or joined accros different datasets + and all predictions need to be present. +*/ +void snvmixClassify_pileup(param_struct *params) { +//MAQ: +// 1 554484 C 1752 @,,.,.,, @xxx @xxx xxxxx +//SAM: +// 1 554484 C 1752 ,,.,.,, xxx xxxx + FILE *fptrIN, *fptrOUT; + + char *line = NULL; + size_t line_len = 0, prev_len = 0; + int read_len = 0; + int col_num = 0; + long int line_num = 0; + + char *col, *qual; + char *col_sep = "\t", *col_str, *col_ptr; + char *qual_sep = ",", *qual_str, *qual_ptr; + char *chr, *pos, *ref, nref, call, nref_skip = 'N'; + + char *bQ, *mQ; + int *calls, *tmpQ; + int pos_int, depth = 0, qual_num, maxp; + int depth_allocated = 0; + + long double bsum = 0, msum = 0, *b, *mu, *notmu, *pi, *log_pi, z = 0; + int nref_count = 0, ref_count = 0; + long double Y, not_Y; + long double phred[PHRED_MAX + 1]; + int i, call_i, k, states; + + //initPhred(phred, PHRED_MAX+1); + initPhred(phred, PHRED_MAX); + + states = params->states; + + // Initialize local values of parameters + mu = params->mu; + pi = params->pi; + + if( ( b = malloc(states * sizeof(long double)) ) == NULL) { perror("[snvmixClassify_pileup] Could not allocate b\n"); exit(1); } + if( ( notmu = malloc(states * sizeof(long double)) ) == NULL) { perror("[snvmixClassify_pileup] Could not allocate notmu\n"); exit(1); } + if( ( log_pi = malloc(states * sizeof(long double)) ) == NULL) { perror("[snvmixClassify_pileup] Could not allocate log_pi\n"); exit(1); } + + for(k = 0; k < states; k++) { + notmu[k] = 1 - mu[k]; + log_pi[k] = logl(pi[k]); + } + fptrIN = params->input; + fptrOUT = params->output; + if(params->full) + nref_skip = -2; + + + if( (calls = malloc(START_QNUM * sizeof (int))) == NULL) { + perror("ERROR allocating initial space for calls"); exit(1); + } + depth_allocated = START_QNUM; +#if defined __linux__ || defined _GNU_SOURCE + while( (read_len = getline(&line,&line_len,fptrIN)) != -1 ) +#endif +#ifdef __APPLE__ + while( (line = fgetln(fptrIN,&line_len)) != NULL ) +#endif + { + line[line_len-1] = '\0'; + line_num++; + depth = 0; + nref = 0; + col_ptr = NULL; + for(col_num = 0, col_str = line; nref != nref_skip ; col_num++, col_str = NULL) { + col = strtok_r(col_str, "\t", &col_ptr); + if(col == NULL) { + break; + } + if(col_num == 0) { + chr = col; + } else if(col_num == 1) { + pos = col; + } else if(col_num == 2) { + ref = col; + } else if(col_num == 3) { + depth = atoi(col); + if(depth > depth_allocated) { + if( (calls = realloc(calls, sizeof (int) * (depth + START_QNUM))) == NULL) { + perror("ERROR allocating space for calls"); exit(1); + } + depth_allocated = depth + START_QNUM; + } + } else if(col_num == 4) { + if(params->input_type == M_PILEUP) + col = col+sizeof(char); + snvmixGetCallString(col, calls, depth, &nref); + } else if(col_num == 5) { + bQ = col; + // If it's a MAQ pileup, we need to skip the @ sign + if(params->input_type == M_PILEUP) + bQ = bQ + sizeof(char); + for(call_i = 0; call_i < depth; call_i++) + bQ[call_i] = bQ[call_i]-33; + } else if(col_num == 6) { + mQ = col; + // If it's a MAQ pileup, we need to skip the @ sign + if(params->input_type == M_PILEUP) + mQ = mQ + sizeof(char); + for(call_i = 0; call_i < depth; call_i++) + mQ[call_i] = mQ[call_i]-33; + } + } + // If we quit the for because no nref was found, skip this too, next line + nref = snvmixFilterCalls(calls,depth,bQ,mQ,params); + nref_count = 0; + ref_count = 0; + for(qual_num = 0; qual_num < depth; qual_num++) { + //if( snvmixSkipCall(calls,qual_num,params,bQ,mQ) ) + if(calls[qual_num] == -1) + continue; + if(calls[qual_num] == 1) + ref_count++; + if(calls[qual_num] == nref) + nref_count++; + } +if(params->filter) { + fprintf(fptrOUT,"%s:%s\t%s:%d\t%c:%d\t", chr, pos, ref, ref_count, nref, nref_count); + for(qual_num = 0; qual_num < ref_count; qual_num++) + fprintf(fptrOUT,","); + for(qual_num = 0; qual_num < nref_count; qual_num++) + fprintf(fptrOUT,"%c",nref); + fprintf(fptrOUT,"\n"); +} else { + if(nref == nref_skip) + continue; + //nref = snvmixFilterCalls(calls,depth,bQ,mQ,params); + //if(nref == nref_skip) + // continue; + for(k = 0; k < states; k++) + b[k] = 0; + nref_count = 0; + for(qual_num = 0; qual_num < depth; qual_num++) { + //if( snvmixSkipCall(calls,qual_num,params,bQ,mQ) ) + if(calls[qual_num] == -1) + continue; + // from matlab: + // b = sum(log(notm*0.5 + m.*(yr.*mur+notyr.*notmur)),2); + if(calls[qual_num] == 1) { + // If REF then + Y = phred[(unsigned char) bQ[qual_num]]; + not_Y = 1-phred[(unsigned char) bQ[qual_num]]; + } else { + nref_count++; + // If NREF then + Y = (1-phred[(unsigned char) bQ[qual_num]])/3; + not_Y = phred[(unsigned char) bQ[qual_num]] + 2*(1-phred[(unsigned char)bQ[qual_num]])/3; + } + for(k = 0; k < states; k++) + b[k] = b[k] + logl((1-phred[(unsigned char) mQ[qual_num]])*0.5 + phred[(unsigned char) mQ[qual_num]] * (Y * mu[k] + not_Y * notmu[k])); + } + // Check if any non-references actually passed the filter + //if(!nref_count) + // continue; + z = 0; + for(k = 0; k < states; k++) { + b[k] = expl(b[k] + log_pi[k]); + z += b[k]; + } + if(!z) z = 1; + for(k = 0; k < states; k++) + b[k] = b[k] / z; + maxp = 0; + z = b[0]; + for(k = 0; k < states; k++) + if( b[k] > z) { + maxp = k; + z = b[k]; + } + + + fprintf(fptrOUT,"%s:%s\t%s\t%c\t%s:%d,%c:%d,",chr,pos, ref, nref, ref, ref_count, nref, nref_count); + for(k = 0; k < states; k++) + fprintf(fptrOUT,"%0.10Lf,",b[k]); + fprintf(fptrOUT,"%d\n",maxp+1); +} + } + fclose(fptrIN); + fclose(fptrOUT); + free(line); + + free(b); free(notmu); free(log_pi); +} + +int snvmixClassify_bamfile(param_struct *params) { + snvmix_pl_t snvmix_pl; + int states, i, k, bam_flag_mask; + + snvmix_pl.params = params; + snvmix_pl.tid = -1; + // TODO: change this to read range + snvmix_pl.begin = 0; + snvmix_pl.end = 0x7fffffff; + snvmix_pl.in = samopen(params->inputfile, "rb", 0); + if (snvmix_pl.in == 0) { + fprintf(stderr, "ERROR: Fail to open BAM file %s\n", params->bamfile); + return 1; + } + snvmix_pl.fai = fai_load(params->fastafile); + if (snvmix_pl.fai == 0) { + fprintf(stderr, "Fail to open BAM file %s\n", params->fastafile); + return 1; + } + if(params->listfile) snvmix_pl.hash = load_pos(params->listfile, snvmix_pl.in->header); + snvmix_pl.depth_allocated = 0; + snvmix_pl.ref = NULL; + snvmix_pl.calls = NULL; + //snvmix_pl.bQ = NULL; + //snvmix_pl.mQ = NULL; + + + /* This looks ugly... but we don't want to be allocating new memory for EVERY location. */ + states = params->states; + if( ( snvmix_pl.notmu = malloc(states * sizeof(long double)) ) == NULL) { perror("[snvmixClassify_bamfile] Could not allocate snvmix_pl.notmu\n"); exit(1); } + if( ( snvmix_pl.log_pi = malloc(states * sizeof(long double)) ) == NULL) { perror("[snvmixClassify_bamfile] Could not allocate snvmix_pl.log_pi\n"); exit(1); } + if( ( snvmix_pl.b = malloc(states * sizeof(long double)) ) == NULL) { perror("[snvmixClassify_bamfile] Could not allocate snvmix_pl.b\n"); exit(1); } + for(k = 0; k < states; k++) { + snvmix_pl.notmu[k] = 1 - params->mu[k]; + snvmix_pl.log_pi[k] = logl(params->pi[k]); + } + initPhred(snvmix_pl.phred, PHRED_MAX); + + /* Init call buffer */ + snvmix_pl.n_buffer = params->window; + if( (snvmix_pl.buffer = malloc(snvmix_pl.n_buffer * sizeof(snvmix_call_t)) ) == NULL) { perror("[snvmixClassify_bamfile] Could not allocate space for buffer\n"); exit(1); } + snvmix_pl.b_start = 0; + snvmix_pl.b_end = 0; + for(i = 0; i < snvmix_pl.n_buffer; i++) { + snvmix_pl.buffer[i].tid = 0; + snvmix_pl.buffer[i].pos = 0; + snvmix_pl.buffer[i].in_use = 0; + if( (snvmix_pl.buffer[i].p = malloc(states * sizeof(long double)) ) == NULL) {perror("[snvmixClassify_bamfile] Could not allocate space for buffer.p\n"); exit(1);} + } + + bam_flag_mask = (BAM_FUNMAP | BAM_FSECONDARY); // | BAM_FQCFAIL | BAM_FDUP); + if(params->filter_chast) + bam_flag_mask |= BAM_FQCFAIL; + if(params->filter_dup) + bam_flag_mask |= BAM_FDUP; + + /* Call pileup with our function and bam_flag_mask */ + sampileup(snvmix_pl.in, bam_flag_mask, snvmixClassify_pileup_func, &snvmix_pl); + + free(snvmix_pl.notmu); + free(snvmix_pl.log_pi); + free(snvmix_pl.b); +} + +int flush_buffer(uint32_t tid, uint32_t pos, snvmix_pl_t *snvmix_pl) { + snvmix_call_t *s; + int i, k, cnt, buff_id; + cnt = 0; + #define _fptrOUT snvmix_pl->params->output + //#define _fptrOUT stderr +//fprintf(_fptrOUT, "ENTERING flush_buffer, b_start = %d\tb_end = %d\n",snvmix_pl->b_start, snvmix_pl->b_end); + for(i = 0, buff_id = snvmix_pl->b_start; i < snvmix_pl->n_buffer; i++, buff_id=(buff_id+1)%snvmix_pl->params->window) { +//fprintf(stderr, "ITERATING in flush_buffer, buff_id = %d\n", buff_id); + s = snvmix_pl->buffer + buff_id; + if(pos+1 >= (s->pos + snvmix_pl->params->window) || tid != s->tid) { +//fprintf(stderr, "PASSED if in flush_buffer, buff_id = %d\n", buff_id); + if(s->in_use) { + //fprintf(_fptrOUT,"%d\t",buff_id); + fprintf(_fptrOUT,"%s:%d\t%c\t%c\t%c:%d,%c:%d", snvmix_pl->in->header->target_name[s->tid], s->pos, s->ref, s->nref, s->ref, s->ref_count, s->nref, s->nref_count); + + if(!snvmix_pl->params->filter) { + fprintf(_fptrOUT,","); + for(k = 0; k < snvmix_pl->params->states; k++) + fprintf(_fptrOUT,"%0.10Lf,",s->p[k]); + fprintf(_fptrOUT,"%d",s->maxP); + } + + fprintf(_fptrOUT,"\t%d %d", s->forward[0], s->reverse[0]); + fprintf(_fptrOUT,"\t%d %d", s->forward[1], s->reverse[1]); + fprintf(_fptrOUT,"\t%d %d", s->nref_center, s->nref_edges); + fprintf(_fptrOUT,"\t%d", s->indel_pos); + fprintf(_fptrOUT,"\t%d %d", s->c_clean[0], s->c_clean[1]); + fprintf(_fptrOUT,"\t%d %d", s->bad_pair[0], s->bad_pair[1]); + fprintf(_fptrOUT,"\t%d %d", s->c_ins[0], s->c_ins[1]); + fprintf(_fptrOUT,"\t%d %d", s->c_del[0], s->c_del[1]); + fprintf(_fptrOUT,"\t%d %d", s->c_junc[0], s->c_junc[1]); + fprintf(_fptrOUT,"\t%d", s->aln_unique_pos); + fprintf(_fptrOUT,"\t[%d,%d,%d,%d,%d]", s->raw_cvg[0],s->raw_cvg[1],s->raw_cvg[2],s->raw_cvg[3],s->raw_cvg[4]); + fprintf(_fptrOUT,"\t[%d,%d,%d,%d,%d]", s->thr_cvg[0],s->thr_cvg[1],s->thr_cvg[2],s->thr_cvg[3],s->thr_cvg[4]); + if(snvmix_pl->params->filter) { + fprintf(_fptrOUT,"\t"); + for(k = 0; k < s->ref_count; k++) + fprintf(_fptrOUT,","); + for(k = 0; k < s->nref_count; k++) + fprintf(_fptrOUT,"%c",s->nref); + } + fprintf(_fptrOUT,"\n"); + cnt++; + s->in_use = 0; + snvmix_pl->b_start = (buff_id+1)%snvmix_pl->params->window; + } + } else break; + if(buff_id == snvmix_pl->b_end) + break; + } +//fprintf(_fptrOUT, "EXITING flush_buffer, b_start = %d\tb_end = %d\n",snvmix_pl->b_start, snvmix_pl->b_end); + return cnt; +} + + +static int snvmixClassify_pileup_func(uint32_t tid, uint32_t pos, int n, const bam_pileup1_t *pl, void *data) { + +#define _bQ(p, x) bam1_qual(p[x].b)[p[x].qpos] +#define _mQ(p, x) p[x].b->core.qual + + //FILE *fptrOUT; + char nref_skip = 'N'; + //int *calls, ; + int depth = 0; + //long double *b, *notmu, *log_pi, *mu, *pi; + long double Y, not_Y, z; + //int states; + int i, k, qual_num, maxp; + //long double *phred; + int b_end_tmp = 0; + snvmix_call_t *s; + snvmix_pl_t *snvmix_pl = (snvmix_pl_t *)data; + param_struct *params = snvmix_pl->params; + // Avoid allocating new variables, use defines to make things readable +#define _calls snvmix_pl->calls +#define _b snvmix_pl->b +#define _notmu snvmix_pl->notmu +#define _log_pi snvmix_pl->log_pi +#define _mu params->mu +#define _pi params->pi +#define _phred snvmix_pl->phred +#define _states params->states + //fprintf(stderr,"DEBUG: snvmix_pl->buffer[snvmix_pl->b_start].in_use = %d\n", snvmix_pl->buffer[snvmix_pl->b_start].in_use); + //if(pos+1 == 148971) + // printf("DEBUG: test 148971, start.in_use = %d\tb_start=%d\tb_end=%d\n",snvmix_pl->buffer[snvmix_pl->b_start].in_use, snvmix_pl->b_start,snvmix_pl->b_end); + //if(pos == 148971) + // printf("DEBUG: test 148972, start.in_use = %d\tb_start=%d\tb_end=%d (pos+1 >= (snvmix_pl->buffer[snvmix_pl->b_start].pos + snvmix_pl->params->window) = %d >= %d\n", snvmix_pl->buffer[snvmix_pl->b_start].in_use, snvmix_pl->b_start,snvmix_pl->b_end, pos+1, snvmix_pl->buffer[snvmix_pl->b_start].pos + snvmix_pl->params->window); + // If we have gone further than window indicates, or changed tid, then flush buffer + if(snvmix_pl->buffer[snvmix_pl->b_start].in_use && (pos+1 >= (snvmix_pl->buffer[snvmix_pl->b_start].pos + snvmix_pl->params->window) || tid != snvmix_pl->buffer[snvmix_pl->b_start].tid )) + flush_buffer(tid, pos, snvmix_pl); + b_end_tmp = snvmix_pl->b_end; + s = snvmix_pl->buffer + snvmix_pl->b_end; + snvmix_pl->b_end = (snvmix_pl->b_end+1)%snvmix_pl->params->window; + + if(snvmix_pl->hash) { + khint_t k_h = kh_get(64, snvmix_pl->hash, (uint64_t)tid<<32|pos); + if (k_h == kh_end(snvmix_pl->hash)) return 0; + } + + s->in_use = 1; + + + if(params->full) + nref_skip = -2; + + if (snvmix_pl->fai && (int)tid != snvmix_pl->tid) { + free(snvmix_pl->ref); + snvmix_pl->ref = fai_fetch(snvmix_pl->fai, snvmix_pl->in->header->target_name[tid], &snvmix_pl->len); + snvmix_pl->tid = tid; + } + + //chr = snvmix_pl->in->header->target_name[tid], + s->tid = tid; + s->ref = toupper((snvmix_pl->ref && (int)pos < snvmix_pl->len)? snvmix_pl->ref[pos] : 'N'); + s->pos = pos + 1; + depth = n; + + if(depth > snvmix_pl->depth_allocated) { + if( (snvmix_pl->calls = realloc(snvmix_pl->calls, sizeof (int) * (depth + START_QNUM))) == NULL) { + perror("ERROR allocating space for snvmix_pl->calls"); exit(1); + } + //calls = snvmix_pl->calls; + snvmix_pl->depth_allocated = depth + START_QNUM; + } + + //for(i = 0; i < depth; i++) { + // FIXME: watch out for deletions, do they get automatically an "n"? if so, ok +//fprintf(stderr, "DEBUG: len = %d\tref = %c\tcalls = ", snvmix_pl->len, ref); + s->raw_cvg[0] = s->raw_cvg[1] = s->raw_cvg[2] = s->raw_cvg[3] = s->raw_cvg[4] = 0; + s->thr_cvg[0] = s->thr_cvg[1] = s->thr_cvg[2] = s->thr_cvg[3] = s->thr_cvg[4] = 0; + for(i = depth; i--; ) { + if(pl[i].is_del) { + _calls[i] = -1; + continue; + } + _calls[i] = "nACnGnnnTnnnnnnn"[bam1_seqi(bam1_seq(pl[i].b), pl[i].qpos)]; +//fprintf(stderr, "%c", _calls[i]); + switch(_calls[i]) { + case 'A': s->raw_cvg[0]++; break; + case 'C': s->raw_cvg[1]++; break; + case 'G': s->raw_cvg[2]++; break; + case 'T': s->raw_cvg[3]++; break; + case 'n': s->raw_cvg[4]++; break; + default: break; + } + // Mask calls according to quality + if( snvmixSkipCall_alt(params, _calls[i], (char) bam1_qual(pl[i].b)[pl[i].qpos], (char) pl[i].b->core.qual) ) + _calls[i] = -1; + else { + switch(_calls[i]) { + case 'A': s->thr_cvg[0]++; break; + case 'C': s->thr_cvg[1]++; break; + case 'G': s->thr_cvg[2]++; break; + case 'T': s->thr_cvg[3]++; break; + case 'n': s->thr_cvg[4]++; break; + default: break; + } + if(_calls[i] == s->ref) + _calls[i] = 1; + else if(_calls[i] == 'n') + _calls[i] = -1; + } + } + + s->nref = snvmixFilterCalls(_calls,depth,NULL,NULL,params); + s->nref_count = 0; + s->ref_count = 0; + + // FIXME: review this section, extra flags + for(i = 0; i < 2; i++) { + s->forward[i] = 0; + s->reverse[i] = 0; + s->good_pair[i] = 0; + s->bad_pair[i] = 0; + s->c_clean[i] = 0; + s->c_ins[i] = 0; + s->c_del[i] = 0; + s->c_junc[i] = 0; + } + s->nref_edges = 0; // FIXME: fixed 5 bp edges + s->nref_center = 0; // FIXME: fixed 5 bp edges + s->indel_pos = 0; // How many reads have a deletion at that site + s->indel_near = 0; // How many reasd have a deletion overall + s->aln_unique_pos = 0; + uint8_t cigar_ops; // 0x1 INS, 0x2 DEL , 0x4 JUNCTION + //for(qual_num = 0; qual_num < depth; qual_num++) { + uint32_t debug_sort = 0x7fffffff; + if(s->nref != nref_skip) { + k = -1; + for(qual_num = depth; qual_num--; ) { + if(_calls[qual_num] == -1) { + if(pl[qual_num].is_del) + s->indel_pos++; + continue; + } + cigar_ops = 0; + for(i=0; i<pl[qual_num].b->core.n_cigar; i++) { + int op = bam1_cigar(pl[qual_num].b)[i] & BAM_CIGAR_MASK; + if(op == BAM_CINS) + cigar_ops |= 0x1; + if(op == BAM_CDEL) + cigar_ops |= 0x2; + if(op == BAM_CREF_SKIP) + cigar_ops |= 0x4; + } + if(pl[qual_num].indel) { + s->indel_pos++; + } + if(_calls[qual_num] == 1) { + s->ref_count++; + k = 0; + } else if(_calls[qual_num] == s->nref) { + s->nref_count++; + k = 1; + if(pl[qual_num].qpos > (pl[qual_num].b->core.l_qseq - 5) || pl[qual_num].qpos < 5) + s->nref_edges++; + else + s->nref_center++; + if(pl[qual_num].b->core.pos < debug_sort) { s->aln_unique_pos++; debug_sort = pl[qual_num].b->core.pos; } + else if(pl[qual_num].b->core.pos > debug_sort) {fprintf(stderr, "ERROR checking sort in read-position, prev = %Ld, new = %Ld\n", debug_sort, pl[qual_num].b->core.pos); exit(1);} + } + + if(k != -1) { + if(cigar_ops) { + if(cigar_ops & 0x1) s->c_ins[k]++; + if(cigar_ops & 0x2) s->c_del[k]++; + if(cigar_ops & 0x4) s->c_junc[k]++; + } else s->c_clean[k]++; + + if(pl[qual_num].b->core.tid != pl[qual_num].b->core.mtid) s->bad_pair[k]++; + + if(pl[qual_num].b->core.flag & 0x10) s->reverse[k]++; + else s->forward[k]++; + } + } + } + if(!params->filter) { + if(s->nref == nref_skip) { + snvmix_pl->b_end = b_end_tmp; + s->in_use = 0; + return 0; + } + int block = (_states / 3) * 3; + //for(k = 0; k < _states; k++) + //for(k = _states; k--; ) + // _b[k] = 0; + k = 0; + while( k < block ) { + _b[k] = 0; + _b[k+1] = 0; + _b[k+2] = 0; + k += 3; + } + if( k < _states) { + switch( _states - k ) { + case 2: _b[k] = 0; k++; + case 1: _b[k] = 0; + } + } + //for(qual_num = 0; qual_num < depth; qual_num++) { + for(qual_num = depth; qual_num--; ) { + //if( snvmixSkipCall(calls,qual_num,params,bQ,mQ) ) + if(_calls[qual_num] == -1) + continue; + // from matlab: + // b = sum(log(notm*0.5 + m.*(yr.*mur+notyr.*notmur)),2); + if(_calls[qual_num] == 1) { + // If REF then + Y = _phred[(unsigned char) _bQ(pl, qual_num)]; + not_Y = 1-_phred[(unsigned char) _bQ(pl, qual_num)]; + } else { + // If NREF then + Y = (1-_phred[(unsigned char) _bQ(pl, qual_num)])/3; + not_Y = _phred[(unsigned char) _bQ(pl, qual_num)] + 2*(1-_phred[(unsigned char)_bQ(pl, qual_num)])/3; + } + //for(k = 0; k < _states; k++) + //for(k = _states; k--; ) + // _b[k] = _b[k] + logl((1-_phred[(unsigned char) _mQ(pl, qual_num)])*0.5 + _phred[(unsigned char) _mQ(pl, qual_num)] * (Y * _mu[k] + not_Y * _notmu[k])); + k = 0; + while( k < block ) { + _b[k] = _b[k] + logl((1-_phred[(unsigned char) _mQ(pl, qual_num)])*0.5 + _phred[(unsigned char) _mQ(pl, qual_num)] * (Y * _mu[k] + not_Y * _notmu[k])); + _b[k+1] = _b[k+1] + logl((1-_phred[(unsigned char) _mQ(pl, qual_num)])*0.5 + _phred[(unsigned char) _mQ(pl, qual_num)] * (Y * _mu[k+1] + not_Y * _notmu[k+1])); + _b[k+2] = _b[k+2] + logl((1-_phred[(unsigned char) _mQ(pl, qual_num)])*0.5 + _phred[(unsigned char) _mQ(pl, qual_num)] * (Y * _mu[k+2] + not_Y * _notmu[k+2])); + k += 3; + } + if( k < _states) { + switch( _states - k ) { + case 2: _b[k] = _b[k] + logl((1-_phred[(unsigned char) _mQ(pl, qual_num)])*0.5 + _phred[(unsigned char) _mQ(pl, qual_num)] * (Y * _mu[k] + not_Y * _notmu[k])); k++; + case 1: _b[k] = _b[k] + logl((1-_phred[(unsigned char) _mQ(pl, qual_num)])*0.5 + _phred[(unsigned char) _mQ(pl, qual_num)] * (Y * _mu[k] + not_Y * _notmu[k])); + } + } + } + z = 0; + //for(k = 0; k < _states; k++) { + //for(k = _states; k--; ) { + // _b[k] = expl(_b[k] + _log_pi[k]); + // z += _b[k]; + //} + k = 0; + while( k < block ) { + _b[k] = expl(_b[k] + _log_pi[k]); z += _b[k]; + _b[k+1] = expl(_b[k+1] + _log_pi[k+1]); z += _b[k+1]; + _b[k+2] = expl(_b[k+2] + _log_pi[k+2]); z += _b[k+2]; + k += 3; + } + if( k < _states ) { + switch( _states - k ) { + case 2: _b[k] = expl(_b[k] + _log_pi[k]); z += _b[k]; k++; + case 1: _b[k] = expl(_b[k] + _log_pi[k]); z += _b[k]; + } + } + if(!z) z = 1; + //for(k = 0; k < _states; k++) + //for(k = _states; k--; ) + // _b[k] = _b[k] / z; + k = 0; + while( k < block ) { + _b[k] = _b[k] / z; + _b[k+1] = _b[k+1] / z; + _b[k+2] = _b[k+2] / z; + k += 3; + } + if( k < _states ) { + switch( _states - k ) { + case 2: _b[k] = _b[k] / z; k++; + case 1: _b[k] = _b[k] / z; + } + } + maxp = _states - 1; + z = _b[maxp]; + //for(k = 0; k < _states; k++) + for(k = _states; k--; ) + if( _b[k] > z) { + maxp = k; + z = _b[k]; + } + + + for(k = 0; k < _states; k++) + s->p[k] = _b[k]; + s->maxP = maxp+1; + } +} + +/* + void snvmixGetCallString + Arguments: + *col : pointer to the current file-line in memory + *calls : pointer to array where we will store the final base-calls + depth : number of base reads for this position + *nref : the observed NREF value will be placed here (-1 if none was found) + + Function: + This will parse column 5 of the pileup file, which contains the + base calls and will fill the array "calls" with: + 1 : when a reference call was made + -1 : when an invalid value is seen ('N', 'n', '*') + [ACTG] : when a non-reference call was made + + + +*/ +inline void snvmixGetCallString(char *col, int *calls, int depth, char *nref) { + int i; + int call_i = 0, call_skip_num = 0; + char call_skip_char[10]; + for(i = 0 ; call_i < depth; i++) { + switch(col[i]){ + case ',': + case '.': + calls[call_i] = 1; + call_i++; + break; + case 'a': case 'A': + case 't': case 'T': + case 'g': case 'G': + case 'c': case 'C': + //calls[call_i] = 0; + calls[call_i] = toupper(col[i]); + call_i++; + //if(*nref == 0) + //*nref = toupper(*(col+sizeof(char)*i)); + if(*nref == 0) + *nref = toupper(col[i]); + break; + case 'N': + case 'n': + case '*': + // Not comparable values, we ignore them, but need to + // keep count to compare against the number of mapping qualities + calls[call_i] = -1; + call_i++; + break; + case '$': + // End of a read, just ignore it + break; + case '^': + // Start of read, ignore it and skip the next value (not base-related) + i++; + break; + case '+': + case '-': + // Eliminate: + // +2AA + // -3AAA + // Start skiping the sign + i++; + for(call_skip_num = 0; col[i] <= '9' && col[i] >= '0'; call_skip_num++, i++) { + //call_skip_char[call_skip_num] = call; + call_skip_char[call_skip_num] = col[i]; + //i++; + } + // we have the number string in call_skip_char, lets terminate it + call_skip_char[call_skip_num] = '\0'; + // i has been updated to first letter, just need to jump the rest of them + i = i+atoi(call_skip_char)-1; + break; + default: + fprintf(stderr,"ERROR: problem reading pileup file calls (%c)\n",col[i]); + exit(1); + break; + } + } + // If no nref was found, don't bother parsing the other columns, make the for fail with -1 + if(!*nref) + *nref = -1; +} + +/* + int snvmixFilterCalls + Arguments: + *calls : array built by snvmixGetCallString containing + 1 : when a reference call was made + -1 : when an invalid value is seen ('N', 'n', '*') + [ACTG] : when a non-reference call was made + depth : number of calls for the current position + *bQ : base qualities observed for each call + *mQ : map quality for each call + *params : parameter structure, get thresholding data + Function: + For each valid call read in the position this function will apply + thresholding according to the type selected (-t flag) and the bQ (-q) + and mQ (-Q) thresholds provided. + + Any base-call that does not pass thresholds will be switched from it's + current value in *calls to -1; + + The most prevalent NREF after filtering will be determined and returned. + +*/ +inline int snvmixFilterCalls(int *calls, int depth, char *bQ, char *mQ, param_struct *params) { + int qual_num, nref_counts[5]; + nref_counts[0] = 0; + nref_counts[1] = 0; + nref_counts[2] = 0; + nref_counts[3] = 0; + nref_counts[4] = 0; + int max_nref = N; + + char nref = 0; + + //for(qual_num = 0; qual_num < depth; qual_num++) { + for(qual_num = depth; qual_num--; ) { + //if( snvmixSkipCall(calls,qual_num,params,bQ,mQ) ) { + if( bQ != NULL && mQ != NULL && snvmixSkipCall(calls,qual_num,params,bQ,mQ) ) { + calls[qual_num] = -1; + } else { + nref_counts[0]++; + switch(calls[qual_num]) { + case 'A': + nref_counts[A]++; + break; + case 'C': + nref_counts[C]++; + break; + case 'G': + nref_counts[G]++; + break; + case 'T': + nref_counts[T]++; + break; + case 1: + case -1: + nref_counts[0]--; + break; + default: + fprintf(stderr,"ERROR: unknown call base\n"); + exit(1); + } + } + } + if(nref_counts[0]) { + max_nref = A; + if(nref_counts[max_nref] < nref_counts[C]) + max_nref = C; + if(nref_counts[max_nref] < nref_counts[G]) + max_nref = G; + if(nref_counts[max_nref] < nref_counts[T]) + max_nref = T; + } else { + //return -1; + } + //for(qual_num = 0; qual_num < depth; qual_num++) { + for(qual_num = depth; qual_num--; ) { + if(calls[qual_num] == 1) + continue; + if(calls[qual_num] != base_code[max_nref]) + calls[qual_num] = -1; + } + return base_code[max_nref]; +} + +/* + int snvmixSkipCall + Arguments: + *calls : array built by snvmixGetCallString containing + 1 : when a reference call was made + -1 : when an invalid value is seen ('N', 'n', '*') + [ACTG] : when a non-reference call was made + qual_num : call number that is being evaluated + *params : parameter structure, get thresholding data + *bQ : base qualities observed for each call + *mQ : map quality for each call + Function: + Evalates quality values in each of the filtering models + + Returns 1 if the calls[qual_num] needs to be filtered out + Returns 0 otherwise +*/ +inline int snvmixSkipCall(int *calls, int qual_num, param_struct *params, char *bQ, char *mQ) { + if(calls[qual_num] == -1) + return(1); + if(params->filter_type == TYPE_mb) { + if(bQ[qual_num] <= params->bQ || mQ[qual_num] <= params->mQ) + return(1); + } else if(params->filter_type == TYPE_b) { + if(bQ[qual_num] <= params->bQ) + return(1); + } else { + if(mQ[qual_num] <= params->mQ) + return(1); + if(params->filter_type == TYPE_m) { + // Use mapping as surrogate + bQ[qual_num] = mQ[qual_num]; + // Make mapping one + mQ[qual_num] = (char) PHRED_MAX; + } else if(params->filter_type == TYPE_M) { + // Mapping passed, make it one + mQ[qual_num] = (char) PHRED_MAX; + } else if(params->filter_type == TYPE_Mb) { + // Nothing special here + } else if(params->filter_type == TYPE_MB || params->filter_type == TYPE_SNVMix1) { + if(bQ[qual_num] <= params->bQ) + return(1); + if(params->filter_type == TYPE_SNVMix1) { + bQ[qual_num] = (char) PHRED_MAX; + mQ[qual_num] = (char) PHRED_MAX; + } } + } + return(0); +} + +inline int snvmixSkipCall_alt(param_struct *params, int call, char bQ, char mQ) { + if(call == -1) + return(1); + if(params->filter_type != TYPE_b && mQ <= params->mQ) + return(1); + switch(params->filter_type) { + case TYPE_mb: + if(bQ <= params->bQ || mQ <= params->mQ) + return(1); + break; + case TYPE_b: + if(bQ <= params->bQ) + return(1); + break; + case TYPE_m: + // Use mapping as surrogate + bQ = mQ; + // Make mapping one + mQ = (char) PHRED_MAX; + break; + case TYPE_M: + // Mapping passed, make it one + mQ = (char) PHRED_MAX; + break; + case TYPE_Mb: + // Nothing special here + break; + case TYPE_MB: + case TYPE_SNVMix1: + if(bQ <= params->bQ) + return(1); + if(params->filter_type == TYPE_SNVMix1) { + bQ = (char) PHRED_MAX; + mQ = (char) PHRED_MAX; + } + break; + } + return(0); +} + + +void resetParams(param_struct *params) { + params->input = stdin; + params->output = stdout; + params->inputfile = NULL; + params->outputfile = NULL; + params->modelfile = NULL; + params->fastafile = NULL; + params->listfile = NULL; + params->window = 1; + params->filter_type = 0; + params->filter_dup = 1; + params->filter_chast = 1; + params->train = 0; + params->classify = 0; + params->filter = 0; + params->full = 0; + params->input_type = S_PILEUP; // 0 = processed, 1 = maq pileup, 2 = sam pileup, 3 = bam file + params->mu = NULL; + params->pi = NULL; + params->max_iter = 1000; + params->bQ = 19; + params->mQ = 19; + params->debug = 0; + params->states = 3; + params->trainP.alpha = NULL; + params->trainP.beta = NULL; + params->trainP.delta = NULL; + params->trainP.param_file = NULL; + params->trainP.max_iter = 100; + params->trainP.bQ = NULL; + params->trainP.mQ = NULL; + params->trainP.calls = NULL; + params->window = 1; +} + +void initSNVMix(int argc, char **argv, param_struct *params) { + char c; + int i; + resetParams(params); + while ((c = getopt (argc, argv, "hDTCFfi:o:m:t:p:q:Q:a:b:d:M:S:r:l:w:cR")) != -1) { + switch (c) + { + case 'm': params->modelfile = optarg; break; + case 'i': params->inputfile = optarg; break; + case 'o': params->outputfile = optarg; break; + // Bam file opts + case 'r': params->fastafile = optarg; break; + case 'l': params->listfile = optarg; break; + case 'T': params->train = 1; break; + case 'C': params->classify = 1; break; + case 'F': params->filter = 1; break; + case 'f': params->full = 1; break; + case 'p': + if(*optarg == 'q') { + params->input_type = Q_PILEUP; + } else if(*optarg == 'm') { + params->input_type = M_PILEUP; + } else if(*optarg == 's') { + params->input_type = S_PILEUP; + } else if(*optarg == 'b') { + params->input_type = BAM_FILE; + } else { + fprintf(stderr,"ERROR: unknown pileup format %c\n",*optarg); + exit(1); + } + break; + case 't': + if(strcmp("mb",optarg) == 0) + params->filter_type = TYPE_mb; + else if(strcmp("m",optarg) == 0) + params->filter_type = TYPE_m; + else if(strcmp("b",optarg) == 0) + params->filter_type = TYPE_b; + else if(strcmp("M",optarg) == 0) + params->filter_type = TYPE_M; + else if(strcmp("Mb",optarg) == 0) + params->filter_type = TYPE_Mb; + else if(strcmp("MB",optarg) == 0) + params->filter_type = TYPE_MB; + else if(strcmp("SNVMix1",optarg) == 0) + params->filter_type = TYPE_SNVMix1; + else { + fprintf(stderr,"ERROR: filter type '%s' not recognized\n",optarg); + exit(1); + } + break; + case 'q': + params->bQ = atoi(optarg); + if( params->bQ < 0 || params->bQ >= PHRED_MAX ) { + fprintf(stderr,"ERROR: quality threshold value Q%d out of range\n",params->bQ); + exit(1); + } + break; + case 'Q': + params->mQ = atoi(optarg); + if( params->mQ < 0 || params->mQ >= PHRED_MAX ) { + fprintf(stderr,"ERROR: mapping threshold value Q%d out of range\n",params->mQ); + exit(1); + } + break; + case 'h': + usage(argv[0]); + break; + case 'D': params->debug = 1; break; + case 'M': params->trainP.param_file = optarg; break; + case 'S': + params->states = atoi(optarg); + if( params->states < 3 ) { + fprintf(stderr,"ERROR: state minimum is 3\n"); + exit(1); + } + break; + case 'w': + params->window = atoi(optarg); + if(params->window < 1) + params->window = 1; + break; + case 'c': + params->filter_chast = 0; + break; + case 'R': + params->filter_dup = 0; + break; + default: + fprintf(stderr,"Unknown option\n"); + usage(argv[0]); + break; + } + } + /* Decide if we're going to train or classify */ + if(params->filter) { + params->train = 0; + params->classify = 0; + } + if(params->train && params->classify) { + fprintf(stderr,"ERROR: choose either train or classify\n"); + exit(1); + } else if(!params->train && !params->classify && !params->filter) { + fprintf(stderr,"Train/Classify/Filter not selected, picking default: Classify\n"); + params->classify = 1; + } + + /* Set parameters */ + allocateParameters(params); + if( params->train ) setTrainingParameters(params); + if( params->classify ) setClassificationParameters(params); + + /* Open input and output streams */ + if( params->input_type == BAM_FILE ) { + if( params->train ) { + fprintf(stderr, "BAM input for training not yet implemented\n"); + exit(1); + } + if( params->inputfile == NULL || strcmp(params->inputfile, "-") == 0) { + fprintf(stderr, "ERROR: if '-p b' is chosen, input file has to be a bam file\n"); + exit(1); + } + if( params->fastafile == NULL ) { + fprintf(stderr, "ERROR: if '-p b' is chosen, reference fasta file is required (-r <ref.fa>)\n"); + exit(1); + } + } else if( params->inputfile != NULL) { + params->input = fopen(params->inputfile, "r"); + if(params->input == NULL) { + perror("ERROR: could not open input file"); + exit(1); + } + } else { + params->input = stdin; + } + if( params->outputfile != NULL ) { + params->output = fopen(params->outputfile, "w"); + if(params->output == NULL) { + perror("ERROR: could not open output file"); + exit(1); + } + } else { + params->output = stdout; + } +} + +void allocateParameters(param_struct *params) { + + /* Allocate alpha */ + if( (params->trainP.alpha = malloc(params->states * sizeof(long double))) == NULL) { + perror("ERROR: could not allocate space for alpha\n"); exit(1); + } + /* Allocate beta */ + if( (params->trainP.beta = malloc(params->states * sizeof(long double))) == NULL) { + perror("ERROR: could not allocate space for beta\n"); exit(1); + } + /* Allocate delta*/ + if( (params->trainP.delta = malloc(params->states * sizeof(long double))) == NULL) { + perror("ERROR: could not allocate space for delta\n"); exit(1); + } + /* Allocate mu*/ + if( (params->mu = malloc(params->states * sizeof(long double))) == NULL) { + perror("ERROR: could not allocate space for mu\n"); exit(1); + } + /* Allocate pi*/ + if( (params->pi = malloc(params->states * sizeof(long double))) == NULL) { + perror("ERROR: could not allocate space for pi\n"); exit(1); + } +} + +void setTrainingParameters(param_struct *params) { + if( params->trainP.param_file != NULL ) { + readParamFile(params,'t'); + } else { + if(params->states != 3) { + fprintf(stderr, "ERROR: if state space larger than 3 requested, parameters must be provided\n"); + exit(1); + } + fprintf(stderr,"Training parameter file not given, using defaults\n"); + params->trainP.alpha[0] = 1000; + params->trainP.alpha[1] = 5000; + params->trainP.alpha[2] = 1; + params->trainP.beta[0] = 1; + params->trainP.beta[1] = 5000; + params->trainP.beta[2] = 1000; + params->trainP.delta[0] = 10; + params->trainP.delta[1] = 1; + params->trainP.delta[2] = 1; + } +} + +void setClassificationParameters(param_struct *params) { + int k; + if( params->modelfile != NULL ) { + readParamFile(params,'c'); + } else { + if(params->states != 3) { + fprintf(stderr, "ERROR: if state space larger than 3 requested, model file must be provided\n"); + exit(1); + } + params->mu[0] = 0.995905287891696078261816182930; + params->mu[1] = 0.499569401000925172873223800707; + params->mu[2] = 0.001002216846753116409260431219; + params->pi[0] = 0.672519580755555956841362785781; + params->pi[1] = 0.139342327124010650907237618412; + params->pi[2] = 0.188138092120433392251399595807; + fprintf(stderr,"Classification parameter file not given, using for mQ35 bQ10\n"); + } + fprintf(stderr,"Mu and pi values:\n"); + for(k = 0; k < params->states; k++) + fprintf(stderr,"\tmu[%d] = %Lf\tpi[%d] = %Lf\n", k, params->mu[k], k, params->pi[k]); + fprintf(stderr,"\n"); +} + +void readParamFile(param_struct *params, char type) { + FILE *fptrPARAM; + char *line = NULL, *param_name, *param, *param_ptr, *filename; + size_t line_len = 0, read_len = 0; + long double *target; + int i; + + if(type == 't') { + filename=params->trainP.param_file; + } else if(type == 'c') { + filename=params->modelfile; + } + fptrPARAM=fopen(filename, "r"); + if(fptrPARAM == NULL) { + fprintf(stderr, "ERROR: could not open parameter file %s\n", filename); + exit(1); + } + +#if defined __linux__ || defined _GNU_SOURCE + while( (read_len = getline(&line,&line_len,fptrPARAM)) != -1 ) +#endif +#ifdef __APPLE__ + while( (line = fgetln(fptrPARAM,&line_len)) != NULL ) +#endif + { + line[line_len-1] = '\0'; + target = NULL; + param_name = strtok_r(line, " ", ¶m_ptr); + if(type == 't') { + if(strcmp("alpha", param_name) == 0) target = params->trainP.alpha; + else if(strcmp("beta", param_name) == 0) target = params->trainP.beta; + else if(strcmp("delta", param_name) == 0) target = params->trainP.delta; + } else if(type == 'c') { + if(strcmp("mu", param_name) == 0) target = params->mu; + else if(strcmp("pi", param_name) == 0) target = params->pi; + + } + if(target == NULL) { fprintf(stderr, "Unknown parameter %s, skipping\n", param_name); continue; } + + for(i = 0; i < params->states; i++) { + param = strtok_r(NULL, " ", ¶m_ptr); + if(param == NULL) { + fprintf(stderr,"ERROR: missing value #%d for %s\n", i, param_name); + exit(1); + } + target[i] = atof(param); +fprintf(stderr, "DEBUG: %s[%d] = %Lf\n", param_name, i, target[i]); + } + } + fclose(fptrPARAM); + free(line); +} + +void initPhred(long double *phredTable, int elem) { + int i; + for(i = 0; i < elem; i++) { + phredTable[i] = 1-powl(10,(-(long double)i/10)); + } + phredTable[i] = 1; +} + + +void usage(char *selfname) { + param_struct default_params; + resetParams(&default_params); + fprintf(stderr,"Syntax:\n\t%s\t-m <modelfile> [-i <infile>] [-o <outfile>] [-T | -C | -F] [-p < q | m | s >] [-t < mb | m | b | M | Mb | MB | SNVMix1>] [-q <#>] [-Q <#>] [-M <trainP file>] [-h]\n",selfname); + fprintf(stderr,"\tRequired:\n"); + fprintf(stderr,"\t-m <modelfile>\tmodel file, a line for mu and a line for pi, three\n"); + fprintf(stderr,"\t\t\tspace-separated values each, like:\n"); + fprintf(stderr,"\t\t\tmu 0.xxxxxxxx 0.xxxxxxxx 0.xxxxxxxx\n"); + fprintf(stderr,"\t\t\tpi 0.xxxxxxxx 0.xxxxxxxx 0.xxxxxxxx\n"); + fprintf(stderr,"\tOptional:\n"); + fprintf(stderr,"\t-i <infile>\tquality pileup, from pileup2matlab.pl script (def: STDIN)\n"); + fprintf(stderr,"\t-o <outfile>\twhere to put the results (def: STDOUT)\n"); + fprintf(stderr,"\t-T | -C | -F\tTrain, Classify or Filter (def: Classify)\n"); + fprintf(stderr,"\t-p q|m|s\tInput pileup format (def: s)\n\t\t\tq = quality\n\t\t\tm = MAQ\n\t\t\ts = SAMtools\n"); + fprintf(stderr,"\t-t mb|m|b|M|Mb|MB|SNVMix1\n\t\t\tFilter type (def: mb)\n"); + fprintf(stderr,"\t\t\tmb\tLowest between map and base quality\n"); + fprintf(stderr,"\t\t\tm\tFilter on map, and use as surrogate for base quality\n"); + fprintf(stderr,"\t\t\tb\tFilter on base quality, take map quality as 1\n"); + fprintf(stderr,"\t\t\tM\tFilter on map quality but use only base quality\n"); + fprintf(stderr,"\t\t\tMb\tFilter on map quality and use both map and base qualities\n"); + fprintf(stderr,"\t\t\tMB\tFilter on map quality AND base quality\n"); + fprintf(stderr,"\t\t\tSNVMix1\tFilter on base quality and map quality, afterwards consider them perfect\n"); + fprintf(stderr,"\t-q #\t\tCutoff Phred value for Base Quality, anything <= this value is ignored (def: Q%d)\n",default_params.bQ); + fprintf(stderr,"\t-Q #\t\tCutoff Phred value for Map Quality, anything <= this value is ignored (def: Q%d)\n",default_params.mQ); + fprintf(stderr,"\n\tTraining parameters:\n"); + fprintf(stderr,"\t-M <file>\tProvide a file containing training parameters\n"); + fprintf(stderr,"\t\t\tValues are space-separated:\n"); + fprintf(stderr,"\t\t\talpha # # #\n"); + fprintf(stderr,"\t\t\tbeta # # #\n"); + fprintf(stderr,"\t\t\tdelta # # #\n"); + fprintf(stderr,"\n\t-h\t\tthis message\n"); + fprintf(stderr,"\nImplementation: Rodrigo Goya, 2009. Version %s\n",VERSION); + exit(0); +} + +// Based on classify pileup, but reads the entire file to memory for training purposes. +void snvmixGetTrainSet_pileup(param_struct *params) { +//MAQ: +// 1 554484 C 1752 @,,.,.,, @xxx @xxx xxxxx +//SAM: +// 1 554484 C 1752 ,,.,.,, xxx xxxx + + FILE *fptrIN; + + char *line = NULL; + size_t line_len = 0, prev_len = 0; + int read_len = 0; + int col_num = 0; + long int line_num = 0; + + char *col, *qual; + char *col_sep = "\t", *col_str, *col_ptr; + char *qual_sep = ",", *qual_str, *qual_ptr; + char *chr, *pos, *ref, nref, call; + + char *bQ, *mQ; + int *calls, *tmpQ, pos_int; + int depth = 0, qual_num, maxp; + int depth_allocated = 0; + + int trainset = 0; + int trainset_allocated = 0; + + int nref_count = 0, ref_count = 0; + int i, call_i; + + fptrIN = params->input; + + if( (params->trainP.bQ = malloc(START_QNUM * sizeof (unsigned char **))) == NULL) { + perror("ERROR allocating initial space for train.bQ"); exit(1); + } + if( (params->trainP.mQ = malloc(START_QNUM * sizeof (unsigned char **))) == NULL) { + perror("ERROR allocating initial space for train.mQ"); exit(1); + } + if( (params->trainP.calls = malloc(START_QNUM * sizeof (signed char **))) == NULL) { + perror("ERROR allocating initial space for train.calls"); exit(1); + } + if( (params->trainP.depth = malloc(START_QNUM * sizeof (int *))) == NULL) { + perror("ERROR allocating initial space for train.depth"); exit(1); + } + trainset_allocated = START_QNUM; + + if( (calls = malloc(START_QNUM * sizeof (int))) == NULL) { + perror("ERROR allocating initial space for train.depth"); exit(1); + } + depth_allocated = START_QNUM; +#if defined __linux__ || defined _GNU_SOURCE + while( (read_len = getline(&line,&line_len,fptrIN)) != -1 ) +#endif +#ifdef __APPLE__ + while( (line = fgetln(fptrIN,&line_len)) != NULL ) +#endif + { + line[line_len-1] = '\0'; + depth = 0; + nref = 0; + col_ptr = NULL; + for(col_num = 0, col_str = line; ; col_num++, col_str = NULL) { + col = strtok_r(col_str, "\t", &col_ptr); + if(col == NULL) { + break; + } + if(col_num == 0) { + chr = col; + } else if(col_num == 1) { + pos = col; + pos_int = strtol(pos, NULL, 10); + } else if(col_num == 2) { + ref = col; + } else if(col_num == 3) { + depth = atoi(col); + if(depth > depth_allocated) { + if( (calls = realloc(calls, sizeof (int) * (depth + START_QNUM))) == NULL) { + perror("ERROR allocating space for calls"); exit(1); + } + depth_allocated = depth + START_QNUM; + } + } else if(col_num == 4) { + if(params->input_type == M_PILEUP) + col = col+sizeof(char); + snvmixGetCallString(col, calls, depth, &nref); + } else if(col_num == 5) { + bQ = col; + // If it's a MAQ pileup, we need to skip the @ sign + if(params->input_type == M_PILEUP) + bQ = bQ + sizeof(char); + for(call_i = 0; call_i < depth; call_i++) + bQ[call_i] = bQ[call_i]-33; + } else if(col_num == 6) { + mQ = col; + // If it's a MAQ pileup, we need to skip the @ sign + if(params->input_type == M_PILEUP) + mQ = mQ + sizeof(char); + for(call_i = 0; call_i < depth; call_i++) + mQ[call_i] = mQ[call_i]-33; + } + } + if(line_num >= trainset_allocated) { + if( ( params->trainP.bQ = realloc(params->trainP.bQ, (line_num + START_QNUM) * sizeof (unsigned char *)) ) == NULL ) { + perror("ERROR reallocating space for trainP.bQ"); exit(1); + } + if( ( params->trainP.mQ = realloc(params->trainP.mQ, (line_num + START_QNUM) * sizeof (unsigned char *)) ) == NULL ) { + perror("ERROR reallocating space for trainP.mQ"); exit(1); + } + if( ( params->trainP.calls = realloc(params->trainP.calls, (line_num + START_QNUM) * sizeof (signed char *)) ) == NULL) { + perror("ERROR reallocating space for trainP.calls"); exit(1); + } + if( ( params->trainP.depth = realloc(params->trainP.depth, (line_num + START_QNUM) * sizeof (int)) ) == NULL) { + perror("ERROR reallocating space for trainP.depth"); exit(1); + } + trainset_allocated = line_num + START_QNUM; + } + + nref = snvmixFilterCalls(calls,depth,bQ,mQ,params); + nref_count = 0; + ref_count = 0; + for(qual_num = 0; qual_num < depth; qual_num++) { + if(calls[qual_num] == -1) + continue; + if(calls[qual_num] == 1) + ref_count++; + if(calls[qual_num] == nref) + nref_count++; + } + params->trainP.depth[line_num] = ref_count + nref_count; + + if( (params->trainP.bQ[line_num] = malloc(sizeof(unsigned char) * params->trainP.depth[line_num])) == NULL ) { + perror("ERROR allocating space for trainP.bQ"); exit(1); + } + if( (params->trainP.mQ[line_num] = malloc(sizeof(unsigned char) * params->trainP.depth[line_num])) == NULL ) { + perror("ERROR allocating space for trainP.mQ"); exit(1); + } + if( (params->trainP.calls[line_num] = malloc(sizeof(signed char) * params->trainP.depth[line_num])) == NULL ) { + perror("ERROR allocating space for trainP.calls"); exit(1); + } + + call_i = 0; + for(qual_num = 0; qual_num < depth; qual_num++) { + if(calls[qual_num] == -1) + continue; + + params->trainP.calls[line_num][call_i] = (signed char) calls[qual_num]; + params->trainP.bQ[line_num][call_i] = (unsigned char) bQ[qual_num]; + params->trainP.mQ[line_num][call_i] = (unsigned char) mQ[qual_num]; + call_i++; + } + if( params->trainP.depth[line_num] != call_i ) { + fprintf(stderr, "ERROR: mismatch between trainP.depth and call_i\n"); exit(1); + } + line_num++; + } + params->trainP.len = line_num; + params->trainP.len = line_num; + fclose(fptrIN); + free(line); free(calls); +} + +// Use EM algorithm on a memory-located data set to train the parameters +void snvmixTrain_pileup(param_struct *params) { + int line_num = 0, call_i = 0, k = 0, states; + int iter = 0; + FILE *fptrOUT; + + long double phred[PHRED_MAX + 1]; + long double bsum = 0, msum = 0, *b, *mu, *notmu, *pi, *log_pi, z = 0; + long double **pG, **xr; + long double *xrhat, *sum_pG; + long double Y, not_Y, M; + int N_sum; + int strength; + + long double ll, prev_ll = 0; + //initPhred(phred, PHRED_MAX+1); + initPhred(phred, PHRED_MAX); + + states = params->states; + + // Initialize local values of parameters + mu = params->mu; + pi = params->pi; + + if( ( b = malloc(states * sizeof(long double)) ) == NULL) { perror("[snvmixClassify_pileup] Could not allocate b\n"); exit(1); } + if( ( notmu = malloc(states * sizeof(long double)) ) == NULL) { perror("[snvmixClassify_pileup] Could not allocate notmu\n"); exit(1); } + if( ( log_pi = malloc(states * sizeof(long double)) ) == NULL) { perror("[snvmixClassify_pileup] Could not allocate log_pi\n"); exit(1); } + if( ( xrhat = malloc(states * sizeof(long double)) ) == NULL) { perror("[snvmixClassify_pileup] Could not allocate xrhat\n"); exit(1); } + if( ( sum_pG = malloc(states * sizeof(long double)) ) == NULL) { perror("[snvmixClassify_pileup] Could not allocate sum_pG\n"); exit(1); } + + snvmixGetTrainSet_pileup(params); + + if(params->debug) { + for(line_num = 0; line_num < params->trainP.len; line_num++) { + fprintf(stderr, "line_num: %d", line_num); + for(call_i = 0; call_i < params->trainP.depth[line_num]; call_i++) { + fprintf(stderr, "\t(%d,bQ%d,mQ%d)", params->trainP.calls[line_num][call_i], params->trainP.bQ[line_num][call_i], params->trainP.mQ[line_num][call_i]); + } + fprintf(stderr, "\n\n"); + } + } + // Initialize mu and pi + + fprintf(stderr, "Initializing mu\n"); + for(k = 0; k < states; k++) { + params->mu[k] = (long double) params->trainP.alpha[k] / (params->trainP.alpha[k] + params->trainP.beta[k]); + fprintf(stderr,"\talpha[%d] = %Lf,\tbeta[%d] = %Lf,\tmu[%d] = %Lf\n", k, params->trainP.alpha[k], k, params->trainP.beta[k], k, params->mu[k]); + } + + fprintf(stderr, "Initializing pi\n"); + z = (long double) params->trainP.delta[0] + params->trainP.delta[1] + params->trainP.delta[2]; + if(!z) { z = 1; } + for(k = 0; k < states; k++) { + params->pi[k] = (long double) params->trainP.delta[k] / z; + fprintf(stderr,"\tdelta[%d] = %Lf,\tpi[%d] = %Lf\n", k, params->trainP.delta[k], k, params->pi[k]); + } + + strength = params->trainP.len; + + // Initialize matrices + if( (pG = malloc(sizeof(long double *) * params->trainP.len)) == NULL) { + perror("ERROR allocating initial space for pG"); exit(1); + } + if( (xr = malloc(sizeof(long double *) * params->trainP.len)) == NULL) { + perror("ERROR allocating initial space for xr"); exit(1); + } + for(line_num = 0; line_num < params->trainP.len; line_num++) { + // [states] cells for each line_num + if( (pG[line_num] = malloc(sizeof(long double) * states)) == NULL) { + perror("ERROR allocating space for pG"); exit(1); + } + if( (xr[line_num] = malloc(sizeof(long double) * states)) == NULL) { + perror("ERROR allocating space for xr"); exit(1); + } + } + + for(iter = 0; iter < params->trainP.max_iter; iter++) { + // Reset values for this iteration + for(k = 0; k < states; k++) { + notmu[k] = 1 - mu[k]; + log_pi[k] = logl(pi[k]); + + sum_pG[k] = 0; + xrhat[k] = 0; + + } + N_sum = 0; + ll = 0; + + // E step + for(line_num = 0; line_num < params->trainP.len; line_num++) { + if(params->trainP.depth == 0) + continue; + for(k = 0; k < states; k++) { + xr[line_num][k] = 0; + b[k] = 0; + } + + for(call_i = 0; call_i < params->trainP.depth[line_num]; call_i++) { + if(params->trainP.calls[line_num][call_i] == 1) { + Y = phred[params->trainP.bQ[line_num][call_i]]; + not_Y = 1-phred[params->trainP.bQ[line_num][call_i]]; + } else { + Y = (1-phred[params->trainP.bQ[line_num][call_i]])/3; + not_Y = phred[params->trainP.bQ[line_num][call_i]] + 2*(1-phred[params->trainP.bQ[line_num][call_i]])/3; + } + M = phred[params->trainP.mQ[line_num][call_i]]; + for(k = 0; k < states; k++) { + b[k] = b[k] + logl( (1 - M) * 0.5 + M * (Y * mu[k] + not_Y * notmu[k]) ); + xr[line_num][k] = xr[line_num][k] + Y; + } + } + z = 0; + for(k = 0; k < states; k++) { + b[k] = expl(b[k] + log_pi[k]); + z = z + b[k]; + } + if(!z) { z=1; } + for(k = 0; k < states; k++) { + pG[line_num][k] = b[k] / z; + } + + ll = ll + logl(z); + + N_sum = N_sum + params->trainP.depth[line_num]; + + for(k = 0; k < states; k++) { + sum_pG[k] = sum_pG[k] + pG[line_num][k]; + xrhat[k] = xrhat[k] + xr[line_num][k] * pG[line_num][k]; + } + } + + // Check log likelihood + if(iter == 0) + prev_ll = ll; + else if(ll <= prev_ll) + break; + prev_ll = ll; + + // M step + z = 0; + for(k = 0; k < states; k++) { + z = z + sum_pG[k] + params->trainP.delta[k]; + } + if(!z) { z=1; } + for(k = 0; k < states; k++) { + // Update pi + params->pi[k] = (sum_pG[k] + params->trainP.delta[k]) / z; + // Update mu + params->mu[k] = (xrhat[k] + params->trainP.alpha[k]*strength-1) / (N_sum + params->trainP.alpha[k]*strength + params->trainP.beta[k]*strength-2); + } + } + + if(params->modelfile == NULL) { + fptrOUT = stdout; + } else { + fptrOUT = fopen(params->modelfile, "w"); + if(fptrOUT == NULL) { + perror("ERROR: could not open modelfile for writing, using STDOUT"); + fptrOUT = stdout; + } + } + fprintf(fptrOUT,"mu"); + for(k = 0; k < states; k++) { + fprintf(fptrOUT, " %0.30Lf", params->mu[k]); + } + fprintf(fptrOUT,"\n"); + fprintf(fptrOUT,"pi"); + for(k = 0; k < states; k++) { + fprintf(fptrOUT, " %0.30Lf", params->pi[k]); + } + fprintf(fptrOUT,"\n"); + + /* free unused memory */ + free(b); free(notmu); free(log_pi); + free(xrhat); free(sum_pG); + for(line_num = 0; line_num < params->trainP.len; line_num++) { + // free [states] cells for each line_num + free(pG[line_num]); + free(xr[line_num]); + } + free(pG); free(xr); +} +
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/SNV/SNVMix2_source/SNVMix2-v0.12.1-rc1/SNVMix2.h Wed Oct 12 19:50:38 2011 -0400 @@ -0,0 +1,234 @@ +/* The MIT License + + Copyright (c) 2009, by Sohrab Shah <sshah@bccrc.ca> and Rodrigo Goya <rgoya@bcgsc.ca> + + Permission is hereby granted, free of charge, to any person obtaining + a copy of this software and associated documentation files (the + "Software"), to deal in the Software without restriction, including + without limitation the rights to use, copy, modify, merge, publish, + distribute, sublicense, and/or sell copies of the Software, and to + permit persons to whom the Software is furnished to do so, subject to + the following conditions: + + The above copyright notice and this permission notice shall be + included in all copies or substantial portions of the Software. + + THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, + EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF + MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND + NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS + BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN + ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN + CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE + SOFTWARE. +*/ +#include <stdio.h> +#include <stdlib.h> +#include <string.h> +#include <math.h> +#include <unistd.h> +#include <stdbool.h> +#include "sam.h" +#include "faidx.h" +#include "khash.h" + +#define TYPE_mb 0 +#define TYPE_m 1 +#define TYPE_b 2 +#define TYPE_M 3 +#define TYPE_Mb 4 +#define TYPE_MB 5 +#define TYPE_SNVMix1 6 + +#define Q_PILEUP 0 +#define M_PILEUP 1 +#define S_PILEUP 2 +#define BAM_FILE 3 + +#define PHRED_MAX 200 + +#define N 0 +#define A 1 +#define G 2 +#define C 3 +#define T 4 + +char base_code[] = {'N','A','G','C','T'}; + +struct params_train { + long double *alpha; + long double *beta; + long double *delta; + char *param_file; + int max_iter; + unsigned char **bQ; + unsigned char **mQ; + signed char **calls; + char *ref; + int *pos; + int *depth; + int len; +}; + +typedef struct { + FILE *input; + FILE *output; + char *inputfile; + char *outputfile; + char *modelfile; + char *bamfile; + char *fastafile; + char *listfile; + int filter_type; + int filter_chast; + int filter_dup; + int train; + int classify; + int filter; + int full; + int input_type; // 0 = processed, 1 = maq pileup, 2 = sam pileup + long double *mu; + long double *pi; + int max_iter; + int bQ; + int mQ; + int debug; + //struct { + // int alpha[3]; + // int beta[3]; + //} train; + struct params_train trainP; + int states; + int window; +} param_struct; + +typedef int *indel_list_t; +KHASH_MAP_INIT_INT64(64, indel_list_t) + +typedef struct{ + bool in_use; + uint32_t tid; // get with snvmix_pl->in->header->target_name[tid], + uint32_t pos; + char ref; + char nref; + int ref_count; + int nref_count; + long double *p; + int maxP; + // 0 = REF , 1 = NREF + int forward[2]; + int reverse[2]; + int good_pair[2]; + int bad_pair[2]; + int c_clean[2]; + int c_ins[2]; + int c_del[2]; + int c_junc[2]; + int nref_edges; // FIXME: fixed 5 bp edges + int nref_center; // + int indel_pos; // How many reads have a deletion at that site + int indel_near; // How many reasd have a deletion overall + int aln_unique_pos; + int full_depth; // Full depth at this position + int raw_cvg[5]; + int thr_cvg[5]; +} snvmix_call_t; + +typedef struct { + param_struct *params; + int begin, end; + samfile_t *in; + faidx_t *fai; + int tid, len; + char *ref; + /* might want to move this elsewhere */ + khash_t(64) *hash; + long double *notmu, *log_pi, *b; + long double phred[PHRED_MAX + 1]; + int *calls, depth_allocated; + snvmix_call_t *buffer; + int n_buffer, b_start, b_end; + // Extra flags +} snvmix_pl_t; + + +void updatePhred(long double *phredTable); +void initPhred(long double *phredTable, int elem); + +void resetParams(param_struct *params); +void initSNVMix(int argc , char **argv, param_struct *params); +void usage(char *selfname); + +void allocateParameters(param_struct *params); +void setTrainingParameters(param_struct *params); +void setClassificationParameters(param_struct *params); +void readParamFile(param_struct *params, char type); + + +void snvmixClassify_qualities(param_struct *params); +void snvmixClassify_pileup(param_struct *params); + +int snvmixClassify_bamfile(param_struct *params); +static int snvmixClassify_pileup_func(uint32_t tid, uint32_t pos, int n, const bam_pileup1_t *pl, void *data); + +inline void snvmixGetCallString(char *col, int *calls, int depth, char *nref); + +inline int snvmixFilterCalls(int *calls, int depth, char *bQ, char *mQ, param_struct *params); +inline int snvmixSkipCall(int *calls, int qual_num, param_struct *params, char *bQ, char *mQ); +inline int snvmixSkipCall_alt(param_struct *params, int call, char bQ, char mQ); + +void snvmixTrain_qualities(param_struct *params); +void snvmixGetTrainSet_pileup(param_struct *params); +void snvmixTrain_pileup(param_struct *params); + +long double normalise(long double *values, int len); + +char **__bam_get_lines(const char *fn, int *_n); +static khash_t(64) *load_pos(const char *fn, bam_header_t *h) +{ + char **list; + int i, j, n, *fields, max_fields; + khash_t(64) *hash; + bam_init_header_hash(h); + list = __bam_get_lines(fn, &n); + fprintf(stderr,"got %d lines\n", n); + hash = kh_init(64); + max_fields = 0; fields = 0; + for (i = 0; i < n; ++i) { + char *str = list[i]; + int chr, n_fields, ret; + khint_t k; + uint64_t x; + n_fields = ksplit_core(str, 0, &max_fields, &fields); + if (n_fields < 2) continue; + chr = bam_get_tid(h, str + fields[0]); + if (chr < 0) { + fprintf(stderr, "[load_pos] unknown reference sequence name: %s\n", str + fields[0]); + continue; + } + x = (uint64_t)chr << 32 | (atoi(str + fields[1]) - 1); + k = kh_put(64, hash, x, &ret); + if (ret == 0) { + fprintf(stderr, "[load_pos] position %s:%s has been loaded.\n", str+fields[0], str+fields[1]); + continue; + } + kh_val(hash, k) = 0; + if (n_fields > 2) { + // count + for (j = 2; j < n_fields; ++j) { + char *s = str + fields[j]; + if ((*s != '+' && *s != '-') || !isdigit(s[1])) break; + } + if (j > 2) { // update kh_val() + int *q, y, z; + q = kh_val(hash, k) = (int*)calloc(j - 1, sizeof(int)); + q[0] = j - 2; z = j; y = 1; + for (j = 2; j < z; ++j) + q[y++] = atoi(str + fields[j]); + } + } + free(str); + } + free(list); free(fields); + return hash; +}
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/SNV/SNVMix2_source/SNVMix2-v0.12.1-rc1/build_tmp.sh Wed Oct 12 19:50:38 2011 -0400 @@ -0,0 +1,6 @@ +#!/bin/bash + +cd samtools-0.1.6 +make +cd .. +make
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/SNV/SNVMix2_source/SNVMix2-v0.12.1-rc1/misc/snvmix2summary.pl Wed Oct 12 19:50:38 2011 -0400 @@ -0,0 +1,64 @@ +#!/usr/bin/perl + +use strict; + +use Getopt::Std; +my $opt_string = 'hi:c:t:'; +my %opt; +getopts( "$opt_string", \%opt ) or usage(); +usage() if $opt{h}; +my $SNVMIX_FILE = "-"; +$SNVMIX_FILE = $opt{i} if $opt{i}; +my $TYPE = 2; +$TYPE = $opt{c} if $opt{c}; +my $THRESHOLD = 0; +$THRESHOLD = $opt{t} if $opt{t}; +if($TYPE != 2 && $TYPE != 3) { die("ERROR: Unknown class TYPE\n"); } + +print STDERR "Reading from ".($SNVMIX_FILE eq "-" ? "STDIN" : $SNVMIX_FILE)."\n"; +print STDERR "Calculating for max between AA".($TYPE == 2 ? " and {AB u BB}" : ", AB and BB")."\n"; +if($THRESHOLD) { + print STDERR "Applying threshold of $THRESHOLD, reporting only if ".($TYPE == 2 ? "P{AB u BB}" : "(P{AB} || P{BB})")." >= $THRESHOLD\n"; +} + +open(INPUT, "<$SNVMIX_FILE") || die("ERROR: Could not open '$SNVMIX_FILE' for reading\n"); +while(<INPUT>) { + chomp; + s/ //; + my $line = $_; + my ($chr_pos, $ref, $nref, $call_str, @extra) = split(/\t/, $line); + my ($ref_num, $nref_num, $pAA, $pAB, $pBB, $call) = split(/,/, $call_str); + my $snv = 0; + if($TYPE == 2) { + if($pAA < ($pAB + $pBB)) { + if( ($pAB + $pBB) >= $THRESHOLD) { + $snv = 1; + } + } + } elsif($TYPE == 3) { + if($call == 2 || $call == 3) { + if( $pAB >= $THRESHOLD || $pBB >= $THRESHOLD) { + $snv = 1; + } + } + } else { + die("ERROR, and a weird one, script shouldn't even BE in here...\n"); + } + if($snv) { + #print "$chr_pos\t$ref\t".( $snv ? $nref : "-")."\t$snv\n"; + print "$line\n"; + } +} +close(INPUT); + +sub usage() { + print "Syntax:\n"; + print "$0 [-i <file>] -c <TYPE> [-t <THRESHOLD>]\n"; + print "\tIf file not given, STDIN is read\n"; + print "\tTYPE is the number of classes to consider\n"; + print "\t\t'2'\tconsiders only AA and {AB U BB} (default)\n"; + print "\t\t'3'\tconsiders AA, AB and BB\n"; + print "\tIf -t THRESHOLD is given, then SNVs will be reported\n"; + print "\twhen the selected probability exceeds this\n"; + exit; +}
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/SNV/SNVMix2_source/SNVMix2-v0.12.1-rc1/notes.h Wed Oct 12 19:50:38 2011 -0400 @@ -0,0 +1,92 @@ +/* + * File: notes.h + * Author: rgoya + * + * Created on February 3, 2010, 12:37 PM + */ + +/*! @typedef +@abstract Structure for one alignment covering the pileup position. +@field b pointer to the alignment +@field qpos position of the read base at the pileup site, 0-based +@field indel indel length; 0 for no indel, positive for ins and negative for del +@field is_del 1 iff the base on the padded read is a deletion +@field level the level of the read in the "viewer" mode + +@discussion See also bam_plbuf_push() and bam_lplbuf_push(). The +difference between the two functions is that the former does not +set bam_pileup1_t::level, while the later does. Level helps the +implementation of alignment viewers, but calculating this has some +overhead. +*/ +typedef struct { + bam1_t *b; + int32_t qpos; + int indel, level; + uint32_t is_del:1, is_head:1, is_tail:1; +} bam_pileup1_t; + +/*! @typedef + @abstract Structure for core alignment information. + @field tid chromosome ID, defined by bam_header_t + @field pos 0-based leftmost coordinate + @field strand strand; 0 for forward and 1 otherwise + @field bin bin calculated by bam_reg2bin() + @field qual mapping quality + @field l_qname length of the query name + @field flag bitwise flag + @field n_cigar number of CIGAR operations + @field l_qseq length of the query sequence (read) + */ +typedef struct { + int32_t tid; + int32_t pos; + uint32_t bin:16, qual:8, l_qname:8; + uint32_t flag:16, n_cigar:16; + int32_t l_qseq; + int32_t mtid; + int32_t mpos; + int32_t isize; +} bam1_core_t; + +/*! @typedef + @abstract Structure for one alignment. + @field core core information about the alignment + @field l_aux length of auxiliary data + @field data_len current length of bam1_t::data + @field m_data maximum length of bam1_t::data + @field data all variable-length data, concatenated; structure: cigar-qname-seq-qual-aux + + @discussion Notes: + + 1. qname is zero tailing and core.l_qname includes the tailing '\0'. + 2. l_qseq is calculated from the total length of an alignment block + on reading or from CIGAR. + */ +typedef struct { + bam1_core_t core; + int l_aux, data_len, m_data; + uint8_t *data; +} bam1_t; + + +/*! @typedef +@abstract Structure for one alignment covering the pileup position. +@field b pointer to the alignment +@field qpos position of the read base at the pileup site, 0-based +@field indel indel length; 0 for no indel, positive for ins and negative for del +@field is_del 1 iff the base on the padded read is a deletion +@field level the level of the read in the "viewer" mode + +@discussion See also bam_plbuf_push() and bam_lplbuf_push(). The +difference between the two functions is that the former does not +set bam_pileup1_t::level, while the later does. Level helps the +implementation of alignment viewers, but calculating this has some +overhead. +*/ +typedef struct { + bam1_t *b; + int32_t qpos; + int indel, level; + uint32_t is_del:1, is_head:1, is_tail:1; +} bam_pileup1_t;
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/SNV/SNVMix2_source/SNVMix2-v0.12.1-rc1/samtools-0.1.6/AUTHORS Wed Oct 12 19:50:38 2011 -0400 @@ -0,0 +1,16 @@ +Heng Li from the Sanger Institute wrote most of the initial source codes +of SAMtools and various converters. + +Bob Handsaker from the Broad Institute is a major contributor to the +SAM/BAM specification. He designed and implemented the BGZF format, the +underlying indexable compression format for the BAM format. BGZF does +not support arithmetic between file offsets. + +Jue Ruan for the Beijing Genome Institute designed and implemented the +RAZF format, an alternative indexable compression format. RAZF supports +arithmetic between file offsets, at the cost of increased index file +size and the full compatibility with gzip. RAZF is optional and only +used in `faidx' for indexing RAZF compressed fasta files. + +Colin Hercus updated novo2sam.pl to support gapped alignment by +novoalign.
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/SNV/SNVMix2_source/SNVMix2-v0.12.1-rc1/samtools-0.1.6/COPYING Wed Oct 12 19:50:38 2011 -0400 @@ -0,0 +1,21 @@ +The MIT License + +Copyright (c) 2008-2009 Genome Research Ltd. + +Permission is hereby granted, free of charge, to any person obtaining a copy +of this software and associated documentation files (the "Software"), to deal +in the Software without restriction, including without limitation the rights +to use, copy, modify, merge, publish, distribute, sublicense, and/or sell +copies of the Software, and to permit persons to whom the Software is +furnished to do so, subject to the following conditions: + +The above copyright notice and this permission notice shall be included in +all copies or substantial portions of the Software. + +THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR +IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, +FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE +AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER +LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, +OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN +THE SOFTWARE. \ No newline at end of file
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/SNV/SNVMix2_source/SNVMix2-v0.12.1-rc1/samtools-0.1.6/ChangeLog Wed Oct 12 19:50:38 2011 -0400 @@ -0,0 +1,2657 @@ +------------------------------------------------------------------------ +r451 | lh3lh3 | 2009-09-02 10:44:48 +0100 (Wed, 02 Sep 2009) | 4 lines +Changed paths: + M /trunk/samtools/bam_md.c + M /trunk/samtools/bam_rmdup.c + M /trunk/samtools/bam_rmdupse.c + M /trunk/samtools/bam_sort.c + M /trunk/samtools/bamtk.c + M /trunk/samtools/samtools.1 + + * samtools-0.1.5-34 (r451) + * applied the patch by John + * improved the help message a little bit + +------------------------------------------------------------------------ +r450 | lh3lh3 | 2009-09-02 09:55:55 +0100 (Wed, 02 Sep 2009) | 3 lines +Changed paths: + M /trunk/samtools/bam_color.c + M /trunk/samtools/bamtk.c + + * samtools-0.1.5-33 (r450) + * fixed a bug in bam_color.c (on behalf of Nils Homer) + +------------------------------------------------------------------------ +r449 | lh3lh3 | 2009-08-29 20:36:41 +0100 (Sat, 29 Aug 2009) | 4 lines +Changed paths: + M /trunk/samtools/bam_import.c + M /trunk/samtools/bam_md.c + M /trunk/samtools/bamtk.c + M /trunk/samtools/misc/samtools.pl + + * samtools-0.1.5-32 (r449) + * fillmd: fixed a bug in modifying MD/NM tags + * in import, give a warning if the read is aligned but there is no CIGAR. + +------------------------------------------------------------------------ +r448 | lh3lh3 | 2009-08-19 09:44:28 +0100 (Wed, 19 Aug 2009) | 3 lines +Changed paths: + M /trunk/samtools/ChangeLog + M /trunk/samtools/bam_pileup.c + M /trunk/samtools/bamtk.c + M /trunk/samtools/misc/wgsim_eval.pl + + * samtools-0.1.5-31 (r448) + * fixed an issue when the last CIGAR is I or D + +------------------------------------------------------------------------ +r447 | lh3lh3 | 2009-08-17 09:34:57 +0100 (Mon, 17 Aug 2009) | 3 lines +Changed paths: + M /trunk/samtools/bam_aux.c + M /trunk/samtools/bamtk.c + + * samtools-0.1.5-30 (r447) + * fixed a bug in bam_aux_get(): 'A' is not checked + +------------------------------------------------------------------------ +r446 | lh3lh3 | 2009-08-17 09:33:17 +0100 (Mon, 17 Aug 2009) | 2 lines +Changed paths: + M /trunk/samtools/bam_aux.c + M /trunk/samtools/bamtk.c + + * + +------------------------------------------------------------------------ +r444 | lh3lh3 | 2009-08-11 10:02:36 +0100 (Tue, 11 Aug 2009) | 3 lines +Changed paths: + M /trunk/samtools/bam_sort.c + M /trunk/samtools/bamtk.c + + * samtools-0.1.5-28 (r444) + * bug in "merge -n" + +------------------------------------------------------------------------ +r443 | lh3lh3 | 2009-08-11 09:29:11 +0100 (Tue, 11 Aug 2009) | 4 lines +Changed paths: + M /trunk/samtools/bam.c + M /trunk/samtools/bam_import.c + M /trunk/samtools/bamtk.c + + * samtools-0.1.5-27 (r443) + * SEQ and QUAL can be "*" + * parse CIGAR "=" and "X" as "M" + +------------------------------------------------------------------------ +r442 | lh3lh3 | 2009-08-07 21:56:38 +0100 (Fri, 07 Aug 2009) | 4 lines +Changed paths: + M /trunk/samtools/bam_pileup.c + M /trunk/samtools/bamtk.c + M /trunk/samtools/misc/md5.c + M /trunk/samtools/misc/md5.h + M /trunk/samtools/misc/md5fa.c + + * samtools-0.1.5-26 (r442) + * replace RSA Inc md5.* with ones under permissive lincense + * fixed a bug in detecting unsorted bam in pileup + +------------------------------------------------------------------------ +r441 | bhandsaker | 2009-08-05 14:41:28 +0100 (Wed, 05 Aug 2009) | 2 lines +Changed paths: + M /trunk/samtools/bgzf.c + M /trunk/samtools/bgzf.h + M /trunk/samtools/bgzip.c + +Change copyright notices now that MIT has approved open source distribution. + +------------------------------------------------------------------------ +r440 | lh3lh3 | 2009-08-05 10:44:24 +0100 (Wed, 05 Aug 2009) | 3 lines +Changed paths: + M /trunk/samtools/bam_stat.c + M /trunk/samtools/bamtk.c + + * samtools-0.1.5-25 (r436) + * in flagstats, do not report singletons if both ends are unmapped + +------------------------------------------------------------------------ +r439 | lh3lh3 | 2009-08-04 22:16:51 +0100 (Tue, 04 Aug 2009) | 2 lines +Changed paths: + M /trunk/samtools/misc/maq2sam.c + +fixed a SERIOUS bug in setting 0x20 flag + +------------------------------------------------------------------------ +r438 | lh3lh3 | 2009-08-04 21:50:43 +0100 (Tue, 04 Aug 2009) | 2 lines +Changed paths: + M /trunk/samtools/misc/samtools.pl + +fixed two minor bugs (suggested by Tim M Storm) + +------------------------------------------------------------------------ +r437 | lh3lh3 | 2009-08-04 09:13:24 +0100 (Tue, 04 Aug 2009) | 3 lines +Changed paths: + M /trunk/samtools/bamtk.c + M /trunk/samtools/misc/samtools.pl + M /trunk/samtools/sam_view.c + + * samtools-0.1.5-24 (r435) + * fixed a typo + +------------------------------------------------------------------------ +r434 | lh3lh3 | 2009-08-03 10:40:42 +0100 (Mon, 03 Aug 2009) | 3 lines +Changed paths: + M /trunk/samtools/bam_tview.c + M /trunk/samtools/bamtk.c + + * samtools-0.1.5-23 (r434) + * in tview, press 'r' to show read names rather than sequences + +------------------------------------------------------------------------ +r433 | lh3lh3 | 2009-08-02 19:13:35 +0100 (Sun, 02 Aug 2009) | 3 lines +Changed paths: + M /trunk/samtools/knetfile.c + + * tried to fixed the buggy FTP random access in Windows. FAILED. + * anyway, MinGW seems to have problem with "%lld". + +------------------------------------------------------------------------ +r432 | lh3lh3 | 2009-08-02 00:32:07 +0100 (Sun, 02 Aug 2009) | 5 lines +Changed paths: + M /trunk/samtools/Makefile.mingw + M /trunk/samtools/bamtk.c + M /trunk/samtools/faidx.c + M /trunk/samtools/razf.c + A /trunk/samtools/win32/libcurses.a + A /trunk/samtools/win32/xcurses.h + + * samtools-0.1.5-22 (r432) + * faidx: fixed compitability issue with _WIN32 + * razf: fixed potential compitability issue with _WIN32 + * PDCurses support in Windows + +------------------------------------------------------------------------ +r431 | lh3lh3 | 2009-08-01 23:34:54 +0100 (Sat, 01 Aug 2009) | 2 lines +Changed paths: + M /trunk/samtools/win32/libz.a + +replace the GnuWin32 version of libz.a with my own build with MinGW. + +------------------------------------------------------------------------ +r430 | lh3lh3 | 2009-08-01 23:21:07 +0100 (Sat, 01 Aug 2009) | 2 lines +Changed paths: + M /trunk/samtools/knetfile.c + +add comments + +------------------------------------------------------------------------ +r429 | lh3lh3 | 2009-08-01 22:41:19 +0100 (Sat, 01 Aug 2009) | 3 lines +Changed paths: + M /trunk/samtools/Makefile.mingw + M /trunk/samtools/bamtk.c + M /trunk/samtools/knetfile.c + M /trunk/samtools/knetfile.h + + * samtools-0.1.5-21 (r428) + * knetfile.c is now compatible with mingw-winsock + +------------------------------------------------------------------------ +r428 | lh3lh3 | 2009-08-01 00:39:07 +0100 (Sat, 01 Aug 2009) | 2 lines +Changed paths: + M /trunk/samtools/Makefile.mingw + +simplify MinGW Makefile + +------------------------------------------------------------------------ +r427 | lh3lh3 | 2009-08-01 00:30:54 +0100 (Sat, 01 Aug 2009) | 5 lines +Changed paths: + A /trunk/samtools/Makefile.mingw + M /trunk/samtools/bam_import.c + M /trunk/samtools/bamtk.c + A /trunk/samtools/win32 + A /trunk/samtools/win32/libz.a + A /trunk/samtools/win32/zconf.h + A /trunk/samtools/win32/zlib.h + + * samtools-0.1.5-20 (r427) + * MinGW support. At least SAM<->BAM conversion is working. Other + functionality are not tested at the moment. + * zlib headers and Windows version of libz.a are included in win32/ + +------------------------------------------------------------------------ +r426 | lh3lh3 | 2009-07-31 23:32:09 +0100 (Fri, 31 Jul 2009) | 3 lines +Changed paths: + M /trunk/samtools/bamtk.c + M /trunk/samtools/sam_view.c + + * samtools-0.1.5-19 (r426) + * fixed a bug caused by recent modifications. Sorry. + +------------------------------------------------------------------------ +r425 | lh3lh3 | 2009-07-31 23:23:51 +0100 (Fri, 31 Jul 2009) | 2 lines +Changed paths: + M /trunk/samtools/bgzf.c + +compatible with Windows binary files + +------------------------------------------------------------------------ +r424 | lh3lh3 | 2009-07-31 10:19:59 +0100 (Fri, 31 Jul 2009) | 5 lines +Changed paths: + M /trunk/samtools/bam_maqcns.c + M /trunk/samtools/bam_maqcns.h + M /trunk/samtools/bam_plcmd.c + M /trunk/samtools/bam_tview.c + M /trunk/samtools/bamtk.c + M /trunk/samtools/misc/samtools.pl + + * samtools-0.1.5-18 (r423) + * output additional information in pileup indel lines, for the purepose + of debugging at the moment + * in tview, optionally allow to treat reference skip as deletion + +------------------------------------------------------------------------ +r423 | lh3lh3 | 2009-07-30 22:00:36 +0100 (Thu, 30 Jul 2009) | 2 lines +Changed paths: + A /trunk/samtools/misc/psl2sam.pl + +convert BLAT psl to SAM. + +------------------------------------------------------------------------ +r422 | lh3lh3 | 2009-07-30 11:24:39 +0100 (Thu, 30 Jul 2009) | 6 lines +Changed paths: + M /trunk/samtools/ChangeLog + M /trunk/samtools/bam.c + M /trunk/samtools/bamtk.c + M /trunk/samtools/bgzf.c + M /trunk/samtools/bgzf.h + M /trunk/samtools/knetfile.c + M /trunk/samtools/sam.c + M /trunk/samtools/sam_view.c + + * samtools-0.1.5-17 (r422) + * fixed a but in knetfile.c when seek type is not SEEK_SET + * write an empty BGZF block to every BGZF file + * check BGZF EOF marker in bam_header_read() + * update ChangeLog + +------------------------------------------------------------------------ +r421 | lh3lh3 | 2009-07-30 10:03:39 +0100 (Thu, 30 Jul 2009) | 3 lines +Changed paths: + M /trunk/samtools/bam_import.c + M /trunk/samtools/bam_plcmd.c + M /trunk/samtools/bamtk.c + M /trunk/samtools/misc/samtools.pl + M /trunk/samtools/sam.c + M /trunk/samtools/sam.h + M /trunk/samtools/sam_view.c + + * samtools-0.1.5-16 (r421) + * in view and pileup, load header from FASTA index if the input is SAM. + +------------------------------------------------------------------------ +r420 | lh3lh3 | 2009-07-29 09:18:55 +0100 (Wed, 29 Jul 2009) | 2 lines +Changed paths: + M /trunk/samtools/misc/maq2sam.c + +do not set "read 1" if reads are not mapped in the PE mode of maq + +------------------------------------------------------------------------ +r419 | lh3lh3 | 2009-07-28 09:52:33 +0100 (Tue, 28 Jul 2009) | 5 lines +Changed paths: + M /trunk/samtools/bam_import.c + M /trunk/samtools/bamtk.c + M /trunk/samtools/misc/samtools.pl + M /trunk/samtools/misc/wgsim_eval.pl + + * samtools-0.1.5-15 (r419) + * in sam_open(), return NULL when the file cannot be opened. + * make wgsim_eval.pl more robust to imperfect SAM + * add "unique" command to samtools.pl + +------------------------------------------------------------------------ +r418 | lh3lh3 | 2009-07-24 14:04:19 +0100 (Fri, 24 Jul 2009) | 2 lines +Changed paths: + M /trunk/samtools/misc/wgsim_eval.pl + +skip @header lines in SAM + +------------------------------------------------------------------------ +r417 | lh3lh3 | 2009-07-24 12:42:38 +0100 (Fri, 24 Jul 2009) | 3 lines +Changed paths: + M /trunk/samtools/bamtk.c + M /trunk/samtools/sam_view.c + + * samtools-0.1.5-14 (r417) + * more help in "samtools view" due to the recent changes. + +------------------------------------------------------------------------ +r416 | lh3lh3 | 2009-07-24 12:34:30 +0100 (Fri, 24 Jul 2009) | 3 lines +Changed paths: + M /trunk/samtools/bam.c + M /trunk/samtools/bam.h + M /trunk/samtools/bam_import.c + M /trunk/samtools/bamtk.c + M /trunk/samtools/sam.c + M /trunk/samtools/sam.h + M /trunk/samtools/sam_view.c + + * samtools-0.1.5-17 (r416) + * support import/export SAM with string tags + +------------------------------------------------------------------------ +r415 | lh3lh3 | 2009-07-24 11:39:26 +0100 (Fri, 24 Jul 2009) | 3 lines +Changed paths: + M /trunk/samtools/bam.c + M /trunk/samtools/bam.h + M /trunk/samtools/bam_import.c + M /trunk/samtools/bamtk.c + M /trunk/samtools/sam.c + M /trunk/samtools/sam.h + M /trunk/samtools/sam_view.c + + * samtools-0.1.5-12 (r415) + * FLAG now can be in HEX + +------------------------------------------------------------------------ +r414 | lh3lh3 | 2009-07-22 22:03:49 +0100 (Wed, 22 Jul 2009) | 2 lines +Changed paths: + M /trunk/samtools/kstring.h + +fixed a compiling error (thank Ken for fixing it) + +------------------------------------------------------------------------ +r412 | lh3lh3 | 2009-07-21 22:19:40 +0100 (Tue, 21 Jul 2009) | 2 lines +Changed paths: + M /trunk/samtools/kstring.c + M /trunk/samtools/kstring.h + +Implemented Boyer-Moore search in the kstring library. + +------------------------------------------------------------------------ +r409 | lh3lh3 | 2009-07-17 17:10:20 +0100 (Fri, 17 Jul 2009) | 2 lines +Changed paths: + M /trunk/samtools/bam_index.c + +do not include knetfile.h when _USE_KNETFILE is not defined + +------------------------------------------------------------------------ +r408 | lh3lh3 | 2009-07-17 15:29:21 +0100 (Fri, 17 Jul 2009) | 5 lines +Changed paths: + M /trunk/samtools/bam_md.c + M /trunk/samtools/bam_tview.c + M /trunk/samtools/bamtk.c + M /trunk/samtools/bgzf.c + + * samtools-0.1.5-11 (r408) + * force to overwirte existing MD if it is different from the one calculated + from fillmd. + * bgzf.c: improved the compatibility with Windows headers + +------------------------------------------------------------------------ +r407 | lh3lh3 | 2009-07-17 14:46:56 +0100 (Fri, 17 Jul 2009) | 5 lines +Changed paths: + M /trunk/samtools/bam.h + M /trunk/samtools/bam_aux.c + M /trunk/samtools/bam_md.c + M /trunk/samtools/bamtk.c + M /trunk/samtools/sam.h + + * samtools-0.1.5-10 (r407) + * implemented bam_aux_del() to remove a tag + * fillmd: generate the NM tag + * fillmd: cmd interface improvement + +------------------------------------------------------------------------ +r406 | lh3lh3 | 2009-07-16 23:30:40 +0100 (Thu, 16 Jul 2009) | 2 lines +Changed paths: + M /trunk/samtools/Makefile + +Sorry. The old Makefile is for PDCurses... + +------------------------------------------------------------------------ +r405 | lh3lh3 | 2009-07-16 23:30:11 +0100 (Thu, 16 Jul 2009) | 3 lines +Changed paths: + M /trunk/samtools/Makefile + M /trunk/samtools/bam_tview.c + M /trunk/samtools/bamtk.c + + * samtools-0.1.5-9 (r405) + * improved the compatibility with PDCurses a little bit + +------------------------------------------------------------------------ +r404 | lh3lh3 | 2009-07-16 23:23:52 +0100 (Thu, 16 Jul 2009) | 3 lines +Changed paths: + M /trunk/samtools/Makefile + M /trunk/samtools/bam_tview.c + M /trunk/samtools/bamtk.c + + * samtools-0.1.5-8 (r404) + * compatible with PDCurses + +------------------------------------------------------------------------ +r403 | lh3lh3 | 2009-07-16 22:39:39 +0100 (Thu, 16 Jul 2009) | 3 lines +Changed paths: + M /trunk/samtools/bamtk.c + M /trunk/samtools/kseq.h + + * samtools-0.1.5-7 (r403) + * fixed a bug in kseq.h for binary files (text files are fine) + +------------------------------------------------------------------------ +r402 | lh3lh3 | 2009-07-16 11:49:53 +0100 (Thu, 16 Jul 2009) | 4 lines +Changed paths: + M /trunk/samtools/bam_import.c + M /trunk/samtools/bam_index.c + M /trunk/samtools/bamtk.c + M /trunk/samtools/bgzf.c + + * samtools-0.1.5-6 (r402) + * fixed compiling error when "-D_USE_NETFILE" is not applied + * improve portability to MinGW + +------------------------------------------------------------------------ +r398 | lh3lh3 | 2009-07-13 10:21:36 +0100 (Mon, 13 Jul 2009) | 3 lines +Changed paths: + A /trunk/bam-lite/bam.h (from /trunk/samtools/bam.h:395) + A /trunk/bam-lite/bam_lite.c (from /trunk/samtools/bam_lite.c:395) + D /trunk/samtools/bam_lite.c + + * move bam_lite.c to bam-lite + * copy bam.h to bam-lite + +------------------------------------------------------------------------ +r395 | lh3lh3 | 2009-07-13 10:12:57 +0100 (Mon, 13 Jul 2009) | 3 lines +Changed paths: + M /trunk/samtools/bam.h + M /trunk/samtools/bam_lite.c + M /trunk/samtools/bam_lpileup.c + M /trunk/samtools/bam_pileup.c + M /trunk/samtools/bamtk.c + + * samtools-0.1.5-5 (r395) + * added bam_pileup_file() and removed bam_lpileup_file() + +------------------------------------------------------------------------ +r394 | lh3lh3 | 2009-07-13 00:35:10 +0100 (Mon, 13 Jul 2009) | 3 lines +Changed paths: + M /trunk/samtools/bamtk.c + M /trunk/samtools/knetfile.c + M /trunk/samtools/knetfile.h + + * samtools-0.1.5-4 (r394) + * http_proxy support in knetfile library (check http_proxy ENV) + +------------------------------------------------------------------------ +r393 | lh3lh3 | 2009-07-12 23:57:07 +0100 (Sun, 12 Jul 2009) | 5 lines +Changed paths: + M /trunk/samtools/bam_index.c + M /trunk/samtools/bam_tview.c + M /trunk/samtools/bamtk.c + M /trunk/samtools/knetfile.c + M /trunk/samtools/knetfile.h + + * samtools-0.1.5-3 (r393) + * knetfile now supports HTTP (no proxy at the moment) + * fixed a potential issue in knetfile on opening ordinary file, although I have + not seen the sideeffect so far. + +------------------------------------------------------------------------ +r392 | lh3lh3 | 2009-07-12 18:50:55 +0100 (Sun, 12 Jul 2009) | 2 lines +Changed paths: + M /trunk/samtools/samtools.1 + +Remove the warning in tview + +------------------------------------------------------------------------ +r391 | lh3lh3 | 2009-07-12 18:42:43 +0100 (Sun, 12 Jul 2009) | 3 lines +Changed paths: + M /trunk/samtools/bam_tview.c + M /trunk/samtools/bamtk.c + + * samtools-0.1.5-2 (r391) + * do not show a blank screen when no reads mapped + +------------------------------------------------------------------------ +r390 | lh3lh3 | 2009-07-09 14:01:42 +0100 (Thu, 09 Jul 2009) | 4 lines +Changed paths: + M /trunk/samtools/bam.h + A /trunk/samtools/bam_lite.c + M /trunk/samtools/bamtk.c + + * samtools-0.1.5-1 (r390) + * removed useless _IOLIB in bam.h. This should cause no change at all. + * added bam_lite.c for light-weight BAM reading + +------------------------------------------------------------------------ +r385 | lh3lh3 | 2009-07-07 16:53:29 +0100 (Tue, 07 Jul 2009) | 2 lines +Changed paths: + M /trunk/samtools/bamtk.c + M /trunk/samtools/knetfile.c + +Release samtools-0.1.5c (fixed a bug in piping) + +------------------------------------------------------------------------ +r383 | lh3lh3 | 2009-07-07 11:39:55 +0100 (Tue, 07 Jul 2009) | 2 lines +Changed paths: + M /trunk/samtools/bamtk.c + M /trunk/samtools/sam.c + +Release samtools-0.1.5b (BUG! so embarrassing!) + +------------------------------------------------------------------------ +r381 | lh3lh3 | 2009-07-07 11:20:06 +0100 (Tue, 07 Jul 2009) | 2 lines +Changed paths: + M /trunk/samtools/Makefile + M /trunk/samtools/bam.h + M /trunk/samtools/bam_aux.c + M /trunk/samtools/bamtk.c + +Release samtools-0.1.5a (for compatibility with Bio::DB::Sam) + +------------------------------------------------------------------------ +r373 | lh3lh3 | 2009-07-07 10:26:57 +0100 (Tue, 07 Jul 2009) | 2 lines +Changed paths: + M /trunk/samtools/ChangeLog + M /trunk/samtools/NEWS + M /trunk/samtools/bamtk.c + M /trunk/samtools/samtools.1 + +Release samtools-0.1.5 + +------------------------------------------------------------------------ +r372 | lh3lh3 | 2009-07-07 09:49:27 +0100 (Tue, 07 Jul 2009) | 3 lines +Changed paths: + M /trunk/samtools/bamtk.c + M /trunk/samtools/sam.c + + * samtools-0.1.4-23 (r372) + * keep header text if "view -t" is used (by Gerton) + +------------------------------------------------------------------------ +r371 | lh3lh3 | 2009-07-07 01:13:32 +0100 (Tue, 07 Jul 2009) | 2 lines +Changed paths: + M /trunk/samtools/samtools.1 + +update documentation + +------------------------------------------------------------------------ +r370 | bhandsaker | 2009-07-02 22:24:34 +0100 (Thu, 02 Jul 2009) | 2 lines +Changed paths: + M /trunk/samtools/Makefile + +Introduced LIBPATH variable so this could be overridden to allow samtools to build correct at the Broad. + +------------------------------------------------------------------------ +r369 | lh3lh3 | 2009-07-02 13:36:53 +0100 (Thu, 02 Jul 2009) | 4 lines +Changed paths: + M /trunk/samtools/ChangeLog + M /trunk/samtools/bam_aux.c + M /trunk/samtools/bam_plcmd.c + M /trunk/samtools/bamtk.c + + * samtools-0.1.4-22 (r369) + * in pileup, optionally print E2 and U2 + * remove the debugging code in bam_aux_get() (Drat!) + +------------------------------------------------------------------------ +r368 | lh3lh3 | 2009-07-02 11:32:26 +0100 (Thu, 02 Jul 2009) | 6 lines +Changed paths: + M /trunk/samtools/bam.c + M /trunk/samtools/bam.h + M /trunk/samtools/bam_aux.c + M /trunk/samtools/bam_index.c + M /trunk/samtools/bam_lpileup.c + M /trunk/samtools/bam_md.c + M /trunk/samtools/bam_pileup.c + M /trunk/samtools/bam_rmdup.c + M /trunk/samtools/bam_stat.c + M /trunk/samtools/bam_tview.c + M /trunk/samtools/bamtk.c + M /trunk/samtools/faidx.c + M /trunk/samtools/faidx.h + M /trunk/samtools/glf.c + + * samtools-0.1.4-21 (r368) + * propagate errors rather than exit or complain assertion failure. Assertion + should be only used for checking internal bugs, but not for external input + inconsistency. I was just a bit lazy. + * small memory leak may be present on failure, though + +------------------------------------------------------------------------ +r367 | lh3lh3 | 2009-06-30 16:18:42 +0100 (Tue, 30 Jun 2009) | 2 lines +Changed paths: + M /trunk/samtools/knetfile.c + +reduce the chance of blocking in FTP connection + +------------------------------------------------------------------------ +r366 | lh3lh3 | 2009-06-30 15:35:21 +0100 (Tue, 30 Jun 2009) | 2 lines +Changed paths: + M /trunk/samtools/knetfile.c + +minor changes to knetfile: invalid fd equals -1 rather than 0 + +------------------------------------------------------------------------ +r365 | lh3lh3 | 2009-06-30 14:04:30 +0100 (Tue, 30 Jun 2009) | 3 lines +Changed paths: + M /trunk/samtools/bam_index.c + M /trunk/samtools/bamtk.c + M /trunk/samtools/knetfile.c + M /trunk/samtools/knetfile.h + + * samtools-0.1.4-20 (r365) + * download the BAM index file if it is not found in the current working directory. + +------------------------------------------------------------------------ +r364 | lh3lh3 | 2009-06-30 12:39:07 +0100 (Tue, 30 Jun 2009) | 3 lines +Changed paths: + M /trunk/samtools/bamtk.c + M /trunk/samtools/knetfile.c + + * samtools-0.1.4-19 (r364) + * knetfile: report error when the file is not present on FTP + +------------------------------------------------------------------------ +r363 | lh3lh3 | 2009-06-29 23:23:32 +0100 (Mon, 29 Jun 2009) | 4 lines +Changed paths: + M /trunk/samtools/bam_tview.c + M /trunk/samtools/bamtk.c + M /trunk/samtools/bgzf.c + M /trunk/samtools/bgzf.h + M /trunk/samtools/knetfile.c + M /trunk/samtools/knetfile.h + + * samtools-0.1.4-18 (r363) + * knetfile: do not trigger network communication in FTP seek (lazy seek) + * bgzf: cache recent blocks (disabled by default) + +------------------------------------------------------------------------ +r362 | lh3lh3 | 2009-06-25 21:04:34 +0100 (Thu, 25 Jun 2009) | 2 lines +Changed paths: + M /trunk/samtools/bgzf.c + +write changelog + +------------------------------------------------------------------------ +r361 | lh3lh3 | 2009-06-25 21:03:10 +0100 (Thu, 25 Jun 2009) | 3 lines +Changed paths: + M /trunk/samtools/bam_index.c + M /trunk/samtools/bamtk.c + + * samtools-0.1.4-17 (r361) + * if a file is given on FTP, search locally for the BAM index + +------------------------------------------------------------------------ +r360 | lh3lh3 | 2009-06-25 20:44:52 +0100 (Thu, 25 Jun 2009) | 5 lines +Changed paths: + M /trunk/samtools/Makefile + M /trunk/samtools/bam_import.c + M /trunk/samtools/bam_index.c + M /trunk/samtools/bamtk.c + M /trunk/samtools/bgzf.c + M /trunk/samtools/bgzf.h + M /trunk/samtools/knetfile.c + M /trunk/samtools/knetfile.h + + * samtools-0.1.4-16 (r360) + * report more information in index when the input is not sorted + * change the behaviour of knet_seek() such that it returns 0 on success + * support knetfile library in BGZF + +------------------------------------------------------------------------ +r359 | lh3lh3 | 2009-06-25 17:10:55 +0100 (Thu, 25 Jun 2009) | 2 lines +Changed paths: + M /trunk/samtools/knetfile.c + M /trunk/samtools/knetfile.h + +fixed bugs in knetfile.* + +------------------------------------------------------------------------ +r358 | lh3lh3 | 2009-06-25 13:53:19 +0100 (Thu, 25 Jun 2009) | 2 lines +Changed paths: + A /trunk/samtools/knetfile.h + +this is the header file + +------------------------------------------------------------------------ +r357 | lh3lh3 | 2009-06-25 13:52:03 +0100 (Thu, 25 Jun 2009) | 3 lines +Changed paths: + A /trunk/samtools/knetfile.c + + * open a file at FTP + * preliminary version + +------------------------------------------------------------------------ +r354 | lh3lh3 | 2009-06-24 14:02:25 +0100 (Wed, 24 Jun 2009) | 3 lines +Changed paths: + M /trunk/samtools/bam.c + M /trunk/samtools/bamtk.c + + * samtools-0.1.4-15 (r354) + * fixed a memory leak in bam_view1(), although samtools is not using this routine. + +------------------------------------------------------------------------ +r351 | lh3lh3 | 2009-06-18 00:16:26 +0100 (Thu, 18 Jun 2009) | 4 lines +Changed paths: + M /trunk/samtools/bamtk.c + M /trunk/samtools/faidx.c + + * samtools-0.1.4-13 (r351) + * make faidx more tolerant to empty lines right before or after > lines + * hope this does not introduce new bugs... + +------------------------------------------------------------------------ +r350 | lh3lh3 | 2009-06-16 14:37:01 +0100 (Tue, 16 Jun 2009) | 3 lines +Changed paths: + M /trunk/samtools/bam_plcmd.c + M /trunk/samtools/bamtk.c + + * samtools-0.1.4-13 (r350) + * fixed a small memory leak in pileup, caused by recent modifications + +------------------------------------------------------------------------ +r347 | lh3lh3 | 2009-06-13 21:20:49 +0100 (Sat, 13 Jun 2009) | 3 lines +Changed paths: + M /trunk/samtools/bam_plcmd.c + M /trunk/samtools/bamtk.c + M /trunk/samtools/sam_view.c + + * samtools-0.1.4-12 (r347) + * added `-S' to pileup, similar to `view -S' + +------------------------------------------------------------------------ +r346 | lh3lh3 | 2009-06-13 17:52:31 +0100 (Sat, 13 Jun 2009) | 3 lines +Changed paths: + M /trunk/samtools/Makefile + M /trunk/samtools/bamtk.c + M /trunk/samtools/sam_view.c + M /trunk/samtools/samtools.1 + + * samtools-0.1.4-11 (r346) + * allow to select a read group at view command-line + +------------------------------------------------------------------------ +r344 | lh3lh3 | 2009-06-13 14:06:24 +0100 (Sat, 13 Jun 2009) | 2 lines +Changed paths: + M /trunk/samtools/examples/calDepth.c + +added more comments + +------------------------------------------------------------------------ +r343 | lh3lh3 | 2009-06-13 14:01:22 +0100 (Sat, 13 Jun 2009) | 2 lines +Changed paths: + M /trunk/samtools/examples/calDepth.c + +nothing really + +------------------------------------------------------------------------ +r342 | lh3lh3 | 2009-06-13 13:58:48 +0100 (Sat, 13 Jun 2009) | 2 lines +Changed paths: + M /trunk/samtools/examples/Makefile + A /trunk/samtools/examples/calDepth.c + +added an example of calculating read depth + +------------------------------------------------------------------------ +r341 | lh3lh3 | 2009-06-13 13:00:08 +0100 (Sat, 13 Jun 2009) | 6 lines +Changed paths: + M /trunk/samtools/Makefile + M /trunk/samtools/bam.h + M /trunk/samtools/bam_aux.c + A /trunk/samtools/bam_color.c + M /trunk/samtools/bam_plcmd.c + M /trunk/samtools/bam_sort.c + M /trunk/samtools/bam_tview.c + M /trunk/samtools/bamtk.c + M /trunk/samtools/sam.c + M /trunk/samtools/sam.h + + * samtools-0.1.4-10 (r341) + * only include key APIs in libbam.a + * move color-specific routines to bam_color.c + * update documentations + * remove the support of -q in pileup + +------------------------------------------------------------------------ +r340 | lh3lh3 | 2009-06-13 11:17:14 +0100 (Sat, 13 Jun 2009) | 6 lines +Changed paths: + M /trunk/samtools/INSTALL + M /trunk/samtools/Makefile + M /trunk/samtools/bam_aux.c + M /trunk/samtools/bam_import.c + M /trunk/samtools/bam_tview.c + M /trunk/samtools/bamtk.c + M /trunk/samtools/razf.c + M /trunk/samtools/sam_view.c + + * samtools-0.1.4-9 (r340) + * added a warning to razf.c if zlib<1.2.2.1 + * fixed a compilation warning + * fixed a segfault caused by @RG parsing + * detect NCURSES in bam_tview.c + +------------------------------------------------------------------------ +r339 | lh3lh3 | 2009-06-13 10:35:19 +0100 (Sat, 13 Jun 2009) | 2 lines +Changed paths: + M /trunk/samtools/INSTALL + +update INSTALL + +------------------------------------------------------------------------ +r338 | lh3lh3 | 2009-06-13 00:15:24 +0100 (Sat, 13 Jun 2009) | 4 lines +Changed paths: + M /trunk/samtools/bam.c + M /trunk/samtools/bam.h + M /trunk/samtools/bam_aux.c + M /trunk/samtools/bam_import.c + M /trunk/samtools/bamtk.c + M /trunk/samtools/kstring.h + M /trunk/samtools/sam.c + M /trunk/samtools/sam_view.c + + * samtools-0.1.4-8 (r338) + * parse the @RG header lines and allow to choose library at the "samtools view" + command line + +------------------------------------------------------------------------ +r337 | lh3lh3 | 2009-06-12 21:25:50 +0100 (Fri, 12 Jun 2009) | 4 lines +Changed paths: + M /trunk/samtools/bamtk.c + M /trunk/samtools/bgzf.c + M /trunk/samtools/bgzf.h + M /trunk/samtools/sam.c + M /trunk/samtools/sam_view.c + + * samtools-0.1.4-7 (r337) + * bgzf.c: support mode string "wu": uncompressed output + * "samtools view" support "-u" command-line option + +------------------------------------------------------------------------ +r336 | lh3lh3 | 2009-06-12 17:20:12 +0100 (Fri, 12 Jun 2009) | 5 lines +Changed paths: + M /trunk/samtools/Makefile + M /trunk/samtools/misc/Makefile + M /trunk/samtools/razf.c + M /trunk/samtools/razf.h + M /trunk/samtools/razip.c + + * no changes to samtools itself + * remove zlib source codes + * make RAZF reading compatible with old version of zlib + * on old version of zlib, writing is not available + +------------------------------------------------------------------------ +r335 | lh3lh3 | 2009-06-12 16:47:33 +0100 (Fri, 12 Jun 2009) | 2 lines +Changed paths: + D /trunk/samtools/zlib + +remove zlib for simplification... + +------------------------------------------------------------------------ +r334 | lh3lh3 | 2009-06-12 15:43:36 +0100 (Fri, 12 Jun 2009) | 5 lines +Changed paths: + M /trunk/samtools/bam.h + M /trunk/samtools/bam_aux.c + M /trunk/samtools/bamtk.c + + * samtools-0.1.4-6 (r334) + * do not export bam_aux_get_core() for Bio::DB::Sam because it has already + been implemented in that. + * this version works with the latest Bio::DB::Sam (20090612) + +------------------------------------------------------------------------ +r333 | lh3lh3 | 2009-06-12 15:33:42 +0100 (Fri, 12 Jun 2009) | 2 lines +Changed paths: + M /trunk/samtools/ChangeLog + +update ChangeLog + +------------------------------------------------------------------------ +r332 | lh3lh3 | 2009-06-12 15:21:21 +0100 (Fri, 12 Jun 2009) | 2 lines +Changed paths: + M /trunk/samtools/AUTHORS + M /trunk/samtools/Makefile + M /trunk/samtools/misc/Makefile + +fixed minor things in Makefile + +------------------------------------------------------------------------ +r331 | lh3lh3 | 2009-06-12 15:07:05 +0100 (Fri, 12 Jun 2009) | 4 lines +Changed paths: + M /trunk/samtools/bamtk.c + + * samtools-0.1.4-5 (r3310 + * no change to samtools itself. Version number is increased to reflect the + changes in the Makefile building system. + +------------------------------------------------------------------------ +r330 | lh3lh3 | 2009-06-12 15:03:38 +0100 (Fri, 12 Jun 2009) | 2 lines +Changed paths: + M /trunk/samtools/AUTHORS + D /trunk/samtools/README + +update information... + +------------------------------------------------------------------------ +r329 | lh3lh3 | 2009-06-12 14:52:21 +0100 (Fri, 12 Jun 2009) | 3 lines +Changed paths: + M /trunk/samtools/misc/novo2sam.pl + + * updated novoalign converter by Colin Hercus et al. + * this version works with indels + +------------------------------------------------------------------------ +r328 | lh3lh3 | 2009-06-12 14:50:53 +0100 (Fri, 12 Jun 2009) | 3 lines +Changed paths: + M /trunk/samtools/INSTALL + M /trunk/samtools/Makefile + M /trunk/samtools/misc/Makefile + M /trunk/samtools/zlib/Makefile + + * update Makefile + * update INSTALL instruction + +------------------------------------------------------------------------ +r327 | lh3lh3 | 2009-06-12 14:18:29 +0100 (Fri, 12 Jun 2009) | 4 lines +Changed paths: + A /trunk/samtools/Makefile (from /trunk/samtools/Makefile.generic:325) + D /trunk/samtools/Makefile.am + D /trunk/samtools/Makefile.generic + D /trunk/samtools/Makefile.lite + D /trunk/samtools/autogen.sh + D /trunk/samtools/cleanup.sh + D /trunk/samtools/configure.ac + A /trunk/samtools/misc/Makefile (from /trunk/samtools/misc/Makefile.generic:305) + D /trunk/samtools/misc/Makefile.am + D /trunk/samtools/misc/Makefile.generic + M /trunk/samtools/razf.c + A /trunk/samtools/zlib + A /trunk/samtools/zlib/Makefile + A /trunk/samtools/zlib/adler32.c + A /trunk/samtools/zlib/compress.c + A /trunk/samtools/zlib/crc32.c + A /trunk/samtools/zlib/crc32.h + A /trunk/samtools/zlib/deflate.c + A /trunk/samtools/zlib/deflate.h + A /trunk/samtools/zlib/gzio.c + A /trunk/samtools/zlib/infback.c + A /trunk/samtools/zlib/inffast.c + A /trunk/samtools/zlib/inffast.h + A /trunk/samtools/zlib/inffixed.h + A /trunk/samtools/zlib/inflate.c + A /trunk/samtools/zlib/inflate.h + A /trunk/samtools/zlib/inftrees.c + A /trunk/samtools/zlib/inftrees.h + A /trunk/samtools/zlib/trees.c + A /trunk/samtools/zlib/trees.h + A /trunk/samtools/zlib/uncompr.c + A /trunk/samtools/zlib/zconf.h + A /trunk/samtools/zlib/zlib.h + A /trunk/samtools/zlib/zutil.c + A /trunk/samtools/zlib/zutil.h + D /trunk/samtools/zutil.h + + * added zlib-1.2.3 as razip requires that + * prepare to changed back to the Makefile building system + * unfinished! (will be soon) + +------------------------------------------------------------------------ +r326 | lh3lh3 | 2009-06-12 14:12:03 +0100 (Fri, 12 Jun 2009) | 2 lines +Changed paths: + M /trunk/samtools/misc/samtools.pl + +Unfinished + +------------------------------------------------------------------------ +r325 | lh3lh3 | 2009-06-10 16:27:59 +0100 (Wed, 10 Jun 2009) | 3 lines +Changed paths: + M /trunk/samtools/bam_maqcns.c + M /trunk/samtools/bamtk.c + + * samtools-0.1.4-4 (r325) + * further avoid wrong consensus calls in repetitive regions. + +------------------------------------------------------------------------ +r324 | lh3lh3 | 2009-06-10 15:56:17 +0100 (Wed, 10 Jun 2009) | 4 lines +Changed paths: + M /trunk/samtools/bam_maqcns.c + M /trunk/samtools/bam_plcmd.c + M /trunk/samtools/bamtk.c + M /trunk/samtools/sam.c + M /trunk/samtools/sam.h + + * samtools-0.1.4-3 (r324) + * make maqcns generate the correct call in repetitive regions. + * allow filtering on mapQ at the pileup command line + +------------------------------------------------------------------------ +r323 | lh3lh3 | 2009-06-10 10:04:21 +0100 (Wed, 10 Jun 2009) | 3 lines +Changed paths: + M /trunk/samtools/misc/samtools.pl + + * samtools.pl-0.3.2 (r322) + * indels and SNPs use different mapping quality threshold + +------------------------------------------------------------------------ +r322 | lh3lh3 | 2009-06-10 10:03:22 +0100 (Wed, 10 Jun 2009) | 2 lines +Changed paths: + M /trunk/samtools/misc/export2sam.pl + +fixed a typo + +------------------------------------------------------------------------ +r321 | lh3lh3 | 2009-06-09 09:21:48 +0100 (Tue, 09 Jun 2009) | 2 lines +Changed paths: + M /trunk/samtools/misc/samtools.pl + +just typo. no real change + +------------------------------------------------------------------------ +r320 | lh3lh3 | 2009-06-08 14:32:51 +0100 (Mon, 08 Jun 2009) | 2 lines +Changed paths: + M /trunk/samtools/misc/samtools.pl + +a little bit code cleanup + +------------------------------------------------------------------------ +r319 | lh3lh3 | 2009-06-08 14:22:33 +0100 (Mon, 08 Jun 2009) | 4 lines +Changed paths: + M /trunk/samtools/misc/samtools.pl + + * samtools.pl-0.3.1 + * change default parameters + * optionally print filtered variants + +------------------------------------------------------------------------ +r318 | lh3lh3 | 2009-06-08 14:14:26 +0100 (Mon, 08 Jun 2009) | 3 lines +Changed paths: + M /trunk/samtools/misc/samtools.pl + + * samtools.pl-0.3.0 + * combine snpFilter and indelFilter + +------------------------------------------------------------------------ +r317 | lh3lh3 | 2009-06-08 11:31:42 +0100 (Mon, 08 Jun 2009) | 3 lines +Changed paths: + M /trunk/samtools/misc/samtools.pl + + * samtools.pl-0.2.3 + * change a default parameter + +------------------------------------------------------------------------ +r316 | lh3lh3 | 2009-06-08 11:11:06 +0100 (Mon, 08 Jun 2009) | 5 lines +Changed paths: + M /trunk/samtools/bam_maqcns.c + M /trunk/samtools/bam_maqcns.h + M /trunk/samtools/bam_plcmd.c + M /trunk/samtools/bamtk.c + M /trunk/samtools/sam.c + + * samtools-0.1.4-2 (r316) + * pileup: cap mapping quality at 60 (by default) + * pileup: always calculate RMS mapq + * pileup: allow to output variant sites only + +------------------------------------------------------------------------ +r312 | lh3lh3 | 2009-06-04 13:01:10 +0100 (Thu, 04 Jun 2009) | 3 lines +Changed paths: + M /trunk/samtools/misc/samtools.pl + + * samtools.pl-0.2.2 + * added pileup2fq + +------------------------------------------------------------------------ +r311 | lh3lh3 | 2009-06-03 09:40:40 +0100 (Wed, 03 Jun 2009) | 2 lines +Changed paths: + M /trunk/samtools/misc/samtools.pl + + * in snpFilter, suppress non-SNP sites + +------------------------------------------------------------------------ +r310 | lh3lh3 | 2009-06-01 14:35:13 +0100 (Mon, 01 Jun 2009) | 3 lines +Changed paths: + M /trunk/samtools/misc/samtools.pl + + * samtools.pl-0.2.1 + * fixed a typo + +------------------------------------------------------------------------ +r309 | lh3lh3 | 2009-06-01 14:04:39 +0100 (Mon, 01 Jun 2009) | 3 lines +Changed paths: + M /trunk/samtools/misc/samtools.pl + + * samtools.pl-0.2.0 + * snpFilter + +------------------------------------------------------------------------ +r306 | lh3lh3 | 2009-05-28 11:49:35 +0100 (Thu, 28 May 2009) | 3 lines +Changed paths: + M /trunk/samtools/bgzf.c + + * minor changes to bgzf: return NULL if fd == -1 + * suggested by {kdj,jm18}@sanger.ac.uk + +------------------------------------------------------------------------ +r305 | lh3lh3 | 2009-05-28 11:16:08 +0100 (Thu, 28 May 2009) | 2 lines +Changed paths: + A /trunk/samtools/misc/interpolate_sam.pl + +Script for paired-end pileup, contributed by Stephen Montgomery. + +------------------------------------------------------------------------ +r304 | lh3lh3 | 2009-05-28 11:08:49 +0100 (Thu, 28 May 2009) | 3 lines +Changed paths: + M /trunk/samtools/bamtk.c + M /trunk/samtools/sam.c + + * samtools-0.1.4-1 (r304) + * fixed a minor bug in printing headers + +------------------------------------------------------------------------ +r297 | lh3lh3 | 2009-05-21 16:06:16 +0100 (Thu, 21 May 2009) | 2 lines +Changed paths: + M /trunk/samtools/ChangeLog + M /trunk/samtools/NEWS + M /trunk/samtools/bam_plcmd.c + M /trunk/samtools/bamtk.c + M /trunk/samtools/misc/maq2sam.c + M /trunk/samtools/samtools.1 + +Release samtools-0.1.4 + +------------------------------------------------------------------------ +r296 | lh3lh3 | 2009-05-21 12:53:14 +0100 (Thu, 21 May 2009) | 3 lines +Changed paths: + M /trunk/samtools/bam_maqcns.c + M /trunk/samtools/bamtk.c + + * samtools-0.1.3-24 (r296) + * another similar bug in the indel caller + +------------------------------------------------------------------------ +r295 | lh3lh3 | 2009-05-21 12:50:28 +0100 (Thu, 21 May 2009) | 3 lines +Changed paths: + M /trunk/samtools/bam_maqcns.c + M /trunk/samtools/bamtk.c + + * samtools-0.1.3-23 (r295) + * fixed a critical bug in the indel caller + +------------------------------------------------------------------------ +r294 | lh3lh3 | 2009-05-20 13:00:20 +0100 (Wed, 20 May 2009) | 2 lines +Changed paths: + M /trunk/samtools/bam_stat.c + +added a missing header file + +------------------------------------------------------------------------ +r293 | lh3lh3 | 2009-05-19 23:44:25 +0100 (Tue, 19 May 2009) | 3 lines +Changed paths: + M /trunk/samtools/bam_tview.c + M /trunk/samtools/bamtk.c + + * samtools-0.1.3-22 (r293) + * open tview in the dot-view mode by default + +------------------------------------------------------------------------ +r292 | lh3lh3 | 2009-05-18 21:01:23 +0100 (Mon, 18 May 2009) | 6 lines +Changed paths: + M /trunk/samtools/samtools.1 + +Added a note to the manual. Currently SAMtools used unaligned words in +several places. Although this does not cause bus errors to me, it may +affect portability. Please see the "Bus error" wiki page for more +information. Also thank James Bonfields for pointing this out. + + +------------------------------------------------------------------------ +r286 | lh3lh3 | 2009-05-14 15:23:13 +0100 (Thu, 14 May 2009) | 3 lines +Changed paths: + M /trunk/samtools/bam.h + M /trunk/samtools/bam_aux.c + M /trunk/samtools/bamtk.c + + * samtools-0.1.3-21 (286) + * declare bam_aux_get_core() in bam.h + +------------------------------------------------------------------------ +r276 | lh3lh3 | 2009-05-13 10:07:55 +0100 (Wed, 13 May 2009) | 5 lines +Changed paths: + M /trunk/samtools/bam.h + M /trunk/samtools/bam_index.c + M /trunk/samtools/bamtk.c + + * samtools-0.1.3-20 (r276) + * remove bam1_t::hash again. We need to modify the Perl API anyway to + make it work with the latest SVN. + * As is suggested by Tim, scan "{base}.bai" and "{base}.bam.bai" for index + +------------------------------------------------------------------------ +r275 | lh3lh3 | 2009-05-12 21:14:10 +0100 (Tue, 12 May 2009) | 4 lines +Changed paths: + M /trunk/samtools/ChangeLog + M /trunk/samtools/bam.h + M /trunk/samtools/bamtk.c + + * samtools-0.1.3-19 (r275) + * a minor change to the bam1_t struct: added back "void *hash" for the + backward compatibility with Bio::DB::Sam + +------------------------------------------------------------------------ +r273 | lh3lh3 | 2009-05-12 14:28:39 +0100 (Tue, 12 May 2009) | 3 lines +Changed paths: + M /trunk/samtools/bam_rmdupse.c + M /trunk/samtools/bamtk.c + + * samtools-0.1.3-18 (r273) + * rmdupse: do not remove unmapped reads + +------------------------------------------------------------------------ +r272 | lh3lh3 | 2009-05-12 14:20:00 +0100 (Tue, 12 May 2009) | 2 lines +Changed paths: + M /trunk/samtools/bam_rmdupse.c + +change a parameter. It does nothing + +------------------------------------------------------------------------ +r271 | lh3lh3 | 2009-05-12 14:17:58 +0100 (Tue, 12 May 2009) | 3 lines +Changed paths: + M /trunk/samtools/Makefile.am + M /trunk/samtools/Makefile.generic + M /trunk/samtools/Makefile.lite + A /trunk/samtools/bam_rmdupse.c + M /trunk/samtools/bamtk.c + M /trunk/samtools/configure.ac + + * samtools-0.1.3-17 (r271) + * added 'rmdupse' command + +------------------------------------------------------------------------ +r267 | lh3lh3 | 2009-05-05 22:31:41 +0100 (Tue, 05 May 2009) | 3 lines +Changed paths: + M /trunk/samtools/bamtk.c + M /trunk/samtools/sam_view.c + + * samtools-0.1.3-16 (r267) + * in sam_view.c, changed g_flag_on based on the suggestion by Angie Hinrichs + +------------------------------------------------------------------------ +r266 | lh3lh3 | 2009-05-05 22:23:27 +0100 (Tue, 05 May 2009) | 3 lines +Changed paths: + M /trunk/samtools/bam_import.c + M /trunk/samtools/bamtk.c + + * samtools-0.1.3-15 (r266) + * report an error if a non-* reference is present while @SQ is absent + +------------------------------------------------------------------------ +r265 | lh3lh3 | 2009-05-05 22:09:00 +0100 (Tue, 05 May 2009) | 3 lines +Changed paths: + M /trunk/samtools/bam.h + M /trunk/samtools/bam_import.c + M /trunk/samtools/bamtk.c + M /trunk/samtools/sam.c + M /trunk/samtools/sam_view.c + + * samtools-0.1.3-14 (r262) + * make samopen() recognize @SQ header lines + +------------------------------------------------------------------------ +r261 | lh3lh3 | 2009-05-05 15:10:30 +0100 (Tue, 05 May 2009) | 3 lines +Changed paths: + M /trunk/samtools/bam_plcmd.c + M /trunk/samtools/bamtk.c + M /trunk/samtools/bgzf.c + M /trunk/samtools/sam.c + M /trunk/samtools/sam_view.c + + * samtools-0.1.3-13 (r260) + * report error for file I/O error + +------------------------------------------------------------------------ +r260 | lh3lh3 | 2009-05-05 15:01:16 +0100 (Tue, 05 May 2009) | 2 lines +Changed paths: + M /trunk/samtools/Makefile.am + +update Makefile.am + +------------------------------------------------------------------------ +r259 | lh3lh3 | 2009-05-05 14:52:25 +0100 (Tue, 05 May 2009) | 3 lines +Changed paths: + M /trunk/samtools/bam.h + M /trunk/samtools/bam_pileup.c + M /trunk/samtools/bam_plcmd.c + M /trunk/samtools/bamtk.c + M /trunk/samtools/sam.c + M /trunk/samtools/sam.h + + * samtools-0.1.3-12 (r259) + * use the new I/O interface in pileup + +------------------------------------------------------------------------ +r258 | lh3lh3 | 2009-05-05 14:33:22 +0100 (Tue, 05 May 2009) | 3 lines +Changed paths: + M /trunk/samtools/Makefile.generic + M /trunk/samtools/Makefile.lite + M /trunk/samtools/bam.c + M /trunk/samtools/bam.h + M /trunk/samtools/bam_import.c + M /trunk/samtools/bamtk.c + A /trunk/samtools/sam.c + A /trunk/samtools/sam.h + A /trunk/samtools/sam_view.c + + * samtools-0.1.3-11 (r258) + * unify the interface to BAM and SAM I/O + +------------------------------------------------------------------------ +r257 | lh3lh3 | 2009-05-05 09:53:35 +0100 (Tue, 05 May 2009) | 3 lines +Changed paths: + M /trunk/samtools/Makefile.lite + M /trunk/samtools/bam_plcmd.c + M /trunk/samtools/bamtk.c + + * samtools-0.1.3-10 (r257) + * allow hex with "pileup -m" + +------------------------------------------------------------------------ +r256 | lh3lh3 | 2009-05-04 19:16:50 +0100 (Mon, 04 May 2009) | 4 lines +Changed paths: + M /trunk/samtools/bam_lpileup.c + M /trunk/samtools/bamtk.c + + * samtools-0.1.3-9 (r256) + * fixed a bug in bam_lpileup.c + * I do not know if this also fixes the bug causing assertion failure in the tview + +------------------------------------------------------------------------ +r251 | lh3lh3 | 2009-04-28 13:53:23 +0100 (Tue, 28 Apr 2009) | 3 lines +Changed paths: + M /trunk/samtools/bam_pileup.c + M /trunk/samtools/bamtk.c + + * samtools-0.1.3-8 (r251) + * fixed a bug when there are reads without coordinates + +------------------------------------------------------------------------ +r250 | lh3lh3 | 2009-04-28 13:43:33 +0100 (Tue, 28 Apr 2009) | 2 lines +Changed paths: + A /trunk/samtools/AUTHORS + A /trunk/samtools/README + M /trunk/samtools/cleanup.sh + +added missing files + +------------------------------------------------------------------------ +r249 | lh3lh3 | 2009-04-28 13:37:16 +0100 (Tue, 28 Apr 2009) | 2 lines +Changed paths: + M /trunk/samtools/Makefile.generic + M /trunk/samtools/Makefile.lite + M /trunk/samtools/configure.ac + M /trunk/samtools/misc/Makefile.generic + +improve large file support in compilation + +------------------------------------------------------------------------ +r248 | lh3lh3 | 2009-04-28 13:33:24 +0100 (Tue, 28 Apr 2009) | 2 lines +Changed paths: + M /trunk/samtools/INSTALL + +update INSTALL + +------------------------------------------------------------------------ +r247 | lh3lh3 | 2009-04-28 13:28:50 +0100 (Tue, 28 Apr 2009) | 2 lines +Changed paths: + M /trunk/samtools/Makefile.am + M /trunk/samtools/autogen.sh + M /trunk/samtools/cleanup.sh + M /trunk/samtools/configure.ac + A /trunk/samtools/misc/Makefile.am + +fixed various issues about the GNU building scripts + +------------------------------------------------------------------------ +r246 | lh3lh3 | 2009-04-28 13:10:23 +0100 (Tue, 28 Apr 2009) | 4 lines +Changed paths: + M /trunk/samtools/ChangeLog + D /trunk/samtools/Makefile + A /trunk/samtools/Makefile.am + A /trunk/samtools/Makefile.generic + A /trunk/samtools/autogen.sh + M /trunk/samtools/bam.h + M /trunk/samtools/bam_aux.c + M /trunk/samtools/bam_tview.c + M /trunk/samtools/bamtk.c + A /trunk/samtools/cleanup.sh + A /trunk/samtools/configure.ac + D /trunk/samtools/misc/Makefile + A /trunk/samtools/misc/Makefile.generic (from /trunk/samtools/misc/Makefile:245) + + * samtools-0.1.3-7 (r246) + * incorporated revisions from Nils Homer + * enhanced support of displaying color-space reads + +------------------------------------------------------------------------ +r244 | lh3lh3 | 2009-04-25 11:49:40 +0100 (Sat, 25 Apr 2009) | 3 lines +Changed paths: + M /trunk/samtools/bam_md.c + M /trunk/samtools/bamtk.c + + * samtools-0.1.3-6 (r244) + * fixed segfault for unmapped reads + +------------------------------------------------------------------------ +r243 | lh3lh3 | 2009-04-24 21:27:26 +0100 (Fri, 24 Apr 2009) | 5 lines +Changed paths: + M /trunk/samtools/bam.h + M /trunk/samtools/bam_maqcns.c + M /trunk/samtools/bam_md.c + M /trunk/samtools/bamtk.c + + * samtools-0.1.3-5 (r243) + * fixed a long existing bug which may cause memory leak + * check MD + * consensus calling now works with "=", but indel calling not + +------------------------------------------------------------------------ +r242 | lh3lh3 | 2009-04-24 20:44:46 +0100 (Fri, 24 Apr 2009) | 3 lines +Changed paths: + M /trunk/samtools/bam_md.c + M /trunk/samtools/bamtk.c + + * samtools-0.1.3-4 (r242) + * fixed a memory leak + +------------------------------------------------------------------------ +r240 | lh3lh3 | 2009-04-24 16:40:18 +0100 (Fri, 24 Apr 2009) | 5 lines +Changed paths: + M /trunk/samtools/Makefile + M /trunk/samtools/Makefile.lite + M /trunk/samtools/bam.h + M /trunk/samtools/bam_aux.c + A /trunk/samtools/bam_md.c + M /trunk/samtools/bam_plcmd.c + M /trunk/samtools/bamtk.c + + * samtools-0.1.3-3 (r240) + * generate MD tag + * generate "=" bases + * the plain pileup now support "=" bases, but consensus calling and glfgen may fail + +------------------------------------------------------------------------ +r239 | lh3lh3 | 2009-04-24 12:08:20 +0100 (Fri, 24 Apr 2009) | 5 lines +Changed paths: + M /trunk/samtools/bam.h + M /trunk/samtools/bam_aux.c + M /trunk/samtools/bamtk.c + + * samtools-0.1.3-2 (r239) + * fixed bugs in bam_aux.c (these functions nevered used by samtools) + * removed bam_aux_init()/bam_aux_destroy() + * added tagview for testing bam_aux + +------------------------------------------------------------------------ +r235 | lh3lh3 | 2009-04-21 23:17:39 +0100 (Tue, 21 Apr 2009) | 3 lines +Changed paths: + M /trunk/samtools/bam_pileup.c + M /trunk/samtools/bamtk.c + + * samtools-0.1.3-1 + * fixed a bug in pileup: the first read in a chromosome may not be printed + +------------------------------------------------------------------------ +r232 | lh3lh3 | 2009-04-16 15:25:43 +0100 (Thu, 16 Apr 2009) | 2 lines +Changed paths: + M /trunk/samtools/Makefile.lite + +a missing file in Makefile.lite + +------------------------------------------------------------------------ +r227 | lh3lh3 | 2009-04-15 22:02:53 +0100 (Wed, 15 Apr 2009) | 2 lines +Changed paths: + M /trunk/samtools/NEWS + M /trunk/samtools/bamtk.c + +Release samtools-0.1.3 + +------------------------------------------------------------------------ +r223 | lh3lh3 | 2009-04-15 14:31:32 +0100 (Wed, 15 Apr 2009) | 3 lines +Changed paths: + M /trunk/samtools/bam_plcmd.c + M /trunk/samtools/bamtk.c + + * samtools-0.1.2-28 + * make samtools more robust to weird input such as empty file + +------------------------------------------------------------------------ +r222 | lh3lh3 | 2009-04-15 14:05:33 +0100 (Wed, 15 Apr 2009) | 2 lines +Changed paths: + M /trunk/samtools/ChangeLog + M /trunk/samtools/NEWS + M /trunk/samtools/samtools.1 + +prepare for release 0.1.3 + +------------------------------------------------------------------------ +r221 | lh3lh3 | 2009-04-15 13:32:14 +0100 (Wed, 15 Apr 2009) | 2 lines +Changed paths: + A /trunk/samtools/misc/blast2sam.pl + +convert NCBI-BLASTN to SAM + +------------------------------------------------------------------------ +r220 | lh3lh3 | 2009-04-15 13:18:19 +0100 (Wed, 15 Apr 2009) | 3 lines +Changed paths: + M /trunk/samtools/bam_lpileup.c + M /trunk/samtools/bamtk.c + + * samtools-0.1.2-27 + * fixed a small memory leak in tview + +------------------------------------------------------------------------ +r219 | lh3lh3 | 2009-04-15 13:00:08 +0100 (Wed, 15 Apr 2009) | 3 lines +Changed paths: + M /trunk/samtools/bam_rmdup.c + M /trunk/samtools/bamtk.c + + * samtools-0.1.2-26 + * fixed a bug in rmdup when there are unmapped reads + +------------------------------------------------------------------------ +r218 | lh3lh3 | 2009-04-14 22:28:58 +0100 (Tue, 14 Apr 2009) | 2 lines +Changed paths: + M /trunk/samtools/ChangeLog + M /trunk/samtools/NEWS + +proposed NEWS for the new release (have not yet) + +------------------------------------------------------------------------ +r216 | lh3lh3 | 2009-04-14 22:10:46 +0100 (Tue, 14 Apr 2009) | 4 lines +Changed paths: + M /trunk/samtools/misc/samtools.pl + + * samtools.pl-0.1.1 + * improve indelFilter to avoid filtering true indels. The new filter relies + on the new pileup indel line implemented in samtools-0.1.2-25 + +------------------------------------------------------------------------ +r215 | lh3lh3 | 2009-04-14 22:04:19 +0100 (Tue, 14 Apr 2009) | 4 lines +Changed paths: + M /trunk/samtools/bam_maqcns.c + M /trunk/samtools/bam_plcmd.c + M /trunk/samtools/bamtk.c + M /trunk/samtools/samtools.1 + + * samtools-0.1.2-25 + * change the pileup indel line to shows the number of alignments actually + containing indels + +------------------------------------------------------------------------ +r211 | lh3lh3 | 2009-04-13 12:07:13 +0100 (Mon, 13 Apr 2009) | 2 lines +Changed paths: + M /trunk/samtools/ChangeLog + +update ChangeLog from "svn log" + +------------------------------------------------------------------------ +r210 | lh3lh3 | 2009-04-12 20:57:05 +0100 (Sun, 12 Apr 2009) | 4 lines +Changed paths: + M /trunk/samtools/bam.c + M /trunk/samtools/bam_import.c + M /trunk/samtools/bam_sort.c + M /trunk/samtools/bamtk.c + M /trunk/samtools/kseq.h + + * samtools-0.1.2-24 + * in merge, gives a warning rather than error if the target sequence length is different + * allow empty header + +------------------------------------------------------------------------ +r209 | lh3lh3 | 2009-04-12 20:32:44 +0100 (Sun, 12 Apr 2009) | 3 lines +Changed paths: + M /trunk/samtools/bam.c + M /trunk/samtools/bam_import.c + M /trunk/samtools/bamtk.c + + * samtools-0.1.2-23 + * recognize '*' at the QUAL field + +------------------------------------------------------------------------ +r208 | lh3lh3 | 2009-04-12 20:08:02 +0100 (Sun, 12 Apr 2009) | 3 lines +Changed paths: + M /trunk/samtools/bam_import.c + M /trunk/samtools/bamtk.c + M /trunk/samtools/kseq.h + + * samtools-0.1.2-22 + * the field separater is TAB only, now + +------------------------------------------------------------------------ +r207 | lh3lh3 | 2009-04-08 15:18:03 +0100 (Wed, 08 Apr 2009) | 2 lines +Changed paths: + M /trunk/samtools/examples/ex1.sam.gz + + * fixed the problem in the example alignment due to the bug in fixmate + +------------------------------------------------------------------------ +r206 | lh3lh3 | 2009-04-08 15:15:05 +0100 (Wed, 08 Apr 2009) | 3 lines +Changed paths: + M /trunk/samtools/bam_mate.c + M /trunk/samtools/bamtk.c + M /trunk/samtools/misc/soap2sam.pl + + * samtools-0.1.2-21 + * fixed a nasty bug in `fixmate' + +------------------------------------------------------------------------ +r205 | lh3lh3 | 2009-04-08 10:57:08 +0100 (Wed, 08 Apr 2009) | 2 lines +Changed paths: + M /trunk/samtools/misc/bowtie2sam.pl + M /trunk/samtools/misc/soap2sam.pl + M /trunk/samtools/misc/wgsim_eval.pl + +make the script robust to the bugs in SOAP-2.1.7 + +------------------------------------------------------------------------ +r200 | lh3lh3 | 2009-04-02 15:14:56 +0100 (Thu, 02 Apr 2009) | 3 lines +Changed paths: + M /trunk/samtools/bam_stat.c + M /trunk/samtools/bamtk.c + + * samtools-0.1.2-20 + * check if file is truncated in flagstat + +------------------------------------------------------------------------ +r199 | lh3lh3 | 2009-04-02 15:09:10 +0100 (Thu, 02 Apr 2009) | 3 lines +Changed paths: + M /trunk/samtools/bamtk.c + + * samtools-0.1.2-19 + * print the header if requested + +------------------------------------------------------------------------ +r193 | lh3lh3 | 2009-03-27 15:09:50 +0000 (Fri, 27 Mar 2009) | 3 lines +Changed paths: + M /trunk/samtools/bam_plcmd.c + M /trunk/samtools/bamtk.c + + * samtools-0.1.2-18 + * fixed a minor bug reported by Nils Homer + +------------------------------------------------------------------------ +r185 | lh3lh3 | 2009-03-24 11:50:32 +0000 (Tue, 24 Mar 2009) | 2 lines +Changed paths: + A /trunk/samtools/Makefile (from /trunk/samtools/Makefile.std:184) + D /trunk/samtools/Makefile.std + A /trunk/samtools/misc/Makefile (from /trunk/samtools/misc/Makefile.std:184) + D /trunk/samtools/misc/Makefile.std + +rename Makefile.std as Makefile. GNU building systerm is not ready and may take some time... + +------------------------------------------------------------------------ +r184 | lh3lh3 | 2009-03-24 10:36:38 +0000 (Tue, 24 Mar 2009) | 4 lines +Changed paths: + D /trunk/samtools/Makefile + A /trunk/samtools/Makefile.std (from /trunk/samtools/Makefile:183) + M /trunk/samtools/bam_sort.c + M /trunk/samtools/bam_tview.c + M /trunk/samtools/bamtk.c + D /trunk/samtools/misc/Makefile + A /trunk/samtools/misc/Makefile.std (from /trunk/samtools/misc/Makefile:182) + M /trunk/samtools/samtools.1 + + * samtools-0.1.2-17 + * incorporating Nils' changes + * rename Makefile to Makefile.std and prepare to add the GNU building systerms (also by Nils) + +------------------------------------------------------------------------ +r183 | lh3lh3 | 2009-03-24 10:30:23 +0000 (Tue, 24 Mar 2009) | 4 lines +Changed paths: + M /trunk/samtools/Makefile + M /trunk/samtools/bam_import.c + M /trunk/samtools/bam_maqcns.c + M /trunk/samtools/bam_maqcns.h + M /trunk/samtools/bam_plcmd.c + M /trunk/samtools/bamtk.c + M /trunk/samtools/kseq.h + A /trunk/samtools/kstring.c + A /trunk/samtools/kstring.h + + * samtools-0.1.2-16 + * made pileup take a list of proposed indels. An insertion is N at the moment. + * added my kstring library for a bit complex parsing of the position list. + +------------------------------------------------------------------------ +r169 | lh3lh3 | 2009-03-12 13:40:14 +0000 (Thu, 12 Mar 2009) | 3 lines +Changed paths: + M /trunk/samtools/misc/soap2sam.pl + + * soap2sam.pl-0.1.2 + * more robust to truncated soap output + +------------------------------------------------------------------------ +r168 | lh3lh3 | 2009-03-11 10:49:00 +0000 (Wed, 11 Mar 2009) | 2 lines +Changed paths: + M /trunk/samtools/Makefile.lite + +added bam_stat.o to Makefile.lite + +------------------------------------------------------------------------ +r167 | lh3lh3 | 2009-03-10 22:11:31 +0000 (Tue, 10 Mar 2009) | 3 lines +Changed paths: + M /trunk/samtools/bam_maqcns.c + M /trunk/samtools/bamtk.c + + * samtools-0.1.2-15 + * generate RMS of mapQ instead of max mapQ + +------------------------------------------------------------------------ +r166 | lh3lh3 | 2009-03-10 22:06:45 +0000 (Tue, 10 Mar 2009) | 3 lines +Changed paths: + M /trunk/samtools/bam_plcmd.c + M /trunk/samtools/bamtk.c + M /trunk/samtools/glf.c + M /trunk/samtools/glf.h + M /trunk/samtools/misc/Makefile + + * samtools-0.1.2-14 + * implemented GLFv3 + +------------------------------------------------------------------------ +r159 | lh3lh3 | 2009-03-03 11:26:08 +0000 (Tue, 03 Mar 2009) | 3 lines +Changed paths: + M /trunk/samtools/bam_plcmd.c + M /trunk/samtools/bamtk.c + + * samtools-0.1.2-13 + * fixed a minor bug in displaying pileup + +------------------------------------------------------------------------ +r158 | lh3lh3 | 2009-03-03 11:24:16 +0000 (Tue, 03 Mar 2009) | 3 lines +Changed paths: + M /trunk/samtools/ChangeLog + M /trunk/samtools/bamtk.c + + * samtools-0.1.2-12 + * optionally print SAM header + +------------------------------------------------------------------------ +r153 | lh3lh3 | 2009-03-02 10:45:28 +0000 (Mon, 02 Mar 2009) | 3 lines +Changed paths: + M /trunk/samtools/bamtk.c + M /trunk/samtools/glf.c + + * samtools-0.1.2-11 + * use "GLF\3" as the magic for GLFv3 files + +------------------------------------------------------------------------ +r152 | lh3lh3 | 2009-03-02 10:39:09 +0000 (Mon, 02 Mar 2009) | 5 lines +Changed paths: + M /trunk/samtools/Makefile + M /trunk/samtools/bam_import.c + M /trunk/samtools/bam_index.c + M /trunk/samtools/bam_plcmd.c + M /trunk/samtools/bamtk.c + M /trunk/samtools/glf.c + M /trunk/samtools/glf.h + + * samtools-0.1.2-10 + * fixed a bug in import: core.bin is undefined for unmapped reads + * this bug can be alleviated (not completely solved) in bam_index.c + * update to GLFv3: pos is changed to offset for better compression + +------------------------------------------------------------------------ +r151 | lh3lh3 | 2009-03-01 15:18:43 +0000 (Sun, 01 Mar 2009) | 3 lines +Changed paths: + M /trunk/samtools/misc/wgsim.c + + * wgsim-0.2.3 + * fixed a bug in simulating indels + +------------------------------------------------------------------------ +r145 | lh3lh3 | 2009-02-26 19:43:57 +0000 (Thu, 26 Feb 2009) | 4 lines +Changed paths: + M /trunk/samtools/misc/wgsim.c + + * wgsim-0.2.2 + * allow to print mismatch information as fastq comment. MAQ does + not like long read names. + +------------------------------------------------------------------------ +r141 | lh3lh3 | 2009-02-26 14:53:03 +0000 (Thu, 26 Feb 2009) | 6 lines +Changed paths: + M /trunk/samtools/ChangeLog + M /trunk/samtools/misc/wgsim.c + M /trunk/samtools/misc/wgsim_eval.pl + + * wgsim-0.2.1 + * fixed a bug about color read coordinates + * fixed a bug in read names + * wgsim_eval.pl-0.1.3 + * make the script work with color reads + +------------------------------------------------------------------------ +r140 | lh3lh3 | 2009-02-26 14:02:57 +0000 (Thu, 26 Feb 2009) | 2 lines +Changed paths: + M /trunk/samtools/misc/Makefile + M /trunk/samtools/misc/wgsim.c + + * wgsim: added a note + +------------------------------------------------------------------------ +r139 | lh3lh3 | 2009-02-26 11:39:08 +0000 (Thu, 26 Feb 2009) | 7 lines +Changed paths: + M /trunk/samtools/misc/wgsim.c + M /trunk/samtools/misc/wgsim_eval.pl + + * wgsim-0.2.0 + * considerable code clean up + * print number of substitutions/indels/errors on each read + * potentially support SOLiD simulation, though not tested at the moment + * wgsim_eval.pl-0.1.2 + * change in accordant with wgsim + +------------------------------------------------------------------------ +r129 | lh3lh3 | 2009-02-18 22:23:27 +0000 (Wed, 18 Feb 2009) | 3 lines +Changed paths: + M /trunk/samtools/bam_index.c + M /trunk/samtools/bamtk.c + + * samtools-0.1.2-9 + * fixed a bug in bam_fetch, caused by completely contained adjacent chunks + +------------------------------------------------------------------------ +r128 | bhandsaker | 2009-02-18 19:06:57 +0000 (Wed, 18 Feb 2009) | 2 lines +Changed paths: + M /trunk/samtools/bamtk.c + +Fix annoying segv when invalid region specified. + +------------------------------------------------------------------------ +r127 | lh3lh3 | 2009-02-17 10:49:55 +0000 (Tue, 17 Feb 2009) | 2 lines +Changed paths: + D /trunk/samtools/misc/indel_filter.pl + A /trunk/samtools/misc/samtools.pl + + * move indel_filter.pl to samtools.pl + +------------------------------------------------------------------------ +r126 | lh3lh3 | 2009-02-14 21:22:30 +0000 (Sat, 14 Feb 2009) | 3 lines +Changed paths: + M /trunk/samtools/bam_mate.c + M /trunk/samtools/bamtk.c + + * samtools-0.1.2-7 + * fixed a bug in fixmate: SE reads are flagged as BAM_FMUNMAP + +------------------------------------------------------------------------ +r125 | lh3lh3 | 2009-02-13 09:54:45 +0000 (Fri, 13 Feb 2009) | 3 lines +Changed paths: + M /trunk/samtools/bam_stat.c + M /trunk/samtools/bamtk.c + + * samtools-0.1.2-7 + * fixed a minor bug in flagstat + +------------------------------------------------------------------------ +r124 | lh3lh3 | 2009-02-12 11:15:32 +0000 (Thu, 12 Feb 2009) | 3 lines +Changed paths: + M /trunk/samtools/bam_maqcns.c + M /trunk/samtools/bamtk.c + M /trunk/samtools/misc/indel_filter.pl + + * samtools-0.1.2-6 + * improve indel caller by setting maximum window size + +------------------------------------------------------------------------ +r123 | lh3lh3 | 2009-02-12 10:30:29 +0000 (Thu, 12 Feb 2009) | 2 lines +Changed paths: + M /trunk/samtools/bam_plcmd.c + M /trunk/samtools/bamtk.c + + * output max mapping quality in indel line + +------------------------------------------------------------------------ +r122 | lh3lh3 | 2009-02-11 10:59:10 +0000 (Wed, 11 Feb 2009) | 2 lines +Changed paths: + M /trunk/samtools/misc/maq2sam.c + +fixed a bug in generating tag AM + +------------------------------------------------------------------------ +r121 | lh3lh3 | 2009-02-03 10:43:11 +0000 (Tue, 03 Feb 2009) | 2 lines +Changed paths: + M /trunk/samtools/bam_index.c + M /trunk/samtools/bamtk.c + +fixed a potential memory problem in indexing + +------------------------------------------------------------------------ +r120 | bhandsaker | 2009-02-02 15:52:52 +0000 (Mon, 02 Feb 2009) | 2 lines +Changed paths: + M /trunk/samtools/Makefile + +Pass LIBS to recursive targets to facilitate building at Broad. + +------------------------------------------------------------------------ +r119 | lh3lh3 | 2009-02-02 10:12:15 +0000 (Mon, 02 Feb 2009) | 4 lines +Changed paths: + M /trunk/samtools/ChangeLog + M /trunk/samtools/bam_plcmd.c + M /trunk/samtools/bam_stat.c + M /trunk/samtools/bamtk.c + + * samtools-0.1.2-3 + * fixed a bug in generating GLFv2 for indels + * improve flagstat report a little bit + +------------------------------------------------------------------------ +r118 | lh3lh3 | 2009-01-29 12:33:23 +0000 (Thu, 29 Jan 2009) | 3 lines +Changed paths: + M /trunk/samtools/Makefile + A /trunk/samtools/bam_stat.c + M /trunk/samtools/bamtk.c + + * samtools-0.1.2-1 + * added flagstat command + +------------------------------------------------------------------------ +r116 | lh3lh3 | 2009-01-28 13:31:12 +0000 (Wed, 28 Jan 2009) | 2 lines +Changed paths: + M /trunk/samtools/ChangeLog + M /trunk/samtools/NEWS + M /trunk/samtools/bamtk.c + M /trunk/samtools/samtools.1 + +Release SAMtools-0.1.2 + +------------------------------------------------------------------------ +r115 | lh3lh3 | 2009-01-28 12:54:08 +0000 (Wed, 28 Jan 2009) | 2 lines +Changed paths: + A /trunk/samtools/misc/indel_filter.pl + +Script for filtering indel results + +------------------------------------------------------------------------ +r114 | lh3lh3 | 2009-01-25 11:45:37 +0000 (Sun, 25 Jan 2009) | 2 lines +Changed paths: + A /trunk/samtools/misc/zoom2sam.pl + +convert ZOOM to SAM + +------------------------------------------------------------------------ +r113 | lh3lh3 | 2009-01-24 14:25:07 +0000 (Sat, 24 Jan 2009) | 2 lines +Changed paths: + A /trunk/samtools/misc/novo2sam.pl + +add a script to convert novo alignment to SAM + +------------------------------------------------------------------------ +r112 | lh3lh3 | 2009-01-23 20:57:39 +0000 (Fri, 23 Jan 2009) | 2 lines +Changed paths: + M /trunk/samtools/ChangeLog + M /trunk/samtools/ChangeLog.old + M /trunk/samtools/samtools.1 + +update documentation and ChangeLog + +------------------------------------------------------------------------ +r111 | lh3lh3 | 2009-01-23 19:22:59 +0000 (Fri, 23 Jan 2009) | 3 lines +Changed paths: + M /trunk/samtools/bam_sort.c + M /trunk/samtools/bamtk.c + + * samtools-0.1.1-19 + * fixed a bug in "merge" command line + +------------------------------------------------------------------------ +r110 | lh3lh3 | 2009-01-22 15:36:48 +0000 (Thu, 22 Jan 2009) | 3 lines +Changed paths: + M /trunk/samtools/misc/Makefile + A /trunk/samtools/misc/bowtie2sam.pl (from /branches/dev/samtools/misc/bowtie2sam.pl:108) + M /trunk/samtools/misc/export2sam.pl + A /trunk/samtools/misc/soap2sam.pl (from /branches/dev/samtools/misc/soap2sam.pl:108) + A /trunk/samtools/misc/wgsim.c (from /branches/dev/samtools/misc/wgsim.c:108) + A /trunk/samtools/misc/wgsim_eval.pl (from /branches/dev/samtools/misc/wgsim_eval.pl:108) + + * merge from branches/dev/ + * all future development will happen here + +------------------------------------------------------------------------ +r109 | lh3lh3 | 2009-01-22 15:14:27 +0000 (Thu, 22 Jan 2009) | 3 lines +Changed paths: + M /trunk/samtools/COPYING + M /trunk/samtools/ChangeLog + A /trunk/samtools/INSTALL (from /branches/dev/samtools/INSTALL:108) + M /trunk/samtools/Makefile + A /trunk/samtools/Makefile.lite (from /branches/dev/samtools/Makefile.lite:108) + M /trunk/samtools/bam.c + M /trunk/samtools/bam.h + M /trunk/samtools/bam_import.c + M /trunk/samtools/bam_index.c + M /trunk/samtools/bam_lpileup.c + M /trunk/samtools/bam_maqcns.c + M /trunk/samtools/bam_maqcns.h + A /trunk/samtools/bam_mate.c (from /branches/dev/samtools/bam_mate.c:108) + M /trunk/samtools/bam_pileup.c + M /trunk/samtools/bam_plcmd.c + A /trunk/samtools/bam_rmdup.c (from /branches/dev/samtools/bam_rmdup.c:108) + M /trunk/samtools/bam_sort.c + M /trunk/samtools/bamtk.c + M /trunk/samtools/bgzf.h + M /trunk/samtools/examples/00README.txt + A /trunk/samtools/examples/Makefile (from /branches/dev/samtools/examples/Makefile:108) + D /trunk/samtools/examples/ex1.fa.fai + M /trunk/samtools/examples/ex1.sam.gz + M /trunk/samtools/faidx.c + A /trunk/samtools/glf.c (from /branches/dev/samtools/glf.c:108) + M /trunk/samtools/glf.h + M /trunk/samtools/misc/Makefile + M /trunk/samtools/misc/maq2sam.c + M /trunk/samtools/razf.c + M /trunk/samtools/source.dot + + * Merge from branches/dev/ + * all future development will happen here at trunk/ + +------------------------------------------------------------------------ +r79 | bhandsaker | 2009-01-07 21:42:15 +0000 (Wed, 07 Jan 2009) | 2 lines +Changed paths: + M /trunk/samtools/bam_maqcns.c + M /trunk/samtools/bam_tview.c + +Fix problem with compiling without curses. + +------------------------------------------------------------------------ +r63 | lh3lh3 | 2008-12-22 15:58:02 +0000 (Mon, 22 Dec 2008) | 2 lines +Changed paths: + A /trunk/samtools (from /branches/dev/samtools:62) + +Create trunk copy + +------------------------------------------------------------------------ +r62 | lh3lh3 | 2008-12-22 15:55:13 +0000 (Mon, 22 Dec 2008) | 2 lines +Changed paths: + A /branches/dev/samtools/NEWS + M /branches/dev/samtools/bamtk.c + M /branches/dev/samtools/samtools.1 + +Release samtools-0.1.1 + +------------------------------------------------------------------------ +r61 | lh3lh3 | 2008-12-22 15:46:08 +0000 (Mon, 22 Dec 2008) | 10 lines +Changed paths: + M /branches/dev/samtools/bam_aux.c + M /branches/dev/samtools/bam_index.c + M /branches/dev/samtools/bam_plcmd.c + M /branches/dev/samtools/bam_tview.c + M /branches/dev/samtools/bamtk.c + M /branches/dev/samtools/razf.c + M /branches/dev/samtools/samtools.1 + + * samtools-0.1.0-66 + * fixed a bug in razf.c: reset z_eof when razf_seek() is called + * fixed a memory leak in parsing a region + * changed pileup a little bit when -s is in use: output ^ and $ + * when a bam is not indexed, output more meaningful error message + * fixed a bug in indexing for small alignment + * fixed a bug in the viewer when we come to the end of a reference file + * updated documentation + * prepare to release 0.1.1 + +------------------------------------------------------------------------ +r60 | lh3lh3 | 2008-12-22 15:10:16 +0000 (Mon, 22 Dec 2008) | 2 lines +Changed paths: + A /branches/dev/samtools/examples + A /branches/dev/samtools/examples/00README.txt + A /branches/dev/samtools/examples/ex1.fa + A /branches/dev/samtools/examples/ex1.fa.fai + A /branches/dev/samtools/examples/ex1.sam.gz + +example + +------------------------------------------------------------------------ +r59 | lh3lh3 | 2008-12-22 09:38:15 +0000 (Mon, 22 Dec 2008) | 2 lines +Changed paths: + M /branches/dev/samtools/ChangeLog + +update ChangeLog + +------------------------------------------------------------------------ +r58 | lh3lh3 | 2008-12-20 23:06:00 +0000 (Sat, 20 Dec 2008) | 3 lines +Changed paths: + M /branches/dev/samtools/misc/export2sam.pl + + * added comments + * fixed several bugs + +------------------------------------------------------------------------ +r57 | lh3lh3 | 2008-12-20 15:44:20 +0000 (Sat, 20 Dec 2008) | 2 lines +Changed paths: + A /branches/dev/samtools/misc/export2sam.pl + +convert Export format to SAM; not thoroughly tested + +------------------------------------------------------------------------ +r56 | lh3lh3 | 2008-12-19 22:13:28 +0000 (Fri, 19 Dec 2008) | 6 lines +Changed paths: + M /branches/dev/samtools/bam_import.c + M /branches/dev/samtools/bam_plcmd.c + M /branches/dev/samtools/bam_tview.c + M /branches/dev/samtools/bamtk.c + A /branches/dev/samtools/source.dot + + * samtools-0.1.0-65 + * pileup: generate maq-like simple output + * pileup: allow to output pileup at required sites + * source.dot: source file relationship graph + * tview: fixed a minor bug + +------------------------------------------------------------------------ +r55 | lh3lh3 | 2008-12-19 20:10:26 +0000 (Fri, 19 Dec 2008) | 2 lines +Changed paths: + D /branches/dev/samtools/misc/all2sam.pl + +remove all2sam.pl + +------------------------------------------------------------------------ +r54 | lh3lh3 | 2008-12-16 22:34:25 +0000 (Tue, 16 Dec 2008) | 2 lines +Changed paths: + A /branches/dev/samtools/COPYING + M /branches/dev/samtools/bam.h + M /branches/dev/samtools/faidx.h + M /branches/dev/samtools/khash.h + M /branches/dev/samtools/kseq.h + M /branches/dev/samtools/ksort.h + M /branches/dev/samtools/samtools.1 + +Added copyright information and a bit more documentation. No code change. + +------------------------------------------------------------------------ +r53 | lh3lh3 | 2008-12-16 13:40:18 +0000 (Tue, 16 Dec 2008) | 3 lines +Changed paths: + M /branches/dev/samtools/bam.c + M /branches/dev/samtools/bam.h + M /branches/dev/samtools/bam_index.c + M /branches/dev/samtools/bam_maqcns.c + M /branches/dev/samtools/bamtk.c + + * samtools-0.1.0-64 + * improved efficiency of the indel caller for spliced alignments + +------------------------------------------------------------------------ +r52 | lh3lh3 | 2008-12-16 10:28:20 +0000 (Tue, 16 Dec 2008) | 3 lines +Changed paths: + M /branches/dev/samtools/bam.c + M /branches/dev/samtools/bam.h + M /branches/dev/samtools/bam_aux.c + M /branches/dev/samtools/bam_index.c + M /branches/dev/samtools/bamtk.c + + * samtools-0.1.0-63 + * a bit code cleanup: reduce the dependency between source files + +------------------------------------------------------------------------ +r51 | lh3lh3 | 2008-12-15 14:29:32 +0000 (Mon, 15 Dec 2008) | 3 lines +Changed paths: + M /branches/dev/samtools/bam_maqcns.c + M /branches/dev/samtools/bam_plcmd.c + M /branches/dev/samtools/bamtk.c + + * samtools-0.1.0-62 + * fixed a memory leak + +------------------------------------------------------------------------ +r50 | lh3lh3 | 2008-12-15 14:00:13 +0000 (Mon, 15 Dec 2008) | 2 lines +Changed paths: + M /branches/dev/samtools/ChangeLog + M /branches/dev/samtools/bam.h + M /branches/dev/samtools/samtools.1 + +update documentation, ChangeLog and a comment + +------------------------------------------------------------------------ +r49 | lh3lh3 | 2008-12-15 13:36:43 +0000 (Mon, 15 Dec 2008) | 6 lines +Changed paths: + M /branches/dev/samtools/Makefile + M /branches/dev/samtools/bam.h + M /branches/dev/samtools/bam_maqcns.c + M /branches/dev/samtools/bam_maqcns.h + M /branches/dev/samtools/bam_pileup.c + A /branches/dev/samtools/bam_plcmd.c + M /branches/dev/samtools/bamtk.c + M /branches/dev/samtools/samtools.1 + + * samtools-0.1.0-61 + * moved pileup command to a separate source file + * added indel caller + * added bam_cal_segend(). (NOT WORKING for spliced alignment!!!) + * updated documentation + +------------------------------------------------------------------------ +r48 | lh3lh3 | 2008-12-12 13:55:36 +0000 (Fri, 12 Dec 2008) | 3 lines +Changed paths: + M /branches/dev/samtools/bam_maqcns.c + M /branches/dev/samtools/bamtk.c + + * samtools-0.1.0-60 + * fixed another bug in maqcns when there is a nearby deletion + +------------------------------------------------------------------------ +r47 | lh3lh3 | 2008-12-12 13:42:16 +0000 (Fri, 12 Dec 2008) | 5 lines +Changed paths: + M /branches/dev/samtools/bam_maqcns.c + M /branches/dev/samtools/bam_pileup.c + M /branches/dev/samtools/bamtk.c + + * samtools-0.1.0-59 + * pileup: outputing consensus is now optional + * fixed a bug in glfgen. This bug also exists in maq's glfgen. However, + I am not quite sure why the previous version may have problem. + +------------------------------------------------------------------------ +r46 | lh3lh3 | 2008-12-12 11:44:56 +0000 (Fri, 12 Dec 2008) | 6 lines +Changed paths: + M /branches/dev/samtools/bam_pileup.c + M /branches/dev/samtools/bamtk.c + + * samtools-0.1.0-58 + * add maq consensus to pileup. However, I will move this part to a new + command as strictly speaking, consensus callin is not part of pileup, + and imposing it would make it harder to generate for other language + bindings. + +------------------------------------------------------------------------ +r45 | bhandsaker | 2008-12-11 20:43:56 +0000 (Thu, 11 Dec 2008) | 2 lines +Changed paths: + M /branches/dev/samtools/bgzf.c + +Fix bug in tell() after reads that consume to the exact end of a block. + +------------------------------------------------------------------------ +r44 | lh3lh3 | 2008-12-11 09:36:53 +0000 (Thu, 11 Dec 2008) | 2 lines +Changed paths: + M /branches/dev/samtools/samtools.1 + +update manual + +------------------------------------------------------------------------ +r43 | lh3lh3 | 2008-12-11 09:25:36 +0000 (Thu, 11 Dec 2008) | 4 lines +Changed paths: + M /branches/dev/samtools/bam_import.c + M /branches/dev/samtools/bamtk.c + + * samtools-0.1.0-57 + * fixed a bug in parser when there is auxiliary fields + * made the parser a bit more robust + +------------------------------------------------------------------------ +r42 | lh3lh3 | 2008-12-10 14:57:29 +0000 (Wed, 10 Dec 2008) | 5 lines +Changed paths: + M /branches/dev/samtools/bam_index.c + M /branches/dev/samtools/bamtk.c + M /branches/dev/samtools/bgzf.c + + * samtools-0.1.0-56 + * fixed a bug in bgzf (only reading is affected) + * fixed a typo in bam_index.c + * in bam_index.c, check potential bugs in the underlying I/O library + +------------------------------------------------------------------------ +r41 | lh3lh3 | 2008-12-10 12:53:08 +0000 (Wed, 10 Dec 2008) | 2 lines +Changed paths: + M /branches/dev/samtools/samtools.1 + +update manual + +------------------------------------------------------------------------ +r40 | lh3lh3 | 2008-12-10 11:52:10 +0000 (Wed, 10 Dec 2008) | 5 lines +Changed paths: + M /branches/dev/samtools/bam.h + M /branches/dev/samtools/bam_pileup.c + M /branches/dev/samtools/bamtk.c + + * samtools-0.1.0-55 + * tried to make pileup work with clipping (previously not), though NOT tested + * removed -v from pileup + * made pileup take the reference sequence + +------------------------------------------------------------------------ +r39 | lh3lh3 | 2008-12-09 11:59:28 +0000 (Tue, 09 Dec 2008) | 4 lines +Changed paths: + M /branches/dev/samtools/bam_import.c + M /branches/dev/samtools/bamtk.c + M /branches/dev/samtools/samtools.1 + + * samtools-0.1.0-54 + * in parser, recognize "=", rather than ",", as a match + * in parser, correctl parse "=" at the MRNM field. + +------------------------------------------------------------------------ +r38 | lh3lh3 | 2008-12-09 11:39:07 +0000 (Tue, 09 Dec 2008) | 2 lines +Changed paths: + M /branches/dev/samtools/misc/maq2sam.c + +fixed a bug in handling maq flag 64 and 192 + +------------------------------------------------------------------------ +r37 | lh3lh3 | 2008-12-09 09:53:46 +0000 (Tue, 09 Dec 2008) | 2 lines +Changed paths: + M /branches/dev/samtools/misc/md5fa.c + +also calculate unordered md5sum check + +------------------------------------------------------------------------ +r36 | lh3lh3 | 2008-12-09 09:46:21 +0000 (Tue, 09 Dec 2008) | 2 lines +Changed paths: + M /branches/dev/samtools/misc/md5fa.c + +fixed a minor bug when there are space in the sequence + +------------------------------------------------------------------------ +r35 | lh3lh3 | 2008-12-09 09:40:45 +0000 (Tue, 09 Dec 2008) | 2 lines +Changed paths: + M /branches/dev/samtools/misc/md5fa.c + +fixed a potential memory leak + +------------------------------------------------------------------------ +r34 | lh3lh3 | 2008-12-08 14:52:17 +0000 (Mon, 08 Dec 2008) | 2 lines +Changed paths: + M /branches/dev/samtools/bam_import.c + M /branches/dev/samtools/bam_index.c + M /branches/dev/samtools/bamtk.c + + * fixed a bug in import: bin is wrongly calculated + +------------------------------------------------------------------------ +r33 | lh3lh3 | 2008-12-08 14:08:01 +0000 (Mon, 08 Dec 2008) | 2 lines +Changed paths: + M /branches/dev/samtools/misc/all2sam.pl + +nothing, really + +------------------------------------------------------------------------ +r32 | lh3lh3 | 2008-12-08 12:56:02 +0000 (Mon, 08 Dec 2008) | 3 lines +Changed paths: + M /branches/dev/samtools/Makefile + M /branches/dev/samtools/kseq.h + M /branches/dev/samtools/misc/Makefile + A /branches/dev/samtools/misc/md5.c + A /branches/dev/samtools/misc/md5.h + A /branches/dev/samtools/misc/md5fa.c + + * fixed two warnings in kseq.h + * added md5sum utilities + +------------------------------------------------------------------------ +r31 | lh3lh3 | 2008-12-08 11:35:29 +0000 (Mon, 08 Dec 2008) | 5 lines +Changed paths: + M /branches/dev/samtools/Makefile + M /branches/dev/samtools/bam_import.c + M /branches/dev/samtools/bamtk.c + A /branches/dev/samtools/kseq.h + D /branches/dev/samtools/kstream.h + + * samtools-0.1.0-52 + * replace kstream with kseq. kseq is a superset of kstream. I need the + extra functions in kseq.h. + * also compile stand-alone faidx + +------------------------------------------------------------------------ +r30 | lh3lh3 | 2008-12-08 11:17:04 +0000 (Mon, 08 Dec 2008) | 3 lines +Changed paths: + M /branches/dev/samtools/bam.h + M /branches/dev/samtools/bam_sort.c + M /branches/dev/samtools/bamtk.c + + * samtools-0.1.0-51 + * sorting by read names is available + +------------------------------------------------------------------------ +r29 | lh3lh3 | 2008-12-08 10:29:02 +0000 (Mon, 08 Dec 2008) | 3 lines +Changed paths: + M /branches/dev/samtools/bam.c + M /branches/dev/samtools/bam.h + M /branches/dev/samtools/bam_import.c + M /branches/dev/samtools/bam_maqcns.c + M /branches/dev/samtools/bam_pileup.c + M /branches/dev/samtools/bam_sort.c + M /branches/dev/samtools/bam_tview.c + M /branches/dev/samtools/bamtk.c + M /branches/dev/samtools/misc/maq2sam.c + + * samtools-0.1.0-50 + * format change to meet the latest specification + +------------------------------------------------------------------------ +r28 | lh3lh3 | 2008-12-04 16:09:21 +0000 (Thu, 04 Dec 2008) | 3 lines +Changed paths: + M /branches/dev/samtools/bam_maqcns.c + M /branches/dev/samtools/misc/maq2sam.c + + * minor change in maqcns: special care when n==0 + * change maq2sam to meet the latest specification + +------------------------------------------------------------------------ +r27 | lh3lh3 | 2008-12-04 15:55:44 +0000 (Thu, 04 Dec 2008) | 2 lines +Changed paths: + M /branches/dev/samtools/razf.c + M /branches/dev/samtools/razf.h + +considerable code clean up in razf + +------------------------------------------------------------------------ +r26 | lh3lh3 | 2008-12-04 15:08:18 +0000 (Thu, 04 Dec 2008) | 2 lines +Changed paths: + M /branches/dev/samtools/ChangeLog + M /branches/dev/samtools/Makefile + M /branches/dev/samtools/faidx.c + +make RAZF optional in faidx.c + +------------------------------------------------------------------------ +r25 | lh3lh3 | 2008-12-01 15:27:22 +0000 (Mon, 01 Dec 2008) | 3 lines +Changed paths: + M /branches/dev/samtools/Makefile + M /branches/dev/samtools/bam.h + M /branches/dev/samtools/bam_aux.c + M /branches/dev/samtools/bamtk.c + M /branches/dev/samtools/samtools.1 + + * samtools-0.1.0-49 + * added routines for retrieving aux data, NOT TESTED YET! + +------------------------------------------------------------------------ +r24 | lh3lh3 | 2008-12-01 14:29:43 +0000 (Mon, 01 Dec 2008) | 5 lines +Changed paths: + M /branches/dev/samtools/bam.c + M /branches/dev/samtools/bam_import.c + M /branches/dev/samtools/bam_maqcns.c + M /branches/dev/samtools/bamtk.c + M /branches/dev/samtools/bgzf.c + M /branches/dev/samtools/samtools.1 + + * samtools-0.1.0-48 + * bgzf: fixed a potential integer overflow on 32-it machines + * maqcns: set the minimum combined quality as 0 + * supporting hex strings + +------------------------------------------------------------------------ +r23 | lh3lh3 | 2008-11-27 17:14:37 +0000 (Thu, 27 Nov 2008) | 3 lines +Changed paths: + M /branches/dev/samtools/bam_maqcns.c + M /branches/dev/samtools/bamtk.c + + * samtools-0.1.0-47 + * fixed the bug in maqcns + +------------------------------------------------------------------------ +r22 | lh3lh3 | 2008-11-27 17:08:11 +0000 (Thu, 27 Nov 2008) | 3 lines +Changed paths: + M /branches/dev/samtools/Makefile + M /branches/dev/samtools/bam.h + A /branches/dev/samtools/bam_maqcns.c + A /branches/dev/samtools/bam_maqcns.h + M /branches/dev/samtools/bam_tview.c + M /branches/dev/samtools/bamtk.c + A /branches/dev/samtools/glf.h + + * samtools-0.1.0-46 + * add MAQ consensus caller, currently BUGGY! + +------------------------------------------------------------------------ +r21 | lh3lh3 | 2008-11-27 13:51:28 +0000 (Thu, 27 Nov 2008) | 4 lines +Changed paths: + M /branches/dev/samtools/bam_pileup.c + M /branches/dev/samtools/bam_tview.c + M /branches/dev/samtools/bamtk.c + + * samtools-0.1.0-45 + * tview: display padded alignment (but not P operation) + * better coordinates and reference sequence + +------------------------------------------------------------------------ +r19 | lh3lh3 | 2008-11-27 09:26:05 +0000 (Thu, 27 Nov 2008) | 2 lines +Changed paths: + A /branches/dev/samtools/ChangeLog + +new ChangeLog + +------------------------------------------------------------------------ +r18 | lh3lh3 | 2008-11-27 09:24:45 +0000 (Thu, 27 Nov 2008) | 3 lines +Changed paths: + D /branches/dev/samtools/ChangeLog + A /branches/dev/samtools/ChangeLog.old (from /branches/dev/samtools/ChangeLog:6) + +Rename ChangeLog to ChangeLog.old. This old ChangeLog is generated from +the log of my personal SVN repository. + +------------------------------------------------------------------------ +r17 | lh3lh3 | 2008-11-27 09:22:55 +0000 (Thu, 27 Nov 2008) | 6 lines +Changed paths: + M /branches/dev/samtools/Makefile + M /branches/dev/samtools/bamtk.c + M /branches/dev/samtools/bgzf.c + + * samtools-0.1.0-44 + * declare fseeko and ftello as some Linux may not do this by default and + missing these declarations will make bgzf buggy + * get rid of some harmless warings + * use BGZF by default, now + +------------------------------------------------------------------------ +r16 | lh3lh3 | 2008-11-26 21:19:11 +0000 (Wed, 26 Nov 2008) | 4 lines +Changed paths: + M /branches/dev/samtools/bam_index.c + M /branches/dev/samtools/bamtk.c + M /branches/dev/samtools/razf.c + + * samtools-0.1.0-43 + * fixed a bug in razf_read() + * give more warnings when the file is truncated (or due to bugs in I/O library) + +------------------------------------------------------------------------ +r15 | lh3lh3 | 2008-11-26 20:41:39 +0000 (Wed, 26 Nov 2008) | 2 lines +Changed paths: + M /branches/dev/samtools/bgzf.c + +fixed a bug in bgzf.c at the end of the file + +------------------------------------------------------------------------ +r14 | lh3lh3 | 2008-11-26 17:05:18 +0000 (Wed, 26 Nov 2008) | 4 lines +Changed paths: + M /branches/dev/samtools/bamtk.c + + * samtools-0.1.0-42 + * a lot happened to RAZF, although samtools itself is untouched. Better + also update the version number anyway to avoid confusion + +------------------------------------------------------------------------ +r13 | lh3lh3 | 2008-11-26 17:03:48 +0000 (Wed, 26 Nov 2008) | 2 lines +Changed paths: + M /branches/dev/samtools/razf.c + +a change from Jue, but I think it should not matter + +------------------------------------------------------------------------ +r12 | lh3lh3 | 2008-11-26 16:48:14 +0000 (Wed, 26 Nov 2008) | 3 lines +Changed paths: + M /branches/dev/samtools/razf.c + +fixed a potential bug in razf. However, it seems still buggy, just +rarely happens, very rarely. + +------------------------------------------------------------------------ +r11 | lh3lh3 | 2008-11-26 14:02:56 +0000 (Wed, 26 Nov 2008) | 2 lines +Changed paths: + M /branches/dev/samtools/razf.c + +fixed a bug in razf, with the help of Jue + +------------------------------------------------------------------------ +r10 | lh3lh3 | 2008-11-26 11:55:32 +0000 (Wed, 26 Nov 2008) | 2 lines +Changed paths: + M /branches/dev/samtools/bam_index.c + +remove a comment + +------------------------------------------------------------------------ +r9 | lh3lh3 | 2008-11-26 11:37:05 +0000 (Wed, 26 Nov 2008) | 2 lines +Changed paths: + M /branches/dev/samtools/Makefile + M /branches/dev/samtools/bam.h + M /branches/dev/samtools/razf.c + M /branches/dev/samtools/razf.h + + * Jue has updated razf to realize Bob's scheme + +------------------------------------------------------------------------ +r7 | lh3lh3 | 2008-11-25 20:37:37 +0000 (Tue, 25 Nov 2008) | 2 lines +Changed paths: + A /branches/dev/samtools/samtools.1 + +the manual page + +------------------------------------------------------------------------ +r6 | lh3lh3 | 2008-11-25 20:37:16 +0000 (Tue, 25 Nov 2008) | 3 lines +Changed paths: + A /branches/dev/samtools/ChangeLog + A /branches/dev/samtools/Makefile + A /branches/dev/samtools/bam.c + A /branches/dev/samtools/bam.h + A /branches/dev/samtools/bam_aux.c + A /branches/dev/samtools/bam_endian.h + A /branches/dev/samtools/bam_import.c + A /branches/dev/samtools/bam_index.c + A /branches/dev/samtools/bam_lpileup.c + A /branches/dev/samtools/bam_pileup.c + A /branches/dev/samtools/bam_sort.c + A /branches/dev/samtools/bam_tview.c + A /branches/dev/samtools/bamtk.c + A /branches/dev/samtools/bgzf.c + A /branches/dev/samtools/bgzf.h + A /branches/dev/samtools/bgzip.c + A /branches/dev/samtools/faidx.c + A /branches/dev/samtools/faidx.h + A /branches/dev/samtools/khash.h + A /branches/dev/samtools/ksort.h + A /branches/dev/samtools/kstream.h + A /branches/dev/samtools/misc + A /branches/dev/samtools/misc/Makefile + A /branches/dev/samtools/misc/all2sam.pl + A /branches/dev/samtools/misc/maq2sam.c + A /branches/dev/samtools/razf.c + A /branches/dev/samtools/razf.h + A /branches/dev/samtools/razip.c + A /branches/dev/samtools/zutil.h + +The initial version of samtools, replicated from my local SVN repository. +The current version is: 0.1.0-42. All future development will happen here. + +------------------------------------------------------------------------ +r5 | lh3lh3 | 2008-11-25 20:30:49 +0000 (Tue, 25 Nov 2008) | 2 lines +Changed paths: + A /branches/dev/samtools + +samtools (C version) + +------------------------------------------------------------------------
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/SNV/SNVMix2_source/SNVMix2-v0.12.1-rc1/samtools-0.1.6/INSTALL Wed Oct 12 19:50:38 2011 -0400 @@ -0,0 +1,29 @@ +System Requirements +=================== + +SAMtools depends on the zlib library <http://www.zlib.net>. The latest +version 1.2.3 is preferred and with the latest version you can compile +razip and use it to compress a FASTA file. SAMtools' faidx is able to +index a razip-compressed FASTA file to save diskspace. Older zlib also +works with SAMtools, but razip cannot be compiled. + +The text-based viewer (tview) requires the GNU ncurses library +<http://www.gnu.org/software/ncurses/>, which comes with Mac OS X and +most of the modern Linux/Unix distributions. If you do not have this +library installed, you can still compile the rest of SAMtools by +manually modifying one line in Makefile. + + +Compilation +=========== + +Type `make' to compile samtools. If you have zlib >= 1.2.2.1, you can +compile razip with `make razip'. + + +Installation +============ + +Simply copy `samtools' and other executables/scripts in `misc' to a +location you want (e.g. a directory in your $PATH). No further +configurations are required.
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/SNV/SNVMix2_source/SNVMix2-v0.12.1-rc1/samtools-0.1.6/Makefile Wed Oct 12 19:50:38 2011 -0400 @@ -0,0 +1,67 @@ +CC= gcc +CFLAGS= -g -Wall -O2 #-m64 #-arch ppc +DFLAGS= -D_FILE_OFFSET_BITS=64 -D_USE_KNETFILE -D_CURSES_LIB=1 +LOBJS= bgzf.o kstring.o bam_aux.o bam.o bam_import.o sam.o bam_index.o \ + bam_pileup.o bam_lpileup.o bam_md.o glf.o razf.o faidx.o knetfile.o \ + bam_sort.o +AOBJS= bam_tview.o bam_maqcns.o bam_plcmd.o sam_view.o \ + bam_rmdup.o bam_rmdupse.o bam_mate.o bam_stat.o bam_color.o \ + bamtk.o +PROG= samtools +INCLUDES= +SUBDIRS= . misc +LIBPATH= +LIBCURSES= -lcurses # -lXCurses + +.SUFFIXES:.c .o + +.c.o: + $(CC) -c $(CFLAGS) $(DFLAGS) $(INCLUDES) $< -o $@ + +all-recur lib-recur clean-recur cleanlocal-recur install-recur: + @target=`echo $@ | sed s/-recur//`; \ + wdir=`pwd`; \ + list='$(SUBDIRS)'; for subdir in $$list; do \ + cd $$subdir; \ + $(MAKE) CC="$(CC)" DFLAGS="$(DFLAGS)" CFLAGS="$(CFLAGS)" \ + INCLUDES="$(INCLUDES)" LIBPATH="$(LIBPATH)" $$target || exit 1; \ + cd $$wdir; \ + done; + +all:$(PROG) + +lib:libbam.a + +libbam.a:$(LOBJS) + $(AR) -cru $@ $(LOBJS) + +samtools:lib $(AOBJS) + $(CC) $(CFLAGS) -o $@ $(AOBJS) -lm $(LIBPATH) $(LIBCURSES) -lz -L. -lbam + +razip:razip.o razf.o + $(CC) $(CFLAGS) -o $@ razf.o razip.o -lz + +bgzip:bgzip.o bgzf.o + $(CC) $(CFLAGS) -o $@ bgzf.o bgzip.o -lz + +razip.o:razf.h +bam.o:bam.h razf.h bam_endian.h kstring.h +sam.o:sam.h bam.h +bam_import.o:bam.h kseq.h khash.h razf.h +bam_pileup.o:bam.h razf.h ksort.h +bam_plcmd.o:bam.h faidx.h bam_maqcns.h glf.h +bam_index.o:bam.h khash.h ksort.h razf.h bam_endian.h +bam_lpileup.o:bam.h ksort.h +bam_tview.o:bam.h faidx.h bam_maqcns.h +bam_maqcns.o:bam.h ksort.h bam_maqcns.h +bam_sort.o:bam.h ksort.h razf.h +bam_md.o:bam.h faidx.h +glf.o:glf.h + +faidx.o:faidx.h razf.h khash.h +faidx_main.o:faidx.h razf.h + +cleanlocal: + rm -fr gmon.out *.o a.out *.dSYM razip $(PROG) *~ *.a + +clean:cleanlocal-recur
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/SNV/SNVMix2_source/SNVMix2-v0.12.1-rc1/samtools-0.1.6/Makefile.mingw Wed Oct 12 19:50:38 2011 -0400 @@ -0,0 +1,55 @@ +CC= gcc.exe +AR= ar.exe +CFLAGS= -g -Wall -O2 +DFLAGS= -D_FILE_OFFSET_BITS=64 -D_CURSES_LIB=2 -D_USE_KNETFILE +LOBJS= bgzf.o kstring.o bam_aux.o bam.o bam_import.o sam.o bam_index.o \ + bam_pileup.o bam_lpileup.o bam_md.o glf.o razf.o faidx.o bam_sort.o \ + knetfile.o +AOBJS= bam_tview.o bam_maqcns.o bam_plcmd.o sam_view.o \ + bam_rmdup.o bam_rmdupse.o bam_mate.o bam_stat.o bam_color.o \ + bamtk.o +PROG= samtools +INCLUDES= -Iwin32 +SUBDIRS= . +LIBPATH= + +.SUFFIXES:.c .o + +.c.o: + $(CC) -c $(CFLAGS) $(DFLAGS) $(INCLUDES) $< -o $@ + +all:$(PROG) + +lib:libbam.a + +libbam.a:$(LOBJS) + $(AR) -cru $@ $(LOBJS) + +samtools:lib $(AOBJS) + $(CC) $(CFLAGS) -o $@ $(AOBJS) $(LIBPATH) -lm -L. -lbam -Lwin32 -lz -lcurses -lws2_32 + +razip:razip.o razf.o + $(CC) $(CFLAGS) -o $@ razf.o razip.o -lz + +bgzip:bgzip.o bgzf.o + $(CC) $(CFLAGS) -o $@ bgzf.o bgzip.o -lz + +razip.o:razf.h +bam.o:bam.h razf.h bam_endian.h kstring.h +sam.o:sam.h bam.h +bam_import.o:bam.h kseq.h khash.h razf.h +bam_pileup.o:bam.h razf.h ksort.h +bam_plcmd.o:bam.h faidx.h bam_maqcns.h glf.h +bam_index.o:bam.h khash.h ksort.h razf.h bam_endian.h +bam_lpileup.o:bam.h ksort.h +bam_tview.o:bam.h faidx.h bam_maqcns.h +bam_maqcns.o:bam.h ksort.h bam_maqcns.h +bam_sort.o:bam.h ksort.h razf.h +bam_md.o:bam.h faidx.h +glf.o:glf.h + +faidx.o:faidx.h razf.h khash.h +faidx_main.o:faidx.h razf.h + +clean: + rm -fr gmon.out *.o *.exe *.dSYM razip $(PROG) *~ *.a
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/SNV/SNVMix2_source/SNVMix2-v0.12.1-rc1/samtools-0.1.6/NEWS Wed Oct 12 19:50:38 2011 -0400 @@ -0,0 +1,275 @@ +Beta Release 0.1.6 (2 September, 2009) +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ + +Notable changes: + + * In tview, do not show a blank screen when no reads mapped to the + corresponding region. + + * Implemented native HTTP support in the BGZF library. Samtools is now + able to directly open a BAM file on HTTP. HTTP proxy is also + supported via the "http_proxy" environmental variable. + + * Samtools is now compitable with the MinGW (win32) compiler and the + PDCurses library. + + * The calmd (or fillmd) command now calculates the NM tag and replaces + MD tags if they are wrong. + + * The view command now recognizes and optionally prints FLAG in HEXs or + strings to make a SAM file more friendly to human eyes. This is a + samtools-C extension, not implemented in Picard for the time + being. Please type `samtools view -?' for more information. + + * BAM files now have an end-of-file (EOF) marker to facilitate + truncation detection. A warning will be given if an on-disk BAM file + does not have this marker. The warning will be seen on BAM files + generated by an older version of samtools. It does NO harm. + + * New key bindings in tview: `r' to show read names and `s' to show + reference skip (N operation) as deletions. + + * Fixed a bug in `samtools merge -n'. + + * Samtools merge now optionally copies the header of a user specified + SAM file to the resultant BAM output. + + * Samtools pileup/tview works with a CIGAR with the first or the last + operation is an indel. + + * Fixed a bug in bam_aux_get(). + + +Changes in other utilies: + + * Fixed wrong FLAG in maq2sam. + + +(0.1.6: 2 September 2009, r453) + + + +Beta Release 0.1.5 (7 July, 2009) +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ + +Notable changes: + + * Support opening a BAM alignment on FTP. Users can now use "tview" to + view alignments at the NCBI ftp site. Please read manual for more + information. + + * In library, propagate errors rather than exit or complain assertion + failure. + + * Simplified the building system and fixed compiling errors caused by + zlib<1.2.2.1. + + * Fixed an issue about lost header information when a SAM is imported + with "view -t". + + * Implemented "samtool.pl varFilter" which filters both SNPs and short + indels. This command replaces "indelFilter". + + * Implemented "samtools.pl pileup2fq" to generate FASTQ consensus from + pileup output. + + * In pileup, cap mapping quality at 60. This helps filtering when + different aligners are in use. + + * In pileup, allow to output variant sites only. + + * Made pileup generate correct calls in repetitive region. At the same + time, I am considering to implement a simplified model in SOAPsnp, + although this has not happened yet. + + * In view, added '-u' option to output BAM without compression. This + option is preferred when the output is piped to other commands. + + * In view, added '-l' and '-r' to get the alignments for one library or + read group. The "@RG" header lines are now partially parsed. + + * Do not include command line utilities to libbam.a. + + * Fixed memory leaks in pileup and bam_view1(). + + * Made faidx more tolerant to empty lines right before or after FASTA > + lines. + + +Changes in other utilities: + + * Updated novo2sam.pl by Colin Hercus, the key developer of novoalign. + + +This release involves several modifications to the key code base which +may potentially introduce new bugs even though we have tried to minimize +this by testing on several examples. Please let us know if you catch +bugs. + +(0.1.5: 7 July 2009, r373) + + + +Beta Release 0.1.4 (21 May, 2009) +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ + +Notable changes: + + * Added the 'rmdupse' command: removing duplicates for SE reads. + + * Fixed a critical bug in the indel caller: clipped alignments are not + processed correctly. + + * Fixed a bug in the tview: gapped alignment may be incorrectly + displayed. + + * Unified the interface to BAM and SAM I/O. This is done by + implementing a wrapper on top of the old APIs and therefore old APIs + are still valid. The new I/O APIs also recognize the @SQ header + lines. + + * Generate the MD tag. + + * Generate "=" bases. However, the indel caller will not work when "=" + bases are present. + + * Enhanced support of color-read display (by Nils Homer). + + * Implemented the GNU building system. However, currently the building + system does not generate libbam.a. We will improve this later. For + the time being, `make -f Makefile.generic' is preferred. + + * Fixed a minor bug in pileup: the first read in a chromosome may be + skipped. + + * Fixed bugs in bam_aux.c. These bugs do not affect other components as + they were not used previously. + + * Output the 'SM' tag from maq2sam. + +(0.1.4: 21 May 2009, r297) + + + +Beta Release 0.1.3 (15 April, 2009) +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ + +Notable changes in SAMtools: + + * SAMtools is more consistent with the specification: a) '*' in the + QUAL field is allowed; b) the field separator is TAB only and SPACE + is treated as a character in a field; c) empty header is allowed. + + * Implemented GLFv3 support in pileup. + + * Fixed a severe bug in fixmate: strand information is wrongly + overwritten. + + * Fixed a bug in alignment retrieval: alignments bridging n*16384bp are + not correctly retrieved sometimes. + + * Fixed a bug in rmdup: segfault if unmapped reads are present. + + * Move indel_filter.pl to samtools.pl and improved the filtering by + checking the actual number of alignments containing indels. The indel + pileup line is also changed a little to make this filtration easier. + + * Fixed a minor bug in indexing: the bin number of an unmapped read is + wrongly calculated. + + * Added `flagstat' command to show statistics on the FLAG field. + + * Improved indel caller by setting the maximum window size in local + realignment. + +Changes in other utilities: + + * Fixed a bug in maq2sam: a tag name is obsolete. + + * Improvement to wgsim: a) added support for SOLiD read simulation; b) + show the number of substitutions/indels/errors in read name; c) + considerable code clean up. + + * Various converters: improved functionality in general. + + * Updated the example SAM due to the previous bug in fixmate. + +(0.1.3: 15 April 2009, r227) + + + +Beta Release 0.1.2 (28 January, 2008) +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ + +Notable changes in SAMtools: + + * Implemented a Bayesian indel caller. The new caller generate scores + and genotype and is potentially more accurate than Maq's indel + caller. The pileup format is also changed accordingly. + + * Implemented rmdup command: remove potential PCR duplicates. Note that + this command ONLY works for FR orientation and requires ISIZE is + correctly set. + + * Added fixmate command: fill in mate coordinates, ISIZE and mate + related flags from a name-sorted alignment. + + * Fixed a bug in indexing: reads bridging 16x kbp were not retrieved. + + * Allow to select reads shown in the pileup output with a mask. + + * Generate GLFv2 from pileup. + + * Added two more flags for flagging PCR/optical duplicates and for QC + failure. + + * Fixed a bug in sort command: name sorting for large alignment did not + work. + + * Allow to completely disable RAZF (using Makefile.lite) as some people + have problem to compile it. + + * Fixed a bug in import command when there are reads without + coordinates. + + * Fixed a bug in tview: clipping broke the alignment viewer. + + * Fixed a compiling error when _NO_CURSES is applied. + + * Fixed a bug in merge command. + +Changes in other utilities: + + * Added wgsim, a paired-end reads simulator. Wgsim was adapted from + maq's reads simulator. Colin Hercus further improved it to allow + longer indels. + + * Added wgsim_eval.pl, a script that evaluates the accuracy of + alignment on reads generated by wgsim. + + * Added soap2sam.pl, a SOAP2->SAM converter. This converter does not + work properly when multiple hits are output. + + * Added bowtie2sam.pl, a Bowtie->SAM converter. Only the top hit will + be retained when multiple hits are present. + + * Fixed a bug in export2sam.pl for QC reads. + + * Support RG tag at MAQ->SAM converter. + + * Added novo2sam.pl, a NovoAlign->SAM converter. Multiple hits and + indel are not properly handled, though. + + * Added zoom2sam.pl, a ZOOM->SAM converter. It only works with the + default Illumina output. + +(0.1.2: 28 January 2008; r116) + + + +Beta Release 0.1.1 (22 December, 2008) +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ + +The is the first public release of samtools. For more information, +please check the manual page `samtools.1' and the samtools website +http://samtools.sourceforge.net \ No newline at end of file
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/SNV/SNVMix2_source/SNVMix2-v0.12.1-rc1/samtools-0.1.6/bam.c Wed Oct 12 19:50:38 2011 -0400 @@ -0,0 +1,310 @@ +#include <stdio.h> +#include <ctype.h> +#include <assert.h> +#include "bam.h" +#include "bam_endian.h" +#include "kstring.h" + +int bam_is_be = 0; +char *bam_flag2char_table = "pPuUrR12sfd\0\0\0\0\0"; + +/************************** + * CIGAR related routines * + **************************/ + +int bam_segreg(int32_t pos, const bam1_core_t *c, const uint32_t *cigar, bam_segreg_t *reg) +{ + unsigned k; + int32_t x = c->pos, y = 0; + int state = 0; + for (k = 0; k < c->n_cigar; ++k) { + int op = cigar[k] & BAM_CIGAR_MASK; // operation + int l = cigar[k] >> BAM_CIGAR_SHIFT; // length + if (state == 0 && (op == BAM_CMATCH || op == BAM_CDEL || op == BAM_CINS) && x + l > pos) { + reg->tbeg = x; reg->qbeg = y; reg->cbeg = k; + state = 1; + } + if (op == BAM_CMATCH) { x += l; y += l; } + else if (op == BAM_CDEL || op == BAM_CREF_SKIP) x += l; + else if (op == BAM_CINS || op == BAM_CSOFT_CLIP) y += l; + if (state == 1 && (op == BAM_CSOFT_CLIP || op == BAM_CHARD_CLIP || op == BAM_CREF_SKIP || k == c->n_cigar - 1)) { + reg->tend = x; reg->qend = y; reg->cend = k; + } + } + return state? 0 : -1; +} + +uint32_t bam_calend(const bam1_core_t *c, const uint32_t *cigar) +{ + uint32_t k, end; + end = c->pos; + for (k = 0; k < c->n_cigar; ++k) { + int op = cigar[k] & BAM_CIGAR_MASK; + if (op == BAM_CMATCH || op == BAM_CDEL || op == BAM_CREF_SKIP) + end += cigar[k] >> BAM_CIGAR_SHIFT; + } + return end; +} + +int32_t bam_cigar2qlen(const bam1_core_t *c, const uint32_t *cigar) +{ + uint32_t k; + int32_t l = 0; + for (k = 0; k < c->n_cigar; ++k) { + int op = cigar[k] & BAM_CIGAR_MASK; + if (op == BAM_CMATCH || op == BAM_CINS || op == BAM_CSOFT_CLIP) + l += cigar[k] >> BAM_CIGAR_SHIFT; + } + return l; +} + +/******************** + * BAM I/O routines * + ********************/ + +bam_header_t *bam_header_init() +{ + bam_is_be = bam_is_big_endian(); + return (bam_header_t*)calloc(1, sizeof(bam_header_t)); +} + +void bam_header_destroy(bam_header_t *header) +{ + int32_t i; + extern void bam_destroy_header_hash(bam_header_t *header); + if (header == 0) return; + if (header->target_name) { + for (i = 0; i < header->n_targets; ++i) + free(header->target_name[i]); + free(header->target_name); + free(header->target_len); + } + free(header->text); +#ifndef BAM_NO_HASH + if (header->rg2lib) bam_strmap_destroy(header->rg2lib); + bam_destroy_header_hash(header); +#endif + free(header); +} + +bam_header_t *bam_header_read(bamFile fp) +{ + bam_header_t *header; + char buf[4]; + int32_t i = 1, name_len; + // check EOF + i = bgzf_check_EOF(fp); + if (i < 0) fprintf(stderr, "[bam_header_read] read from pipe; skip EOF checking.\n"); + else if (i == 0) fprintf(stderr, "[bam_header_read] EOF marker is absent.\n"); + // read "BAM1" + if (bam_read(fp, buf, 4) != 4) return 0; + if (strncmp(buf, "BAM\001", 4)) { + fprintf(stderr, "[bam_header_read] wrong header\n"); + return 0; + } + header = bam_header_init(); + // read plain text and the number of reference sequences + bam_read(fp, &header->l_text, 4); + if (bam_is_be) bam_swap_endian_4p(&header->l_text); + header->text = (char*)calloc(header->l_text + 1, 1); + bam_read(fp, header->text, header->l_text); + bam_read(fp, &header->n_targets, 4); + if (bam_is_be) bam_swap_endian_4p(&header->n_targets); + // read reference sequence names and lengths + header->target_name = (char**)calloc(header->n_targets, sizeof(char*)); + header->target_len = (uint32_t*)calloc(header->n_targets, 4); + for (i = 0; i != header->n_targets; ++i) { + bam_read(fp, &name_len, 4); + if (bam_is_be) bam_swap_endian_4p(&name_len); + header->target_name[i] = (char*)calloc(name_len, 1); + bam_read(fp, header->target_name[i], name_len); + bam_read(fp, &header->target_len[i], 4); + if (bam_is_be) bam_swap_endian_4p(&header->target_len[i]); + } + return header; +} + +int bam_header_write(bamFile fp, const bam_header_t *header) +{ + char buf[4]; + int32_t i, name_len, x; + // write "BAM1" + strncpy(buf, "BAM\001", 4); + bam_write(fp, buf, 4); + // write plain text and the number of reference sequences + if (bam_is_be) { + x = bam_swap_endian_4(header->l_text); + bam_write(fp, &x, 4); + if (header->l_text) bam_write(fp, header->text, header->l_text); + x = bam_swap_endian_4(header->n_targets); + bam_write(fp, &x, 4); + } else { + bam_write(fp, &header->l_text, 4); + if (header->l_text) bam_write(fp, header->text, header->l_text); + bam_write(fp, &header->n_targets, 4); + } + // write sequence names and lengths + for (i = 0; i != header->n_targets; ++i) { + char *p = header->target_name[i]; + name_len = strlen(p) + 1; + if (bam_is_be) { + x = bam_swap_endian_4(name_len); + bam_write(fp, &x, 4); + } else bam_write(fp, &name_len, 4); + bam_write(fp, p, name_len); + if (bam_is_be) { + x = bam_swap_endian_4(header->target_len[i]); + bam_write(fp, &x, 4); + } else bam_write(fp, &header->target_len[i], 4); + } + return 0; +} + +static void swap_endian_data(const bam1_core_t *c, int data_len, uint8_t *data) +{ + uint8_t *s; + uint32_t i, *cigar = (uint32_t*)(data + c->l_qname); + s = data + c->n_cigar*4 + c->l_qname + c->l_qseq + (c->l_qseq + 1)/2; + for (i = 0; i < c->n_cigar; ++i) bam_swap_endian_4p(&cigar[i]); + while (s < data + data_len) { + uint8_t type; + s += 2; // skip key + type = toupper(*s); ++s; // skip type + if (type == 'C' || type == 'A') ++s; + else if (type == 'S') { bam_swap_endian_2p(s); s += 2; } + else if (type == 'I' || type == 'F') { bam_swap_endian_4p(s); s += 4; } + else if (type == 'D') { bam_swap_endian_8p(s); s += 8; } + else if (type == 'Z' || type == 'H') { while (*s) ++s; ++s; } + } +} + +int bam_read1(bamFile fp, bam1_t *b) +{ + bam1_core_t *c = &b->core; + int32_t block_len, ret, i; + uint32_t x[8]; + + assert(BAM_CORE_SIZE == 32); + if ((ret = bam_read(fp, &block_len, 4)) != 4) { + if (ret == 0) return -1; // normal end-of-file + else return -2; // truncated + } + if (bam_read(fp, x, BAM_CORE_SIZE) != BAM_CORE_SIZE) return -3; + if (bam_is_be) { + bam_swap_endian_4p(&block_len); + for (i = 0; i < 8; ++i) bam_swap_endian_4p(x + i); + } + c->tid = x[0]; c->pos = x[1]; + c->bin = x[2]>>16; c->qual = x[2]>>8&0xff; c->l_qname = x[2]&0xff; + c->flag = x[3]>>16; c->n_cigar = x[3]&0xffff; + c->l_qseq = x[4]; + c->mtid = x[5]; c->mpos = x[6]; c->isize = x[7]; + b->data_len = block_len - BAM_CORE_SIZE; + if (b->m_data < b->data_len) { + b->m_data = b->data_len; + kroundup32(b->m_data); + b->data = (uint8_t*)realloc(b->data, b->m_data); + } + if (bam_read(fp, b->data, b->data_len) != b->data_len) return -4; + b->l_aux = b->data_len - c->n_cigar * 4 - c->l_qname - c->l_qseq - (c->l_qseq+1)/2; + if (bam_is_be) swap_endian_data(c, b->data_len, b->data); + return 4 + block_len; +} + +inline int bam_write1_core(bamFile fp, const bam1_core_t *c, int data_len, uint8_t *data) +{ + uint32_t x[8], block_len = data_len + BAM_CORE_SIZE, y; + int i; + assert(BAM_CORE_SIZE == 32); + x[0] = c->tid; + x[1] = c->pos; + x[2] = (uint32_t)c->bin<<16 | c->qual<<8 | c->l_qname; + x[3] = (uint32_t)c->flag<<16 | c->n_cigar; + x[4] = c->l_qseq; + x[5] = c->mtid; + x[6] = c->mpos; + x[7] = c->isize; + if (bam_is_be) { + for (i = 0; i < 8; ++i) bam_swap_endian_4p(x + i); + y = block_len; + bam_write(fp, bam_swap_endian_4p(&y), 4); + swap_endian_data(c, data_len, data); + } else bam_write(fp, &block_len, 4); + bam_write(fp, x, BAM_CORE_SIZE); + bam_write(fp, data, data_len); + if (bam_is_be) swap_endian_data(c, data_len, data); + return 4 + block_len; +} + +int bam_write1(bamFile fp, const bam1_t *b) +{ + return bam_write1_core(fp, &b->core, b->data_len, b->data); +} + +char *bam_format1_core(const bam_header_t *header, const bam1_t *b, int of) +{ + uint8_t *s = bam1_seq(b), *t = bam1_qual(b); + int i; + const bam1_core_t *c = &b->core; + kstring_t str; + str.l = str.m = 0; str.s = 0; + + ksprintf(&str, "%s\t", bam1_qname(b)); + if (of == BAM_OFDEC) ksprintf(&str, "%d\t", c->flag); + else if (of == BAM_OFHEX) ksprintf(&str, "0x%x\t", c->flag); + else { // BAM_OFSTR + for (i = 0; i < 16; ++i) + if ((c->flag & 1<<i) && bam_flag2char_table[i]) + kputc(bam_flag2char_table[i], &str); + kputc('\t', &str); + } + if (c->tid < 0) kputs("*\t", &str); + else ksprintf(&str, "%s\t", header->target_name[c->tid]); + ksprintf(&str, "%d\t%d\t", c->pos + 1, c->qual); + if (c->n_cigar == 0) kputc('*', &str); + else { + for (i = 0; i < c->n_cigar; ++i) + ksprintf(&str, "%d%c", bam1_cigar(b)[i]>>BAM_CIGAR_SHIFT, "MIDNSHP"[bam1_cigar(b)[i]&BAM_CIGAR_MASK]); + } + kputc('\t', &str); + if (c->mtid < 0) kputs("*\t", &str); + else if (c->mtid == c->tid) kputs("=\t", &str); + else ksprintf(&str, "%s\t", header->target_name[c->mtid]); + ksprintf(&str, "%d\t%d\t", c->mpos + 1, c->isize); + if (c->l_qseq) { + for (i = 0; i < c->l_qseq; ++i) kputc(bam_nt16_rev_table[bam1_seqi(s, i)], &str); + kputc('\t', &str); + if (t[0] == 0xff) kputc('*', &str); + else for (i = 0; i < c->l_qseq; ++i) kputc(t[i] + 33, &str); + } else ksprintf(&str, "*\t*"); + s = bam1_aux(b); + while (s < b->data + b->data_len) { + uint8_t type, key[2]; + key[0] = s[0]; key[1] = s[1]; + s += 2; type = *s; ++s; + ksprintf(&str, "\t%c%c:", key[0], key[1]); + if (type == 'A') { ksprintf(&str, "A:%c", *s); ++s; } + else if (type == 'C') { ksprintf(&str, "i:%u", *s); ++s; } + else if (type == 'c') { ksprintf(&str, "i:%d", *s); ++s; } + else if (type == 'S') { ksprintf(&str, "i:%u", *(uint16_t*)s); s += 2; } + else if (type == 's') { ksprintf(&str, "i:%d", *(int16_t*)s); s += 2; } + else if (type == 'I') { ksprintf(&str, "i:%u", *(uint32_t*)s); s += 4; } + else if (type == 'i') { ksprintf(&str, "i:%d", *(int32_t*)s); s += 4; } + else if (type == 'f') { ksprintf(&str, "f:%g", *(float*)s); s += 4; } + else if (type == 'd') { ksprintf(&str, "d:%lg", *(double*)s); s += 8; } + else if (type == 'Z' || type == 'H') { ksprintf(&str, "%c:", type); while (*s) kputc(*s++, &str); ++s; } + } + return str.s; +} + +char *bam_format1(const bam_header_t *header, const bam1_t *b) +{ + return bam_format1_core(header, b, BAM_OFDEC); +} + +void bam_view1(const bam_header_t *header, const bam1_t *b) +{ + char *s = bam_format1(header, b); + printf("%s\n", s); + free(s); +}
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/SNV/SNVMix2_source/SNVMix2-v0.12.1-rc1/samtools-0.1.6/bam.h Wed Oct 12 19:50:38 2011 -0400 @@ -0,0 +1,702 @@ +/* The MIT License + + Copyright (c) 2008 Genome Research Ltd (GRL). + + Permission is hereby granted, free of charge, to any person obtaining + a copy of this software and associated documentation files (the + "Software"), to deal in the Software without restriction, including + without limitation the rights to use, copy, modify, merge, publish, + distribute, sublicense, and/or sell copies of the Software, and to + permit persons to whom the Software is furnished to do so, subject to + the following conditions: + + The above copyright notice and this permission notice shall be + included in all copies or substantial portions of the Software. + + THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, + EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF + MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND + NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS + BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN + ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN + CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE + SOFTWARE. +*/ + +/* Contact: Heng Li <lh3@sanger.ac.uk> */ + +#ifndef BAM_BAM_H +#define BAM_BAM_H + +/*! + @header + + BAM library provides I/O and various operations on manipulating files + in the BAM (Binary Alignment/Mapping) or SAM (Sequence Alignment/Map) + format. It now supports importing from or exporting to TAM, sorting, + merging, generating pileup, and quickly retrieval of reads overlapped + with a specified region. + + @copyright Genome Research Ltd. + */ + +#include <stdint.h> +#include <stdlib.h> +#include <string.h> +#include <stdio.h> + +#ifndef BAM_LITE +#define BAM_VIRTUAL_OFFSET16 +#include "bgzf.h" +/*! @abstract BAM file handler */ +typedef BGZF *bamFile; +#define bam_open(fn, mode) bgzf_open(fn, mode) +#define bam_dopen(fd, mode) bgzf_fdopen(fd, mode) +#define bam_close(fp) bgzf_close(fp) +#define bam_read(fp, buf, size) bgzf_read(fp, buf, size) +#define bam_write(fp, buf, size) bgzf_write(fp, buf, size) +#define bam_tell(fp) bgzf_tell(fp) +#define bam_seek(fp, pos, dir) bgzf_seek(fp, pos, dir) +#else +#define BAM_TRUE_OFFSET +#include <zlib.h> +typedef gzFile bamFile; +#define bam_open(fn, mode) gzopen(fn, mode) +#define bam_dopen(fd, mode) gzdopen(fd, mode) +#define bam_close(fp) gzclose(fp) +#define bam_read(fp, buf, size) gzread(fp, buf, size) +/* no bam_write/bam_tell/bam_seek() here */ +#endif + +/*! @typedef + @abstract Structure for the alignment header. + @field n_targets number of reference sequences + @field target_name names of the reference sequences + @field target_len lengths of the referene sequences + @field hash hash table for fast name lookup + @field rg2lib hash table for @RG-ID -> LB lookup + @field l_text length of the plain text in the header + @field text plain text + + @discussion Field hash points to null by default. It is a private + member. + */ +typedef struct { + int32_t n_targets; + char **target_name; + uint32_t *target_len; + void *hash, *rg2lib; + int l_text; + char *text; +} bam_header_t; + +/*! @abstract the read is paired in sequencing, no matter whether it is mapped in a pair */ +#define BAM_FPAIRED 1 +/*! @abstract the read is mapped in a proper pair */ +#define BAM_FPROPER_PAIR 2 +/*! @abstract the read itself is unmapped; conflictive with BAM_FPROPER_PAIR */ +#define BAM_FUNMAP 4 +/*! @abstract the mate is unmapped */ +#define BAM_FMUNMAP 8 +/*! @abstract the read is mapped to the reverse strand */ +#define BAM_FREVERSE 16 +/*! @abstract the mate is mapped to the reverse strand */ +#define BAM_FMREVERSE 32 +/*! @abstract this is read1 */ +#define BAM_FREAD1 64 +/*! @abstract this is read2 */ +#define BAM_FREAD2 128 +/*! @abstract not primary alignment */ +#define BAM_FSECONDARY 256 +/*! @abstract QC failure */ +#define BAM_FQCFAIL 512 +/*! @abstract optical or PCR duplicate */ +#define BAM_FDUP 1024 + +#define BAM_OFDEC 0 +#define BAM_OFHEX 1 +#define BAM_OFSTR 2 + +/*! @abstract defautl mask for pileup */ +#define BAM_DEF_MASK (BAM_FUNMAP | BAM_FSECONDARY | BAM_FQCFAIL | BAM_FDUP) + +#define BAM_CORE_SIZE sizeof(bam1_core_t) + +/** + * Describing how CIGAR operation/length is packed in a 32-bit integer. + */ +#define BAM_CIGAR_SHIFT 4 +#define BAM_CIGAR_MASK ((1 << BAM_CIGAR_SHIFT) - 1) + +/* + CIGAR operations. + */ +/*! @abstract CIGAR: match */ +#define BAM_CMATCH 0 +/*! @abstract CIGAR: insertion to the reference */ +#define BAM_CINS 1 +/*! @abstract CIGAR: deletion from the reference */ +#define BAM_CDEL 2 +/*! @abstract CIGAR: skip on the reference (e.g. spliced alignment) */ +#define BAM_CREF_SKIP 3 +/*! @abstract CIGAR: clip on the read with clipped sequence present in qseq */ +#define BAM_CSOFT_CLIP 4 +/*! @abstract CIGAR: clip on the read with clipped sequence trimmed off */ +#define BAM_CHARD_CLIP 5 +/*! @abstract CIGAR: padding */ +#define BAM_CPAD 6 + +/*! @typedef + @abstract Structure for core alignment information. + @field tid chromosome ID, defined by bam_header_t + @field pos 0-based leftmost coordinate + @field strand strand; 0 for forward and 1 otherwise + @field bin bin calculated by bam_reg2bin() + @field qual mapping quality + @field l_qname length of the query name + @field flag bitwise flag + @field n_cigar number of CIGAR operations + @field l_qseq length of the query sequence (read) + */ +typedef struct { + int32_t tid; + int32_t pos; + uint32_t bin:16, qual:8, l_qname:8; + uint32_t flag:16, n_cigar:16; + int32_t l_qseq; + int32_t mtid; + int32_t mpos; + int32_t isize; +} bam1_core_t; + +/*! @typedef + @abstract Structure for one alignment. + @field core core information about the alignment + @field l_aux length of auxiliary data + @field data_len current length of bam1_t::data + @field m_data maximum length of bam1_t::data + @field data all variable-length data, concatenated; structure: cigar-qname-seq-qual-aux + + @discussion Notes: + + 1. qname is zero tailing and core.l_qname includes the tailing '\0'. + 2. l_qseq is calculated from the total length of an alignment block + on reading or from CIGAR. + */ +typedef struct { + bam1_core_t core; + int l_aux, data_len, m_data; + uint8_t *data; +} bam1_t; + +#define bam1_strand(b) (((b)->core.flag&BAM_FREVERSE) != 0) +#define bam1_mstrand(b) (((b)->core.flag&BAM_FMREVERSE) != 0) + +/*! @function + @abstract Get the CIGAR array + @param b pointer to an alignment + @return pointer to the CIGAR array + + @discussion In the CIGAR array, each element is a 32-bit integer. The + lower 4 bits gives a CIGAR operation and the higher 28 bits keep the + length of a CIGAR. + */ +#define bam1_cigar(b) ((uint32_t*)((b)->data + (b)->core.l_qname)) + +/*! @function + @abstract Get the name of the query + @param b pointer to an alignment + @return pointer to the name string, null terminated + */ +#define bam1_qname(b) ((char*)((b)->data)) + +/*! @function + @abstract Get query sequence + @param b pointer to an alignment + @return pointer to sequence + + @discussion Each base is encoded in 4 bits: 1 for A, 2 for C, 4 for G, + 8 for T and 15 for N. Two bases are packed in one byte with the base + at the higher 4 bits having smaller coordinate on the read. It is + recommended to use bam1_seqi() macro to get the base. + */ +#define bam1_seq(b) ((b)->data + (b)->core.n_cigar*4 + (b)->core.l_qname) + +/*! @function + @abstract Get query quality + @param b pointer to an alignment + @return pointer to quality string + */ +#define bam1_qual(b) ((b)->data + (b)->core.n_cigar*4 + (b)->core.l_qname + ((b)->core.l_qseq + 1)/2) + +/*! @function + @abstract Get a base on read + @param s Query sequence returned by bam1_seq() + @param i The i-th position, 0-based + @return 4-bit integer representing the base. + */ +#define bam1_seqi(s, i) ((s)[(i)/2] >> 4*(1-(i)%2) & 0xf) + +/*! @function + @abstract Get query sequence and quality + @param b pointer to an alignment + @return pointer to the concatenated auxiliary data + */ +#define bam1_aux(b) ((b)->data + (b)->core.n_cigar*4 + (b)->core.l_qname + (b)->core.l_qseq + ((b)->core.l_qseq + 1)/2) + +#ifndef kroundup32 +/*! @function + @abstract Round an integer to the next closest power-2 integer. + @param x integer to be rounded (in place) + @discussion x will be modified. + */ +#define kroundup32(x) (--(x), (x)|=(x)>>1, (x)|=(x)>>2, (x)|=(x)>>4, (x)|=(x)>>8, (x)|=(x)>>16, ++(x)) +#endif + +/*! + @abstract Whether the machine is big-endian; modified only in + bam_header_init(). + */ +extern int bam_is_be; + +/*! @abstract Table for converting a nucleotide character to the 4-bit encoding. */ +extern unsigned char bam_nt16_table[256]; + +/*! @abstract Table for converting a 4-bit encoded nucleotide to a letter. */ +extern char *bam_nt16_rev_table; + +extern char bam_nt16_nt4_table[]; + +#ifdef __cplusplus +extern "C" { +#endif + + /*! @abstract TAM file handler */ + typedef struct __tamFile_t *tamFile; + + /*! + @abstract Open a SAM file for reading, either uncompressed or compressed by gzip/zlib. + @param fn SAM file name + @return SAM file handler + */ + tamFile sam_open(const char *fn); + + /*! + @abstract Close a SAM file handler + @param fp SAM file handler + */ + void sam_close(tamFile fp); + + /*! + @abstract Read one alignment from a SAM file handler + @param fp SAM file handler + @param header header information (ordered names of chromosomes) + @param b read alignment; all members in b will be updated + @return 0 if successful; otherwise negative + */ + int sam_read1(tamFile fp, bam_header_t *header, bam1_t *b); + + /*! + @abstract Read header information from a TAB-delimited list file. + @param fn_list file name for the list + @return a pointer to the header structure + + @discussion Each line in this file consists of chromosome name and + the length of chromosome. + */ + bam_header_t *sam_header_read2(const char *fn_list); + + /*! + @abstract Read header from a SAM file (if present) + @param fp SAM file handler + @return pointer to header struct; 0 if no @SQ lines available + */ + bam_header_t *sam_header_read(tamFile fp); + + /*! + @abstract Parse @SQ lines a update a header struct + @param h pointer to the header struct to be updated + @return number of target sequences + + @discussion bam_header_t::{n_targets,target_len,target_name} will + be destroyed in the first place. + */ + int sam_header_parse(bam_header_t *h); + + /*! + @abstract Parse @RG lines a update a header struct + @param h pointer to the header struct to be updated + @return number of @RG lines + + @discussion bam_header_t::rg2lib will be destroyed in the first + place. + */ + int sam_header_parse_rg(bam_header_t *h); + +#define sam_write1(header, b) bam_view1(header, b) + + int bam_strmap_put(void *strmap, const char *rg, const char *lib); + const char *bam_strmap_get(const void *strmap, const char *rg); + void *bam_strmap_dup(const void*); + void *bam_strmap_init(); + void bam_strmap_destroy(void *strmap); + + /*! + @abstract Initialize a header structure. + @return the pointer to the header structure + + @discussion This function also modifies the global variable + bam_is_be. + */ + bam_header_t *bam_header_init(); + + /*! + @abstract Destroy a header structure. + @param header pointer to the header + */ + void bam_header_destroy(bam_header_t *header); + + /*! + @abstract Read a header structure from BAM. + @param fp BAM file handler, opened by bam_open() + @return pointer to the header structure + + @discussion The file position indicator must be placed at the + beginning of the file. Upon success, the position indicator will + be set at the start of the first alignment. + */ + bam_header_t *bam_header_read(bamFile fp); + + /*! + @abstract Write a header structure to BAM. + @param fp BAM file handler + @param header pointer to the header structure + @return always 0 currently + */ + int bam_header_write(bamFile fp, const bam_header_t *header); + + /*! + @abstract Read an alignment from BAM. + @param fp BAM file handler + @param b read alignment; all members are updated. + @return number of bytes read from the file + + @discussion The file position indicator must be + placed right before an alignment. Upon success, this function + will set the position indicator to the start of the next + alignment. This function is not affected by the machine + endianness. + */ + int bam_read1(bamFile fp, bam1_t *b); + + /*! + @abstract Write an alignment to BAM. + @param fp BAM file handler + @param c pointer to the bam1_core_t structure + @param data_len total length of variable size data related to + the alignment + @param data pointer to the concatenated data + @return number of bytes written to the file + + @discussion This function is not affected by the machine + endianness. + */ + int bam_write1_core(bamFile fp, const bam1_core_t *c, int data_len, uint8_t *data); + + /*! + @abstract Write an alignment to BAM. + @param fp BAM file handler + @param b alignment to write + @return number of bytes written to the file + + @abstract It is equivalent to: + bam_write1_core(fp, &b->core, b->data_len, b->data) + */ + int bam_write1(bamFile fp, const bam1_t *b); + + /*! @function + @abstract Initiate a pointer to bam1_t struct + */ +#define bam_init1() ((bam1_t*)calloc(1, sizeof(bam1_t))) + + /*! @function + @abstract Free the memory allocated for an alignment. + @param b pointer to an alignment + */ +#define bam_destroy1(b) do { \ + free((b)->data); free(b); \ + } while (0) + + /*! + @abstract Format a BAM record in the SAM format + @param header pointer to the header structure + @param b alignment to print + @return a pointer to the SAM string + */ + char *bam_format1(const bam_header_t *header, const bam1_t *b); + + char *bam_format1_core(const bam_header_t *header, const bam1_t *b, int of); + + /*! @typedef + @abstract Structure for one alignment covering the pileup position. + @field b pointer to the alignment + @field qpos position of the read base at the pileup site, 0-based + @field indel indel length; 0 for no indel, positive for ins and negative for del + @field is_del 1 iff the base on the padded read is a deletion + @field level the level of the read in the "viewer" mode + + @discussion See also bam_plbuf_push() and bam_lplbuf_push(). The + difference between the two functions is that the former does not + set bam_pileup1_t::level, while the later does. Level helps the + implementation of alignment viewers, but calculating this has some + overhead. + */ + typedef struct { + bam1_t *b; + int32_t qpos; + int indel, level; + uint32_t is_del:1, is_head:1, is_tail:1; + } bam_pileup1_t; + + struct __bam_plbuf_t; + /*! @abstract pileup buffer */ + typedef struct __bam_plbuf_t bam_plbuf_t; + + void bam_plbuf_set_mask(bam_plbuf_t *buf, int mask); + + /*! @typedef + @abstract Type of function to be called by bam_plbuf_push(). + @param tid chromosome ID as is defined in the header + @param pos start coordinate of the alignment, 0-based + @param n number of elements in pl array + @param pl array of alignments + @param data user provided data + @discussion See also bam_plbuf_push(), bam_plbuf_init() and bam_pileup1_t. + */ + typedef int (*bam_pileup_f)(uint32_t tid, uint32_t pos, int n, const bam_pileup1_t *pl, void *data); + + /*! + @abstract Reset a pileup buffer for another pileup process + @param buf the pileup buffer to be reset + */ + void bam_plbuf_reset(bam_plbuf_t *buf); + + /*! + @abstract Initialize a buffer for pileup. + @param func fucntion to be called by bam_pileup_core() + @param data user provided data + @return pointer to the pileup buffer + */ + bam_plbuf_t *bam_plbuf_init(bam_pileup_f func, void *data); + + /*! + @abstract Destroy a pileup buffer. + @param buf pointer to the pileup buffer + */ + void bam_plbuf_destroy(bam_plbuf_t *buf); + + /*! + @abstract Push an alignment to the pileup buffer. + @param b alignment to be pushed + @param buf pileup buffer + @see bam_plbuf_init() + @return always 0 currently + + @discussion If all the alignments covering a particular site have + been collected, this function will call the user defined function + as is provided to bam_plbuf_init(). The coordinate of the site and + all the alignments will be transferred to the user defined + function as function parameters. + + When all the alignments are pushed to the buffer, this function + needs to be called with b equal to NULL. This will flush the + buffer. A pileup buffer can only be reused when bam_plbuf_reset() + is called. + */ + int bam_plbuf_push(const bam1_t *b, bam_plbuf_t *buf); + + int bam_pileup_file(bamFile fp, int mask, bam_pileup_f func, void *func_data); + + struct __bam_lplbuf_t; + typedef struct __bam_lplbuf_t bam_lplbuf_t; + + void bam_lplbuf_reset(bam_lplbuf_t *buf); + + /*! @abstract bam_plbuf_init() equivalent with level calculated. */ + bam_lplbuf_t *bam_lplbuf_init(bam_pileup_f func, void *data); + + /*! @abstract bam_plbuf_destroy() equivalent with level calculated. */ + void bam_lplbuf_destroy(bam_lplbuf_t *tv); + + /*! @abstract bam_plbuf_push() equivalent with level calculated. */ + int bam_lplbuf_push(const bam1_t *b, bam_lplbuf_t *buf); + + struct __bam_index_t; + typedef struct __bam_index_t bam_index_t; + + /*! + @abstract Build index for a BAM file. + @discussion Index file "fn.bai" will be created. + @param fn name of the BAM file + @return always 0 currently + */ + int bam_index_build(const char *fn); + + /*! + @abstract Load index from file "fn.bai". + @param fn name of the BAM file (NOT the index file) + @return pointer to the index structure + */ + bam_index_t *bam_index_load(const char *fn); + + /*! + @abstract Destroy an index structure. + @param idx pointer to the index structure + */ + void bam_index_destroy(bam_index_t *idx); + + /*! @typedef + @abstract Type of function to be called by bam_fetch(). + @param b the alignment + @param data user provided data + */ + typedef int (*bam_fetch_f)(const bam1_t *b, void *data); + + /*! + @abstract Retrieve the alignments that are overlapped with the + specified region. + + @discussion A user defined function will be called for each + retrieved alignment ordered by its start position. + + @param fp BAM file handler + @param idx pointer to the alignment index + @param tid chromosome ID as is defined in the header + @param beg start coordinate, 0-based + @param end end coordinate, 0-based + @param data user provided data (will be transferred to func) + @param func user defined function + */ + int bam_fetch(bamFile fp, const bam_index_t *idx, int tid, int beg, int end, void *data, bam_fetch_f func); + + /*! + @abstract Parse a region in the format: "chr2:100,000-200,000". + @discussion bam_header_t::hash will be initialized if empty. + @param header pointer to the header structure + @param str string to be parsed + @param ref_id the returned chromosome ID + @param begin the returned start coordinate + @param end the returned end coordinate + @return 0 on success; -1 on failure + */ + int bam_parse_region(bam_header_t *header, const char *str, int *ref_id, int *begin, int *end); + + /*! + @abstract Retrieve data of a tag + @param b pointer to an alignment struct + @param tag two-character tag to be retrieved + + @return pointer to the type and data. The first character is the + type that can be 'iIsScCdfAZH'. + + @discussion Use bam_aux2?() series to convert the returned data to + the corresponding type. + */ + uint8_t *bam_aux_get(const bam1_t *b, const char tag[2]); + + int32_t bam_aux2i(const uint8_t *s); + float bam_aux2f(const uint8_t *s); + double bam_aux2d(const uint8_t *s); + char bam_aux2A(const uint8_t *s); + char *bam_aux2Z(const uint8_t *s); + + int bam_aux_del(bam1_t *b, uint8_t *s); + void bam_aux_append(bam1_t *b, const char tag[2], char type, int len, uint8_t *data); + uint8_t *bam_aux_get_core(bam1_t *b, const char tag[2]); // an alias of bam_aux_get() + + /*! + @abstract Calculate the rightmost coordinate of an alignment on the + reference genome. + + @param c pointer to the bam1_core_t structure + @param cigar the corresponding CIGAR array (from bam1_t::cigar) + @return the rightmost coordinate, 0-based + */ + uint32_t bam_calend(const bam1_core_t *c, const uint32_t *cigar); + + /*! + @abstract Calculate the length of the query sequence from CIGAR. + @param c pointer to the bam1_core_t structure + @param cigar the corresponding CIGAR array (from bam1_t::cigar) + @return length of the query sequence + */ + int32_t bam_cigar2qlen(const bam1_core_t *c, const uint32_t *cigar); + + typedef struct { + int32_t qbeg, qend; + int32_t tbeg, tend; + int32_t cbeg, cend; + } bam_segreg_t; + + int bam_segreg(int32_t pos, const bam1_core_t *c, const uint32_t *cigar, bam_segreg_t *reg); + +#ifdef __cplusplus +} +#endif + +/*! + @abstract Calculate the minimum bin that contains a region [beg,end). + @param beg start of the region, 0-based + @param end end of the region, 0-based + @return bin + */ +static inline int bam_reg2bin(uint32_t beg, uint32_t end) +{ + --end; + if (beg>>14 == end>>14) return 4681 + (beg>>14); + if (beg>>17 == end>>17) return 585 + (beg>>17); + if (beg>>20 == end>>20) return 73 + (beg>>20); + if (beg>>23 == end>>23) return 9 + (beg>>23); + if (beg>>26 == end>>26) return 1 + (beg>>26); + return 0; +} + +/*! + @abstract Copy an alignment + @param bdst destination alignment struct + @param bsrc source alignment struct + @return pointer to the destination alignment struct + */ +static inline bam1_t *bam_copy1(bam1_t *bdst, const bam1_t *bsrc) +{ + uint8_t *data = bdst->data; + int m_data = bdst->m_data; // backup data and m_data + if (m_data < bsrc->m_data) { // double the capacity + m_data = bsrc->m_data; kroundup32(m_data); + data = (uint8_t*)realloc(data, m_data); + } + memcpy(data, bsrc->data, bsrc->data_len); // copy var-len data + *bdst = *bsrc; // copy the rest + // restore the backup + bdst->m_data = m_data; + bdst->data = data; + return bdst; +} + +/*! + @abstract Duplicate an alignment + @param src source alignment struct + @return pointer to the destination alignment struct + */ +static inline bam1_t *bam_dup1(const bam1_t *src) +{ + bam1_t *b; + b = bam_init1(); + *b = *src; + b->m_data = b->data_len; + b->data = (uint8_t*)calloc(b->data_len, 1); + memcpy(b->data, src->data, b->data_len); + return b; +} + +#endif
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/SNV/SNVMix2_source/SNVMix2-v0.12.1-rc1/samtools-0.1.6/bam_aux.c Wed Oct 12 19:50:38 2011 -0400 @@ -0,0 +1,249 @@ +#include <ctype.h> +#include "bam.h" +#include "khash.h" +typedef char *str_p; +KHASH_MAP_INIT_STR(s, int) +KHASH_MAP_INIT_STR(r2l, str_p) + +void bam_aux_append(bam1_t *b, const char tag[2], char type, int len, uint8_t *data) +{ + int ori_len = b->data_len; + b->data_len += 3 + len; + b->l_aux += 3 + len; + if (b->m_data < b->data_len) { + b->m_data = b->data_len; + kroundup32(b->m_data); + b->data = (uint8_t*)realloc(b->data, b->m_data); + } + b->data[ori_len] = tag[0]; b->data[ori_len + 1] = tag[1]; + b->data[ori_len + 2] = type; + memcpy(b->data + ori_len + 3, data, len); +} + +uint8_t *bam_aux_get_core(bam1_t *b, const char tag[2]) +{ + return bam_aux_get(b, tag); +} + +#define __skip_tag(s) do { \ + int type = toupper(*(s)); \ + ++(s); \ + if (type == 'C' || type == 'A') ++(s); \ + else if (type == 'S') (s) += 2; \ + else if (type == 'I' || type == 'F') (s) += 4; \ + else if (type == 'D') (s) += 8; \ + else if (type == 'Z' || type == 'H') { while (*(s)) ++(s); ++(s); } \ + } while (0) + +uint8_t *bam_aux_get(const bam1_t *b, const char tag[2]) +{ + uint8_t *s; + int y = tag[0]<<8 | tag[1]; + s = bam1_aux(b); + while (s < b->data + b->data_len) { + int x = (int)s[0]<<8 | s[1]; + s += 2; + if (x == y) return s; + __skip_tag(s); + } + return 0; +} +// s MUST BE returned by bam_aux_get() +int bam_aux_del(bam1_t *b, uint8_t *s) +{ + uint8_t *p, *aux; + aux = bam1_aux(b); + p = s - 2; + __skip_tag(s); + memmove(p, s, b->l_aux - (s - aux)); + b->data_len -= s - p; + b->l_aux -= s - p; + return 0; +} + +void bam_init_header_hash(bam_header_t *header) +{ + if (header->hash == 0) { + int ret, i; + khiter_t iter; + khash_t(s) *h; + header->hash = h = kh_init(s); + for (i = 0; i < header->n_targets; ++i) { + iter = kh_put(s, h, header->target_name[i], &ret); + kh_value(h, iter) = i; + } + } +} + +void bam_destroy_header_hash(bam_header_t *header) +{ + if (header->hash) + kh_destroy(s, (khash_t(s)*)header->hash); +} + +int32_t bam_get_tid(const bam_header_t *header, const char *seq_name) +{ + khint_t k; + khash_t(s) *h = (khash_t(s)*)header->hash; + k = kh_get(s, h, seq_name); + return k == kh_end(h)? -1 : kh_value(h, k); +} + +int bam_parse_region(bam_header_t *header, const char *str, int *ref_id, int *begin, int *end) +{ + char *s, *p; + int i, l, k; + khiter_t iter; + khash_t(s) *h; + + bam_init_header_hash(header); + h = (khash_t(s)*)header->hash; + + l = strlen(str); + p = s = (char*)malloc(l+1); + /* squeeze out "," */ + for (i = k = 0; i != l; ++i) + if (str[i] != ',' && !isspace(str[i])) s[k++] = str[i]; + s[k] = 0; + for (i = 0; i != k; ++i) if (s[i] == ':') break; + s[i] = 0; + iter = kh_get(s, h, s); /* get the ref_id */ + if (iter == kh_end(h)) { // name not found + *ref_id = -1; free(s); + return -1; + } + *ref_id = kh_value(h, iter); + if (i == k) { /* dump the whole sequence */ + *begin = 0; *end = 1<<29; free(s); + return -1; + } + for (p = s + i + 1; i != k; ++i) if (s[i] == '-') break; + *begin = atoi(p); + if (i < k) { + p = s + i + 1; + *end = atoi(p); + } else *end = 1<<29; + if (*begin > 0) --*begin; + free(s); + if (*begin > *end) { + fprintf(stderr, "[bam_parse_region] invalid region.\n"); + return -1; + } + return 0; +} + +int32_t bam_aux2i(const uint8_t *s) +{ + int type; + if (s == 0) return 0; + type = *s++; + if (type == 'c') return (int32_t)*(int8_t*)s; + else if (type == 'C') return (int32_t)*(uint8_t*)s; + else if (type == 's') return (int32_t)*(int16_t*)s; + else if (type == 'S') return (int32_t)*(uint16_t*)s; + else if (type == 'i' || type == 'I') return *(int32_t*)s; + else return 0; +} + +float bam_aux2f(const uint8_t *s) +{ + int type; + type = *s++; + if (s == 0) return 0.0; + if (type == 'f') return *(float*)s; + else return 0.0; +} + +double bam_aux2d(const uint8_t *s) +{ + int type; + type = *s++; + if (s == 0) return 0.0; + if (type == 'd') return *(double*)s; + else return 0.0; +} + +char bam_aux2A(const uint8_t *s) +{ + int type; + type = *s++; + if (s == 0) return 0; + if (type == 'A') return *(char*)s; + else return 0; +} + +char *bam_aux2Z(const uint8_t *s) +{ + int type; + type = *s++; + if (s == 0) return 0; + if (type == 'Z' || type == 'H') return (char*)s; + else return 0; +} + +/****************** + * rg2lib related * + ******************/ + +int bam_strmap_put(void *rg2lib, const char *rg, const char *lib) +{ + int ret; + khint_t k; + khash_t(r2l) *h = (khash_t(r2l)*)rg2lib; + char *key; + if (h == 0) return 1; + key = strdup(rg); + k = kh_put(r2l, h, key, &ret); + if (ret) kh_val(h, k) = strdup(lib); + else { + fprintf(stderr, "[bam_rg2lib_put] duplicated @RG ID: %s\n", rg); + free(key); + } + return 0; +} + +const char *bam_strmap_get(const void *rg2lib, const char *rg) +{ + const khash_t(r2l) *h = (const khash_t(r2l)*)rg2lib; + khint_t k; + if (h == 0) return 0; + k = kh_get(r2l, h, rg); + if (k != kh_end(h)) return (const char*)kh_val(h, k); + else return 0; +} + +void *bam_strmap_dup(const void *rg2lib) +{ + const khash_t(r2l) *h = (const khash_t(r2l)*)rg2lib; + khash_t(r2l) *g; + khint_t k, l; + int ret; + if (h == 0) return 0; + g = kh_init(r2l); + for (k = kh_begin(h); k < kh_end(h); ++k) { + if (kh_exist(h, k)) { + char *key = strdup(kh_key(h, k)); + l = kh_put(r2l, g, key, &ret); + kh_val(g, l) = strdup(kh_val(h, k)); + } + } + return g; +} + +void *bam_strmap_init() +{ + return (void*)kh_init(r2l); +} + +void bam_strmap_destroy(void *rg2lib) +{ + khash_t(r2l) *h = (khash_t(r2l)*)rg2lib; + khint_t k; + if (h == 0) return; + for (k = kh_begin(h); k < kh_end(h); ++k) { + if (kh_exist(h, k)) { + free((char*)kh_key(h, k)); free(kh_val(h, k)); + } + } + kh_destroy(r2l, h); +}
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/SNV/SNVMix2_source/SNVMix2-v0.12.1-rc1/samtools-0.1.6/bam_color.c Wed Oct 12 19:50:38 2011 -0400 @@ -0,0 +1,127 @@ +#include <ctype.h> +#include "bam.h" + +/*! + @abstract Get the color encoding the previous and current base + @param b pointer to an alignment + @param i The i-th position, 0-based + @return color + + @discussion Returns 0 no color information is found. + */ +char bam_aux_getCSi(bam1_t *b, int i) +{ + uint8_t *c = bam_aux_get(b, "CS"); + char *cs = NULL; + + // return the base if the tag was not found + if(0 == c) return 0; + + cs = bam_aux2Z(c); + // adjust for strandedness and leading adaptor + if(bam1_strand(b)) i = strlen(cs) - 1 - i; + else i++; + return cs[i]; +} + +/*! + @abstract Get the color quality of the color encoding the previous and current base + @param b pointer to an alignment + @param i The i-th position, 0-based + @return color quality + + @discussion Returns 0 no color information is found. + */ +char bam_aux_getCQi(bam1_t *b, int i) +{ + uint8_t *c = bam_aux_get(b, "CQ"); + char *cq = NULL; + + // return the base if the tag was not found + if(0 == c) return 0; + + cq = bam_aux2Z(c); + // adjust for strandedness + if(bam1_strand(b)) i = strlen(cq) - 1 - i; + return cq[i]; +} + +char bam_aux_nt2int(char a) +{ + switch(toupper(a)) { + case 'A': + return 0; + break; + case 'C': + return 1; + break; + case 'G': + return 2; + break; + case 'T': + return 3; + break; + default: + return 4; + break; + } +} + +char bam_aux_ntnt2cs(char a, char b) +{ + a = bam_aux_nt2int(a); + b = bam_aux_nt2int(b); + if(4 == a || 4 == b) return '4'; + return "0123"[(int)(a ^ b)]; +} + +/*! + @abstract Get the color error profile at the give position + @param b pointer to an alignment + @return the original color if the color was an error, '-' (dash) otherwise + + @discussion Returns 0 no color information is found. + */ +char bam_aux_getCEi(bam1_t *b, int i) +{ + int cs_i; + uint8_t *c = bam_aux_get(b, "CS"); + char *cs = NULL; + char prev_b, cur_b; + char cur_color, cor_color; + + // return the base if the tag was not found + if(0 == c) return 0; + + cs = bam_aux2Z(c); + + // adjust for strandedness and leading adaptor + if(bam1_strand(b)) { //reverse strand + cs_i = strlen(cs) - 1 - i; + // get current color + cur_color = cs[cs_i]; + // get previous base. Note: must rc adaptor + prev_b = (cs_i == 1) ? "TGCAN"[(int)bam_aux_nt2int(cs[0])] : bam_nt16_rev_table[bam1_seqi(bam1_seq(b), i+1)]; + // get current base + cur_b = bam_nt16_rev_table[bam1_seqi(bam1_seq(b), i)]; + } + else { + cs_i=i+1; + // get current color + cur_color = cs[cs_i]; + // get previous base + prev_b = (0 == i) ? cs[0] : bam_nt16_rev_table[bam1_seqi(bam1_seq(b), i-1)]; + // get current base + cur_b = bam_nt16_rev_table[bam1_seqi(bam1_seq(b), i)]; + } + + // corrected color + cor_color = bam_aux_ntnt2cs(prev_b, cur_b); + + if(cur_color == cor_color) { + return '-'; + } + else { + return cur_color; + } +}
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/SNV/SNVMix2_source/SNVMix2-v0.12.1-rc1/samtools-0.1.6/bam_endian.h Wed Oct 12 19:50:38 2011 -0400 @@ -0,0 +1,42 @@ +#ifndef BAM_ENDIAN_H +#define BAM_ENDIAN_H + +#include <stdint.h> + +static inline int bam_is_big_endian() +{ + long one= 1; + return !(*((char *)(&one))); +} +static inline uint16_t bam_swap_endian_2(uint16_t v) +{ + return (uint16_t)(((v & 0x00FF00FFU) << 8) | ((v & 0xFF00FF00U) >> 8)); +} +static inline void *bam_swap_endian_2p(void *x) +{ + *(uint16_t*)x = bam_swap_endian_2(*(uint16_t*)x); + return x; +} +static inline uint32_t bam_swap_endian_4(uint32_t v) +{ + v = ((v & 0x0000FFFFU) << 16) | (v >> 16); + return ((v & 0x00FF00FFU) << 8) | ((v & 0xFF00FF00U) >> 8); +} +static inline void *bam_swap_endian_4p(void *x) +{ + *(uint32_t*)x = bam_swap_endian_4(*(uint32_t*)x); + return x; +} +static inline uint64_t bam_swap_endian_8(uint64_t v) +{ + v = ((v & 0x00000000FFFFFFFFLLU) << 32) | (v >> 32); + v = ((v & 0x0000FFFF0000FFFFLLU) << 16) | ((v & 0xFFFF0000FFFF0000LLU) >> 16); + return ((v & 0x00FF00FF00FF00FFLLU) << 8) | ((v & 0xFF00FF00FF00FF00LLU) >> 8); +} +static inline void *bam_swap_endian_8p(void *x) +{ + *(uint64_t*)x = bam_swap_endian_8(*(uint64_t*)x); + return x; +} + +#endif
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/SNV/SNVMix2_source/SNVMix2-v0.12.1-rc1/samtools-0.1.6/bam_import.c Wed Oct 12 19:50:38 2011 -0400 @@ -0,0 +1,519 @@ +#include <zlib.h> +#include <stdio.h> +#include <ctype.h> +#include <string.h> +#include <stdlib.h> +#include <unistd.h> +#include <assert.h> +#ifdef _WIN32 +#include <fcntl.h> +#endif +#include "kstring.h" +#include "bam.h" +#include "kseq.h" +#include "khash.h" + +KSTREAM_INIT(gzFile, gzread, 8192) +KHASH_MAP_INIT_STR(ref, uint64_t) + +void bam_init_header_hash(bam_header_t *header); +void bam_destroy_header_hash(bam_header_t *header); +int32_t bam_get_tid(const bam_header_t *header, const char *seq_name); + +unsigned char bam_nt16_table[256] = { + 15,15,15,15, 15,15,15,15, 15,15,15,15, 15,15,15,15, + 15,15,15,15, 15,15,15,15, 15,15,15,15, 15,15,15,15, + 15,15,15,15, 15,15,15,15, 15,15,15,15, 15,15,15,15, + 1, 2, 4, 8, 15,15,15,15, 15,15,15,15, 15, 0 /*=*/,15,15, + 15, 1,14, 2, 13,15,15, 4, 11,15,15,12, 15, 3,15,15, + 15,15, 5, 6, 8,15, 7, 9, 15,10,15,15, 15,15,15,15, + 15, 1,14, 2, 13,15,15, 4, 11,15,15,12, 15, 3,15,15, + 15,15, 5, 6, 8,15, 7, 9, 15,10,15,15, 15,15,15,15, + 15,15,15,15, 15,15,15,15, 15,15,15,15, 15,15,15,15, + 15,15,15,15, 15,15,15,15, 15,15,15,15, 15,15,15,15, + 15,15,15,15, 15,15,15,15, 15,15,15,15, 15,15,15,15, + 15,15,15,15, 15,15,15,15, 15,15,15,15, 15,15,15,15, + 15,15,15,15, 15,15,15,15, 15,15,15,15, 15,15,15,15, + 15,15,15,15, 15,15,15,15, 15,15,15,15, 15,15,15,15, + 15,15,15,15, 15,15,15,15, 15,15,15,15, 15,15,15,15, + 15,15,15,15, 15,15,15,15, 15,15,15,15, 15,15,15,15 +}; + +unsigned short bam_char2flag_table[256] = { + 0,0,0,0, 0,0,0,0, 0,0,0,0, 0,0,0,0, + 0,0,0,0, 0,0,0,0, 0,0,0,0, 0,0,0,0, + 0,0,0,0, 0,0,0,0, 0,0,0,0, 0,0,0,0, + 0,BAM_FREAD1,BAM_FREAD2,0, 0,0,0,0, 0,0,0,0, 0,0,0,0, + 0,0,0,0, 0,0,0,0, 0,0,0,0, 0,0,0,0, + BAM_FPROPER_PAIR,0,BAM_FMREVERSE,0, 0,BAM_FMUNMAP,0,0, 0,0,0,0, 0,0,0,0, + 0,0,0,0, BAM_FDUP,0,BAM_FQCFAIL,0, 0,0,0,0, 0,0,0,0, + BAM_FPAIRED,0,BAM_FREVERSE,BAM_FSECONDARY, 0,BAM_FUNMAP,0,0, 0,0,0,0, 0,0,0,0, + 0,0,0,0, 0,0,0,0, 0,0,0,0, 0,0,0,0, + 0,0,0,0, 0,0,0,0, 0,0,0,0, 0,0,0,0, + 0,0,0,0, 0,0,0,0, 0,0,0,0, 0,0,0,0, + 0,0,0,0, 0,0,0,0, 0,0,0,0, 0,0,0,0, + 0,0,0,0, 0,0,0,0, 0,0,0,0, 0,0,0,0, + 0,0,0,0, 0,0,0,0, 0,0,0,0, 0,0,0,0, + 0,0,0,0, 0,0,0,0, 0,0,0,0, 0,0,0,0, + 0,0,0,0, 0,0,0,0, 0,0,0,0, 0,0,0,0 +}; + +char *bam_nt16_rev_table = "=ACMGRSVTWYHKDBN"; + +struct __tamFile_t { + gzFile fp; + kstream_t *ks; + kstring_t *str; + uint64_t n_lines; + int is_first; +}; + +char **__bam_get_lines(const char *fn, int *_n) // for bam_plcmd.c only +{ + char **list = 0, *s; + int n = 0, dret, m = 0; + gzFile fp = (strcmp(fn, "-") == 0)? gzdopen(fileno(stdin), "r") : gzopen(fn, "r"); + kstream_t *ks; + kstring_t *str; + str = (kstring_t*)calloc(1, sizeof(kstring_t)); + ks = ks_init(fp); + while (ks_getuntil(ks, '\n', str, &dret) > 0) { + if (n == m) { + m = m? m << 1 : 16; + list = (char**)realloc(list, m * sizeof(char*)); + } + if (str->s[str->l-1] == '\r') + str->s[--str->l] = '\0'; + s = list[n++] = (char*)calloc(str->l + 1, 1); + strcpy(s, str->s); + } + ks_destroy(ks); + gzclose(fp); + free(str->s); free(str); + *_n = n; + return list; +} + +static bam_header_t *hash2header(const kh_ref_t *hash) +{ + bam_header_t *header; + khiter_t k; + header = bam_header_init(); + header->n_targets = kh_size(hash); + header->target_name = (char**)calloc(kh_size(hash), sizeof(char*)); + header->target_len = (uint32_t*)calloc(kh_size(hash), 4); + for (k = kh_begin(hash); k != kh_end(hash); ++k) { + if (kh_exist(hash, k)) { + int i = (int)kh_value(hash, k); + header->target_name[i] = (char*)kh_key(hash, k); + header->target_len[i] = kh_value(hash, k)>>32; + } + } + bam_init_header_hash(header); + return header; +} +bam_header_t *sam_header_read2(const char *fn) +{ + bam_header_t *header; + int c, dret, ret; + gzFile fp; + kstream_t *ks; + kstring_t *str; + kh_ref_t *hash; + khiter_t k; + if (fn == 0) return 0; + fp = (strcmp(fn, "-") == 0)? gzdopen(fileno(stdin), "r") : gzopen(fn, "r"); + if (fp == 0) return 0; + hash = kh_init(ref); + ks = ks_init(fp); + str = (kstring_t*)calloc(1, sizeof(kstring_t)); + while (ks_getuntil(ks, 0, str, &dret) > 0) { + char *s = strdup(str->s); + int len, i; + i = kh_size(hash); + ks_getuntil(ks, 0, str, &dret); + len = atoi(str->s); + k = kh_put(ref, hash, s, &ret); + kh_value(hash, k) = (uint64_t)len<<32 | i; + if (dret != '\n') + while ((c = ks_getc(ks)) != '\n' && c != -1); + } + ks_destroy(ks); + gzclose(fp); + free(str->s); free(str); + fprintf(stderr, "[sam_header_read2] %d sequences loaded.\n", kh_size(hash)); + header = hash2header(hash); + kh_destroy(ref, hash); + return header; +} +static inline uint8_t *alloc_data(bam1_t *b, int size) +{ + if (b->m_data < size) { + b->m_data = size; + kroundup32(b->m_data); + b->data = (uint8_t*)realloc(b->data, b->m_data); + } + return b->data; +} +static inline void parse_error(int64_t n_lines, const char * __restrict msg) +{ + fprintf(stderr, "Parse error at line %lld: %s\n", (long long)n_lines, msg); + abort(); +} +static inline void append_text(bam_header_t *header, kstring_t *str) +{ + int x = header->l_text, y = header->l_text + str->l + 2; // 2 = 1 byte dret + 1 byte null + kroundup32(x); kroundup32(y); + if (x < y) header->text = (char*)realloc(header->text, y); + strncpy(header->text + header->l_text, str->s, str->l+1); // we cannot use strcpy() here. + header->l_text += str->l + 1; + header->text[header->l_text] = 0; +} + +int sam_header_parse_rg(bam_header_t *h) +{ + kstring_t *rgid, *rglib; + char *p, *q, *s, *r; + int n = 0; + + // free + if (h == 0) return 0; + bam_strmap_destroy(h->rg2lib); h->rg2lib = 0; + if (h->l_text < 3) return 0; + // parse @RG lines + h->rg2lib = bam_strmap_init(); + rgid = calloc(1, sizeof(kstring_t)); + rglib = calloc(1, sizeof(kstring_t)); + s = h->text; + while ((s = strstr(s, "@RG")) != 0) { + if (rgid->l && rglib->l) { + bam_strmap_put(h->rg2lib, rgid->s, rglib->s); + ++n; + } + rgid->l = rglib->l = 0; + s += 3; + r = s; + if ((p = strstr(s, "ID:")) != 0) { + q = p + 3; + for (p = q; *p && *p != '\t' && *p != '\r' && *p != '\n'; ++p); + kputsn(q, p - q, rgid); + } else { + fprintf(stderr, "[bam_header_parse] missing ID tag in @RG lines.\n"); + break; + } + if (r < p) r = p; + if ((p = strstr(s, "LB:")) != 0) { + q = p + 3; + for (p = q; *p && *p != '\t' && *p != '\r' && *p != '\n'; ++p); + kputsn(q, p - q, rglib); + } else { + fprintf(stderr, "[bam_header_parse] missing LB tag in @RG lines.\n"); + break; + } + if (r < p) r = p; + s = r + 3; + } + if (rgid->l && rglib->l) { + bam_strmap_put(h->rg2lib, rgid->s, rglib->s); + ++n; + } + free(rgid->s); free(rgid); + free(rglib->s); free(rglib); + if (n == 0) { + bam_strmap_destroy(h->rg2lib); + h->rg2lib = 0; + } + return n; +} + +int sam_header_parse(bam_header_t *h) +{ + int i; + char *s, *p, *q, *r; + + // free + free(h->target_len); free(h->target_name); + h->n_targets = 0; h->target_len = 0; h->target_name = 0; + if (h->l_text < 3) return 0; + // count number of @SQ + s = h->text; + while ((s = strstr(s, "@SQ")) != 0) { + ++h->n_targets; + s += 3; + } + if (h->n_targets == 0) return 0; + h->target_len = (uint32_t*)calloc(h->n_targets, 4); + h->target_name = (char**)calloc(h->n_targets, sizeof(void*)); + // parse @SQ lines + i = 0; + s = h->text; + while ((s = strstr(s, "@SQ")) != 0) { + s += 3; + r = s; + if ((p = strstr(s, "SN:")) != 0) { + q = p + 3; + for (p = q; *p && *p != '\t' && *p != '\r' && *p != '\n'; ++p); + h->target_name[i] = (char*)calloc(p - q + 1, 1); + strncpy(h->target_name[i], q, p - q); + } else goto header_err_ret; + if (r < p) r = p; + if ((p = strstr(s, "LN:")) != 0) h->target_len[i] = strtol(p + 3, 0, 10); + else goto header_err_ret; + if (r < p) r = p; + s = r + 3; + ++i; + } + sam_header_parse_rg(h); + return h->n_targets; + +header_err_ret: + fprintf(stderr, "[bam_header_parse] missing SN or LN tag in @SQ lines.\n"); + free(h->target_len); free(h->target_name); + h->n_targets = 0; h->target_len = 0; h->target_name = 0; + return 0; +} + +bam_header_t *sam_header_read(tamFile fp) +{ + int ret, dret; + bam_header_t *header = bam_header_init(); + kstring_t *str = fp->str; + while ((ret = ks_getuntil(fp->ks, KS_SEP_TAB, str, &dret)) >= 0 && str->s[0] == '@') { // skip header + str->s[str->l] = dret; // note that str->s is NOT null terminated!! + append_text(header, str); + if (dret != '\n') { + ret = ks_getuntil(fp->ks, '\n', str, &dret); + str->s[str->l] = '\n'; // NOT null terminated!! + append_text(header, str); + } + ++fp->n_lines; + } + sam_header_parse(header); + bam_init_header_hash(header); + fp->is_first = 1; + return header; +} + +int sam_read1(tamFile fp, bam_header_t *header, bam1_t *b) +{ + int ret, doff, doff0, dret, z = 0; + bam1_core_t *c = &b->core; + kstring_t *str = fp->str; + kstream_t *ks = fp->ks; + + if (fp->is_first) { + fp->is_first = 0; + ret = str->l; + } else { + do { // special consideration for empty lines + ret = ks_getuntil(fp->ks, KS_SEP_TAB, str, &dret); + if (ret >= 0) z += str->l + 1; + } while (ret == 0); + } + if (ret < 0) return -1; + ++fp->n_lines; + doff = 0; + + { // name + c->l_qname = strlen(str->s) + 1; + memcpy(alloc_data(b, doff + c->l_qname) + doff, str->s, c->l_qname); + doff += c->l_qname; + } + { // flag + long flag; + char *s; + ret = ks_getuntil(ks, KS_SEP_TAB, str, &dret); z += str->l + 1; + flag = strtol((char*)str->s, &s, 0); + if (*s) { // not the end of the string + flag = 0; + for (s = str->s; *s; ++s) + flag |= bam_char2flag_table[(int)*s]; + } + c->flag = flag; + } + { // tid, pos, qual + ret = ks_getuntil(ks, KS_SEP_TAB, str, &dret); z += str->l + 1; c->tid = bam_get_tid(header, str->s); + if (c->tid < 0 && strcmp(str->s, "*")) { + if (header->n_targets == 0) { + fprintf(stderr, "[sam_read1] missing header? Abort!\n"); + exit(1); + } else fprintf(stderr, "[sam_read1] reference '%s' is recognized as '*'.\n", str->s); + } + ret = ks_getuntil(ks, KS_SEP_TAB, str, &dret); z += str->l + 1; c->pos = isdigit(str->s[0])? atoi(str->s) - 1 : -1; + ret = ks_getuntil(ks, KS_SEP_TAB, str, &dret); z += str->l + 1; c->qual = isdigit(str->s[0])? atoi(str->s) : 0; + if (ret < 0) return -2; + } + { // cigar + char *s, *t; + int i, op; + long x; + c->n_cigar = 0; + if (ks_getuntil(ks, KS_SEP_TAB, str, &dret) < 0) return -3; + z += str->l + 1; + if (str->s[0] != '*') { + for (s = str->s; *s; ++s) { + if (isalpha(*s)) ++c->n_cigar; + else if (!isdigit(*s)) parse_error(fp->n_lines, "invalid CIGAR character"); + } + b->data = alloc_data(b, doff + c->n_cigar * 4); + for (i = 0, s = str->s; i != c->n_cigar; ++i) { + x = strtol(s, &t, 10); + op = toupper(*t); + if (op == 'M' || op == '=' || op == 'X') op = BAM_CMATCH; + else if (op == 'I') op = BAM_CINS; + else if (op == 'D') op = BAM_CDEL; + else if (op == 'N') op = BAM_CREF_SKIP; + else if (op == 'S') op = BAM_CSOFT_CLIP; + else if (op == 'H') op = BAM_CHARD_CLIP; + else if (op == 'P') op = BAM_CPAD; + else parse_error(fp->n_lines, "invalid CIGAR operation"); + s = t + 1; + bam1_cigar(b)[i] = x << BAM_CIGAR_SHIFT | op; + } + if (*s) parse_error(fp->n_lines, "unmatched CIGAR operation"); + c->bin = bam_reg2bin(c->pos, bam_calend(c, bam1_cigar(b))); + doff += c->n_cigar * 4; + } else { + if (!(c->flag&BAM_FUNMAP)) { + fprintf(stderr, "Parse warning at line %lld: mapped sequence without CIGAR\n", (long long)fp->n_lines); + c->flag |= BAM_FUNMAP; + } + c->bin = bam_reg2bin(c->pos, c->pos + 1); + } + } + { // mtid, mpos, isize + ret = ks_getuntil(ks, KS_SEP_TAB, str, &dret); z += str->l + 1; + c->mtid = strcmp(str->s, "=")? bam_get_tid(header, str->s) : c->tid; + ret = ks_getuntil(ks, KS_SEP_TAB, str, &dret); z += str->l + 1; + c->mpos = isdigit(str->s[0])? atoi(str->s) - 1 : -1; + ret = ks_getuntil(ks, KS_SEP_TAB, str, &dret); z += str->l + 1; + c->isize = (str->s[0] == '-' || isdigit(str->s[0]))? atoi(str->s) : 0; + if (ret < 0) return -4; + } + { // seq and qual + int i; + uint8_t *p = 0; + if (ks_getuntil(ks, KS_SEP_TAB, str, &dret) < 0) return -5; // seq + z += str->l + 1; + if (strcmp(str->s, "*")) { + c->l_qseq = strlen(str->s); + if (c->n_cigar && c->l_qseq != (int32_t)bam_cigar2qlen(c, bam1_cigar(b))) + parse_error(fp->n_lines, "CIGAR and sequence length are inconsistent"); + p = (uint8_t*)alloc_data(b, doff + c->l_qseq + (c->l_qseq+1)/2) + doff; + memset(p, 0, (c->l_qseq+1)/2); + for (i = 0; i < c->l_qseq; ++i) + p[i/2] |= bam_nt16_table[(int)str->s[i]] << 4*(1-i%2); + } else c->l_qseq = 0; + if (ks_getuntil(ks, KS_SEP_TAB, str, &dret) < 0) return -6; // qual + z += str->l + 1; + if (strcmp(str->s, "*") && c->l_qseq != strlen(str->s)) + parse_error(fp->n_lines, "sequence and quality are inconsistent"); + p += (c->l_qseq+1)/2; + if (strcmp(str->s, "*") == 0) for (i = 0; i < c->l_qseq; ++i) p[i] = 0xff; + else for (i = 0; i < c->l_qseq; ++i) p[i] = str->s[i] - 33; + doff += c->l_qseq + (c->l_qseq+1)/2; + } + doff0 = doff; + if (dret != '\n' && dret != '\r') { // aux + while (ks_getuntil(ks, KS_SEP_TAB, str, &dret) >= 0) { + uint8_t *s, type, key[2]; + z += str->l + 1; + if (str->l < 6 || str->s[2] != ':' || str->s[4] != ':') + parse_error(fp->n_lines, "missing colon in auxiliary data"); + key[0] = str->s[0]; key[1] = str->s[1]; + type = str->s[3]; + s = alloc_data(b, doff + 3) + doff; + s[0] = key[0]; s[1] = key[1]; s += 2; doff += 2; + if (type == 'A' || type == 'a' || type == 'c' || type == 'C') { // c and C for backward compatibility + s = alloc_data(b, doff + 2) + doff; + *s++ = 'A'; *s = str->s[5]; + doff += 2; + } else if (type == 'I' || type == 'i') { + long long x; + s = alloc_data(b, doff + 5) + doff; + x = (long long)atoll(str->s + 5); + if (x < 0) { + if (x >= -127) { + *s++ = 'c'; *(int8_t*)s = (int8_t)x; + s += 1; doff += 2; + } else if (x >= -32767) { + *s++ = 's'; *(int16_t*)s = (int16_t)x; + s += 2; doff += 3; + } else { + *s++ = 'i'; *(int32_t*)s = (int32_t)x; + s += 4; doff += 5; + if (x < -2147483648ll) + fprintf(stderr, "Parse warning at line %lld: integer %lld is out of range.", + (long long)fp->n_lines, x); + } + } else { + if (x <= 255) { + *s++ = 'C'; *s++ = (uint8_t)x; + doff += 2; + } else if (x <= 65535) { + *s++ = 'S'; *(uint16_t*)s = (uint16_t)x; + s += 2; doff += 3; + } else { + *s++ = 'I'; *(uint32_t*)s = (uint32_t)x; + s += 4; doff += 5; + if (x > 4294967295ll) + fprintf(stderr, "Parse warning at line %lld: integer %lld is out of range.", + (long long)fp->n_lines, x); + } + } + } else if (type == 'f') { + s = alloc_data(b, doff + 5) + doff; + *s++ = 'f'; + *(float*)s = (float)atof(str->s + 5); + s += 4; doff += 5; + } else if (type == 'd') { + s = alloc_data(b, doff + 9) + doff; + *s++ = 'd'; + *(float*)s = (float)atof(str->s + 9); + s += 8; doff += 9; + } else if (type == 'Z' || type == 'H') { + int size = 1 + (str->l - 5) + 1; + if (type == 'H') { // check whether the hex string is valid + int i; + if ((str->l - 5) % 2 == 1) parse_error(fp->n_lines, "length of the hex string not even"); + for (i = 0; i < str->l - 5; ++i) { + int c = toupper(str->s[5 + i]); + if (!((c >= '0' && c <= '9') || (c >= 'A' && c <= 'F'))) + parse_error(fp->n_lines, "invalid hex character"); + } + } + s = alloc_data(b, doff + size) + doff; + *s++ = type; + memcpy(s, str->s + 5, str->l - 5); + s[str->l - 5] = 0; + doff += size; + } else parse_error(fp->n_lines, "unrecognized type"); + if (dret == '\n' || dret == '\r') break; + } + } + b->l_aux = doff - doff0; + b->data_len = doff; + return z; +} + +tamFile sam_open(const char *fn) +{ + tamFile fp; + gzFile gzfp = (strcmp(fn, "-") == 0)? gzdopen(fileno(stdin), "rb") : gzopen(fn, "rb"); + if (gzfp == 0) return 0; + fp = (tamFile)calloc(1, sizeof(struct __tamFile_t)); + fp->str = (kstring_t*)calloc(1, sizeof(kstring_t)); + fp->fp = gzfp; + fp->ks = ks_init(fp->fp); + return fp; +} + +void sam_close(tamFile fp) +{ + if (fp) { + ks_destroy(fp->ks); + gzclose(fp->fp); + free(fp->str->s); free(fp->str); + free(fp); + } +}
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/SNV/SNVMix2_source/SNVMix2-v0.12.1-rc1/samtools-0.1.6/bam_index.c Wed Oct 12 19:50:38 2011 -0400 @@ -0,0 +1,560 @@ +#include <ctype.h> +#include <assert.h> +#include "bam.h" +#include "khash.h" +#include "ksort.h" +#include "bam_endian.h" +#ifdef _USE_KNETFILE +#include "knetfile.h" +#endif + +/*! + @header + + Alignment indexing. Before indexing, BAM must be sorted based on the + leftmost coordinate of alignments. In indexing, BAM uses two indices: + a UCSC binning index and a simple linear index. The binning index is + efficient for alignments spanning long distance, while the auxiliary + linear index helps to reduce unnecessary seek calls especially for + short alignments. + + The UCSC binning scheme was suggested by Richard Durbin and Lincoln + Stein and is explained by Kent et al. (2002). In this scheme, each bin + represents a contiguous genomic region which can be fully contained in + another bin; each alignment is associated with a bin which represents + the smallest region containing the entire alignment. The binning + scheme is essentially another representation of R-tree. A distinct bin + uniquely corresponds to a distinct internal node in a R-tree. Bin A is + a child of Bin B if region A is contained in B. + + In BAM, each bin may span 2^29, 2^26, 2^23, 2^20, 2^17 or 2^14 bp. Bin + 0 spans a 512Mbp region, bins 1-8 span 64Mbp, 9-72 8Mbp, 73-584 1Mbp, + 585-4680 128Kbp and bins 4681-37449 span 16Kbp regions. If we want to + find the alignments overlapped with a region [rbeg,rend), we need to + calculate the list of bins that may be overlapped the region and test + the alignments in the bins to confirm the overlaps. If the specified + region is short, typically only a few alignments in six bins need to + be retrieved. The overlapping alignments can be quickly fetched. + + */ + +#define BAM_MIN_CHUNK_GAP 32768 +// 1<<14 is the size of minimum bin. +#define BAM_LIDX_SHIFT 14 + +typedef struct { + uint64_t u, v; +} pair64_t; + +#define pair64_lt(a,b) ((a).u < (b).u) +KSORT_INIT(off, pair64_t, pair64_lt) + +typedef struct { + uint32_t m, n; + pair64_t *list; +} bam_binlist_t; + +typedef struct { + int32_t n, m; + uint64_t *offset; +} bam_lidx_t; + +KHASH_MAP_INIT_INT(i, bam_binlist_t) + +struct __bam_index_t { + int32_t n; + khash_t(i) **index; + bam_lidx_t *index2; +}; + +// requirement: len <= LEN_MASK +static inline void insert_offset(khash_t(i) *h, int bin, uint64_t beg, uint64_t end) +{ + khint_t k; + bam_binlist_t *l; + int ret; + k = kh_put(i, h, bin, &ret); + l = &kh_value(h, k); + if (ret) { // not present + l->m = 1; l->n = 0; + l->list = (pair64_t*)calloc(l->m, 16); + } + if (l->n == l->m) { + l->m <<= 1; + l->list = (pair64_t*)realloc(l->list, l->m * 16); + } + l->list[l->n].u = beg; l->list[l->n++].v = end; +} + +static inline void insert_offset2(bam_lidx_t *index2, bam1_t *b, uint64_t offset) +{ + int i, beg, end; + beg = b->core.pos >> BAM_LIDX_SHIFT; + end = (bam_calend(&b->core, bam1_cigar(b)) - 1) >> BAM_LIDX_SHIFT; + if (index2->m < end + 1) { + int old_m = index2->m; + index2->m = end + 1; + kroundup32(index2->m); + index2->offset = (uint64_t*)realloc(index2->offset, index2->m * 8); + memset(index2->offset + old_m, 0, 8 * (index2->m - old_m)); + } + for (i = beg + 1; i <= end; ++i) + if (index2->offset[i] == 0) index2->offset[i] = offset; + index2->n = end + 1; +} + +static void merge_chunks(bam_index_t *idx) +{ +#if defined(BAM_TRUE_OFFSET) || defined(BAM_VIRTUAL_OFFSET16) + khash_t(i) *index; + int i, l, m; + khint_t k; + for (i = 0; i < idx->n; ++i) { + index = idx->index[i]; + for (k = kh_begin(index); k != kh_end(index); ++k) { + bam_binlist_t *p; + if (!kh_exist(index, k)) continue; + p = &kh_value(index, k); + m = 0; + for (l = 1; l < p->n; ++l) { +#ifdef BAM_TRUE_OFFSET + if (p->list[m].v + BAM_MIN_CHUNK_GAP > p->list[l].u) p->list[m].v = p->list[l].v; +#else + if (p->list[m].v>>16 == p->list[l].u>>16) p->list[m].v = p->list[l].v; +#endif + else p->list[++m] = p->list[l]; + } // ~for(l) + p->n = m + 1; + } // ~for(k) + } // ~for(i) +#endif // defined(BAM_TRUE_OFFSET) || defined(BAM_BGZF) +} + +bam_index_t *bam_index_core(bamFile fp) +{ + bam1_t *b; + bam_header_t *h; + int i, ret; + bam_index_t *idx; + uint32_t last_bin, save_bin; + int32_t last_coor, last_tid, save_tid; + bam1_core_t *c; + uint64_t save_off, last_off; + + idx = (bam_index_t*)calloc(1, sizeof(bam_index_t)); + b = (bam1_t*)calloc(1, sizeof(bam1_t)); + h = bam_header_read(fp); + c = &b->core; + + idx->n = h->n_targets; + bam_header_destroy(h); + idx->index = (khash_t(i)**)calloc(idx->n, sizeof(void*)); + for (i = 0; i < idx->n; ++i) idx->index[i] = kh_init(i); + idx->index2 = (bam_lidx_t*)calloc(idx->n, sizeof(bam_lidx_t)); + + save_bin = save_tid = last_tid = last_bin = 0xffffffffu; + save_off = last_off = bam_tell(fp); last_coor = 0xffffffffu; + while ((ret = bam_read1(fp, b)) >= 0) { + if (last_tid != c->tid) { // change of chromosomes + last_tid = c->tid; + last_bin = 0xffffffffu; + } else if (last_coor > c->pos) { + fprintf(stderr, "[bam_index_core] the alignment is not sorted (%s): %u > %u in %d-th chr\n", + bam1_qname(b), last_coor, c->pos, c->tid+1); + exit(1); + } + if (b->core.tid >= 0 && b->core.bin < 4681) insert_offset2(&idx->index2[b->core.tid], b, last_off); + if (c->bin != last_bin) { // then possibly write the binning index + if (save_bin != 0xffffffffu) // save_bin==0xffffffffu only happens to the first record + insert_offset(idx->index[save_tid], save_bin, save_off, last_off); + save_off = last_off; + save_bin = last_bin = c->bin; + save_tid = c->tid; + if (save_tid < 0) break; + } + if (bam_tell(fp) <= last_off) { + fprintf(stderr, "[bam_index_core] bug in BGZF/RAZF: %llx < %llx\n", + (unsigned long long)bam_tell(fp), (unsigned long long)last_off); + exit(1); + } + last_off = bam_tell(fp); + last_coor = b->core.pos; + } + if (save_tid >= 0) insert_offset(idx->index[save_tid], save_bin, save_off, bam_tell(fp)); + merge_chunks(idx); + if (ret < -1) fprintf(stderr, "[bam_index_core] truncated file? Continue anyway. (%d)\n", ret); + free(b->data); free(b); + return idx; +} + +void bam_index_destroy(bam_index_t *idx) +{ + khint_t k; + int i; + if (idx == 0) return; + for (i = 0; i < idx->n; ++i) { + khash_t(i) *index = idx->index[i]; + bam_lidx_t *index2 = idx->index2 + i; + for (k = kh_begin(index); k != kh_end(index); ++k) { + if (kh_exist(index, k)) + free(kh_value(index, k).list); + } + kh_destroy(i, index); + free(index2->offset); + } + free(idx->index); free(idx->index2); + free(idx); +} + +void bam_index_save(const bam_index_t *idx, FILE *fp) +{ + int32_t i, size; + khint_t k; + fwrite("BAI\1", 1, 4, fp); + if (bam_is_be) { + uint32_t x = idx->n; + fwrite(bam_swap_endian_4p(&x), 4, 1, fp); + } else fwrite(&idx->n, 4, 1, fp); + for (i = 0; i < idx->n; ++i) { + khash_t(i) *index = idx->index[i]; + bam_lidx_t *index2 = idx->index2 + i; + // write binning index + size = kh_size(index); + if (bam_is_be) { // big endian + uint32_t x = size; + fwrite(bam_swap_endian_4p(&x), 4, 1, fp); + } else fwrite(&size, 4, 1, fp); + for (k = kh_begin(index); k != kh_end(index); ++k) { + if (kh_exist(index, k)) { + bam_binlist_t *p = &kh_value(index, k); + if (bam_is_be) { // big endian + uint32_t x; + x = kh_key(index, k); fwrite(bam_swap_endian_4p(&x), 4, 1, fp); + x = p->n; fwrite(bam_swap_endian_4p(&x), 4, 1, fp); + for (x = 0; (int)x < p->n; ++x) { + bam_swap_endian_8p(&p->list[x].u); + bam_swap_endian_8p(&p->list[x].v); + } + fwrite(p->list, 16, p->n, fp); + for (x = 0; (int)x < p->n; ++x) { + bam_swap_endian_8p(&p->list[x].u); + bam_swap_endian_8p(&p->list[x].v); + } + } else { + fwrite(&kh_key(index, k), 4, 1, fp); + fwrite(&p->n, 4, 1, fp); + fwrite(p->list, 16, p->n, fp); + } + } + } + // write linear index (index2) + if (bam_is_be) { + int x = index2->n; + fwrite(bam_swap_endian_4p(&x), 4, 1, fp); + } else fwrite(&index2->n, 4, 1, fp); + if (bam_is_be) { // big endian + int x; + for (x = 0; (int)x < index2->n; ++x) + bam_swap_endian_8p(&index2->offset[x]); + fwrite(index2->offset, 8, index2->n, fp); + for (x = 0; (int)x < index2->n; ++x) + bam_swap_endian_8p(&index2->offset[x]); + } else fwrite(index2->offset, 8, index2->n, fp); + } + fflush(fp); +} + +static bam_index_t *bam_index_load_core(FILE *fp) +{ + int i; + char magic[4]; + bam_index_t *idx; + if (fp == 0) { + fprintf(stderr, "[bam_index_load_core] fail to load index.\n"); + return 0; + } + fread(magic, 1, 4, fp); + if (strncmp(magic, "BAI\1", 4)) { + fprintf(stderr, "[bam_index_load] wrong magic number.\n"); + fclose(fp); + return 0; + } + idx = (bam_index_t*)calloc(1, sizeof(bam_index_t)); + fread(&idx->n, 4, 1, fp); + if (bam_is_be) bam_swap_endian_4p(&idx->n); + idx->index = (khash_t(i)**)calloc(idx->n, sizeof(void*)); + idx->index2 = (bam_lidx_t*)calloc(idx->n, sizeof(bam_lidx_t)); + for (i = 0; i < idx->n; ++i) { + khash_t(i) *index; + bam_lidx_t *index2 = idx->index2 + i; + uint32_t key, size; + khint_t k; + int j, ret; + bam_binlist_t *p; + index = idx->index[i] = kh_init(i); + // load binning index + fread(&size, 4, 1, fp); + if (bam_is_be) bam_swap_endian_4p(&size); + for (j = 0; j < (int)size; ++j) { + fread(&key, 4, 1, fp); + if (bam_is_be) bam_swap_endian_4p(&key); + k = kh_put(i, index, key, &ret); + p = &kh_value(index, k); + fread(&p->n, 4, 1, fp); + if (bam_is_be) bam_swap_endian_4p(&p->n); + p->m = p->n; + p->list = (pair64_t*)malloc(p->m * 16); + fread(p->list, 16, p->n, fp); + if (bam_is_be) { + int x; + for (x = 0; x < p->n; ++x) { + bam_swap_endian_8p(&p->list[x].u); + bam_swap_endian_8p(&p->list[x].v); + } + } + } + // load linear index + fread(&index2->n, 4, 1, fp); + if (bam_is_be) bam_swap_endian_4p(&index2->n); + index2->m = index2->n; + index2->offset = (uint64_t*)calloc(index2->m, 8); + fread(index2->offset, index2->n, 8, fp); + if (bam_is_be) + for (j = 0; j < index2->n; ++j) bam_swap_endian_8p(&index2->offset[j]); + } + return idx; +} + +bam_index_t *bam_index_load_local(const char *_fn) +{ + FILE *fp; + char *fnidx, *fn; + + if (strstr(_fn, "ftp://") == _fn || strstr(_fn, "http://") == _fn) { + const char *p; + int l = strlen(_fn); + for (p = _fn + l - 1; p >= _fn; --p) + if (*p == '/') break; + fn = strdup(p + 1); + } else fn = strdup(_fn); + fnidx = (char*)calloc(strlen(fn) + 5, 1); + strcpy(fnidx, fn); strcat(fnidx, ".bai"); + fp = fopen(fnidx, "r"); + if (fp == 0) { // try "{base}.bai" + char *s = strstr(fn, "bam"); + if (s == fn + strlen(fn) - 3) { + strcpy(fnidx, fn); + fnidx[strlen(fn)-1] = 'i'; + fp = fopen(fnidx, "r"); + } + } + free(fnidx); free(fn); + if (fp) { + bam_index_t *idx = bam_index_load_core(fp); + fclose(fp); + return idx; + } else return 0; +} + +#ifdef _USE_KNETFILE +static void download_from_remote(const char *url) +{ + const int buf_size = 1 * 1024 * 1024; + char *fn; + FILE *fp; + uint8_t *buf; + knetFile *fp_remote; + int l; + if (strstr(url, "ftp://") != url && strstr(url, "http://") != url) return; + l = strlen(url); + for (fn = (char*)url + l - 1; fn >= url; --fn) + if (*fn == '/') break; + ++fn; // fn now points to the file name + fp_remote = knet_open(url, "r"); + if (fp_remote == 0) { + fprintf(stderr, "[download_from_remote] fail to open remote file.\n"); + return; + } + if ((fp = fopen(fn, "w")) == 0) { + fprintf(stderr, "[download_from_remote] fail to create file in the working directory.\n"); + knet_close(fp_remote); + return; + } + buf = (uint8_t*)calloc(buf_size, 1); + while ((l = knet_read(fp_remote, buf, buf_size)) != 0) + fwrite(buf, 1, l, fp); + free(buf); + fclose(fp); + knet_close(fp_remote); +} +#else +static void download_from_remote(const char *url) +{ + return; +} +#endif + +bam_index_t *bam_index_load(const char *fn) +{ + bam_index_t *idx; + idx = bam_index_load_local(fn); + if (idx == 0 && (strstr(fn, "ftp://") == fn || strstr(fn, "http://") == fn)) { + char *fnidx = calloc(strlen(fn) + 5, 1); + strcat(strcpy(fnidx, fn), ".bai"); + fprintf(stderr, "[bam_index_load] attempting to download the remote index file.\n"); + download_from_remote(fnidx); + idx = bam_index_load_local(fn); + } + if (idx == 0) fprintf(stderr, "[bam_index_load] fail to load BAM index.\n"); + return idx; +} + +int bam_index_build2(const char *fn, const char *_fnidx) +{ + char *fnidx; + FILE *fpidx; + bamFile fp; + bam_index_t *idx; + if ((fp = bam_open(fn, "r")) == 0) { + fprintf(stderr, "[bam_index_build2] fail to open the BAM file.\n"); + return -1; + } + idx = bam_index_core(fp); + bam_close(fp); + if (_fnidx == 0) { + fnidx = (char*)calloc(strlen(fn) + 5, 1); + strcpy(fnidx, fn); strcat(fnidx, ".bai"); + } else fnidx = strdup(_fnidx); + fpidx = fopen(fnidx, "w"); + if (fpidx == 0) { + fprintf(stderr, "[bam_index_build2] fail to create the index file.\n"); + free(fnidx); + return -1; + } + bam_index_save(idx, fpidx); + bam_index_destroy(idx); + fclose(fpidx); + free(fnidx); + return 0; +} + +int bam_index_build(const char *fn) +{ + return bam_index_build2(fn, 0); +} + +int bam_index(int argc, char *argv[]) +{ + if (argc < 2) { + fprintf(stderr, "Usage: samtools index <in.bam> [<out.index>]\n"); + return 1; + } + if (argc >= 3) bam_index_build2(argv[1], argv[2]); + else bam_index_build(argv[1]); + return 0; +} + +#define MAX_BIN 37450 // =(8^6-1)/7+1 + +static inline int reg2bins(uint32_t beg, uint32_t end, uint16_t list[MAX_BIN]) +{ + int i = 0, k; + --end; + list[i++] = 0; + for (k = 1 + (beg>>26); k <= 1 + (end>>26); ++k) list[i++] = k; + for (k = 9 + (beg>>23); k <= 9 + (end>>23); ++k) list[i++] = k; + for (k = 73 + (beg>>20); k <= 73 + (end>>20); ++k) list[i++] = k; + for (k = 585 + (beg>>17); k <= 585 + (end>>17); ++k) list[i++] = k; + for (k = 4681 + (beg>>14); k <= 4681 + (end>>14); ++k) list[i++] = k; + return i; +} + +static inline int is_overlap(uint32_t beg, uint32_t end, const bam1_t *b) +{ + uint32_t rbeg = b->core.pos; + uint32_t rend = b->core.n_cigar? bam_calend(&b->core, bam1_cigar(b)) : b->core.pos + 1; + return (rend > beg && rbeg < end); +} + +int bam_fetch(bamFile fp, const bam_index_t *idx, int tid, int beg, int end, void *data, bam_fetch_f func) +{ + uint16_t *bins; + int i, n_bins, n_off; + pair64_t *off; + khint_t k; + khash_t(i) *index; + uint64_t min_off; + + bins = (uint16_t*)calloc(MAX_BIN, 2); + n_bins = reg2bins(beg, end, bins); + index = idx->index[tid]; + min_off = (beg>>BAM_LIDX_SHIFT >= idx->index2[tid].n)? 0 : idx->index2[tid].offset[beg>>BAM_LIDX_SHIFT]; + for (i = n_off = 0; i < n_bins; ++i) { + if ((k = kh_get(i, index, bins[i])) != kh_end(index)) + n_off += kh_value(index, k).n; + } + if (n_off == 0) { + free(bins); return 0; + } + off = (pair64_t*)calloc(n_off, 16); + for (i = n_off = 0; i < n_bins; ++i) { + if ((k = kh_get(i, index, bins[i])) != kh_end(index)) { + int j; + bam_binlist_t *p = &kh_value(index, k); + for (j = 0; j < p->n; ++j) + if (p->list[j].v > min_off) off[n_off++] = p->list[j]; + } + } + free(bins); + { + bam1_t *b; + int l, ret, n_seeks; + uint64_t curr_off; + b = (bam1_t*)calloc(1, sizeof(bam1_t)); + ks_introsort(off, n_off, off); + // resolve completely contained adjacent blocks + for (i = 1, l = 0; i < n_off; ++i) + if (off[l].v < off[i].v) + off[++l] = off[i]; + n_off = l + 1; + // resolve overlaps between adjacent blocks; this may happen due to the merge in indexing + for (i = 1; i < n_off; ++i) + if (off[i-1].v >= off[i].u) off[i-1].v = off[i].u; + { // merge adjacent blocks +#if defined(BAM_TRUE_OFFSET) || defined(BAM_VIRTUAL_OFFSET16) + for (i = 1, l = 0; i < n_off; ++i) { +#ifdef BAM_TRUE_OFFSET + if (off[l].v + BAM_MIN_CHUNK_GAP > off[i].u) off[l].v = off[i].v; +#else + if (off[l].v>>16 == off[i].u>>16) off[l].v = off[i].v; +#endif + else off[++l] = off[i]; + } + n_off = l + 1; +#endif + } + // retrive alignments + n_seeks = 0; i = -1; curr_off = 0; + for (;;) { + if (curr_off == 0 || curr_off >= off[i].v) { // then jump to the next chunk + if (i == n_off - 1) break; // no more chunks + if (i >= 0) assert(curr_off == off[i].v); // otherwise bug + if (i < 0 || off[i].v != off[i+1].u) { // not adjacent chunks; then seek + bam_seek(fp, off[i+1].u, SEEK_SET); + curr_off = bam_tell(fp); + ++n_seeks; + } + ++i; + } + if ((ret = bam_read1(fp, b)) > 0) { + curr_off = bam_tell(fp); + if (b->core.tid != tid || b->core.pos >= end) break; // no need to proceed + else if (is_overlap(beg, end, b)) func(b, data); + } else break; // end of file + } +// fprintf(stderr, "[bam_fetch] # seek calls: %d\n", n_seeks); + bam_destroy1(b); + } + free(off); + return 0; +}
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/SNV/SNVMix2_source/SNVMix2-v0.12.1-rc1/samtools-0.1.6/bam_lpileup.c Wed Oct 12 19:50:38 2011 -0400 @@ -0,0 +1,198 @@ +#include <stdlib.h> +#include <stdio.h> +#include <assert.h> +#include "bam.h" +#include "ksort.h" + +#define TV_GAP 2 + +typedef struct __freenode_t { + uint32_t level:28, cnt:4; + struct __freenode_t *next; +} freenode_t, *freenode_p; + +#define freenode_lt(a,b) ((a)->cnt < (b)->cnt || ((a)->cnt == (b)->cnt && (a)->level < (b)->level)) +KSORT_INIT(node, freenode_p, freenode_lt) + +/* Memory pool, similar to the one in bam_pileup.c */ +typedef struct { + int cnt, n, max; + freenode_t **buf; +} mempool_t; + +static mempool_t *mp_init() +{ + return (mempool_t*)calloc(1, sizeof(mempool_t)); +} +static void mp_destroy(mempool_t *mp) +{ + int k; + for (k = 0; k < mp->n; ++k) free(mp->buf[k]); + free(mp->buf); free(mp); +} +static inline freenode_t *mp_alloc(mempool_t *mp) +{ + ++mp->cnt; + if (mp->n == 0) return (freenode_t*)calloc(1, sizeof(freenode_t)); + else return mp->buf[--mp->n]; +} +static inline void mp_free(mempool_t *mp, freenode_t *p) +{ + --mp->cnt; p->next = 0; p->cnt = TV_GAP; + if (mp->n == mp->max) { + mp->max = mp->max? mp->max<<1 : 256; + mp->buf = (freenode_t**)realloc(mp->buf, sizeof(freenode_t*) * mp->max); + } + mp->buf[mp->n++] = p; +} + +/* core part */ +struct __bam_lplbuf_t { + int max, n_cur, n_pre; + int max_level, *cur_level, *pre_level; + mempool_t *mp; + freenode_t **aux, *head, *tail; + int n_nodes, m_aux; + bam_pileup_f func; + void *user_data; + bam_plbuf_t *plbuf; +}; + +void bam_lplbuf_reset(bam_lplbuf_t *buf) +{ + freenode_t *p, *q; + bam_plbuf_reset(buf->plbuf); + for (p = buf->head; p->next;) { + q = p->next; + mp_free(buf->mp, p); + p = q; + } + buf->head = buf->tail; + buf->max_level = 0; + buf->n_cur = buf->n_pre = 0; + buf->n_nodes = 0; +} + +static int tview_func(uint32_t tid, uint32_t pos, int n, const bam_pileup1_t *pl, void *data) +{ + bam_lplbuf_t *tv = (bam_lplbuf_t*)data; + freenode_t *p; + int i, l, max_level; + // allocate memory if necessary + if (tv->max < n) { // enlarge + tv->max = n; + kroundup32(tv->max); + tv->cur_level = (int*)realloc(tv->cur_level, sizeof(int) * tv->max); + tv->pre_level = (int*)realloc(tv->pre_level, sizeof(int) * tv->max); + } + tv->n_cur = n; + // update cnt + for (p = tv->head; p->next; p = p->next) + if (p->cnt > 0) --p->cnt; + // calculate cur_level[] + max_level = 0; + for (i = l = 0; i < n; ++i) { + const bam_pileup1_t *p = pl + i; + if (p->is_head) { + if (tv->head->next && tv->head->cnt == 0) { // then take a free slot + freenode_t *p = tv->head->next; + tv->cur_level[i] = tv->head->level; + mp_free(tv->mp, tv->head); + tv->head = p; + --tv->n_nodes; + } else tv->cur_level[i] = ++tv->max_level; + } else { + tv->cur_level[i] = tv->pre_level[l++]; + if (p->is_tail) { // then return a free slot + tv->tail->level = tv->cur_level[i]; + tv->tail->next = mp_alloc(tv->mp); + tv->tail = tv->tail->next; + ++tv->n_nodes; + } + } + if (tv->cur_level[i] > max_level) max_level = tv->cur_level[i]; + ((bam_pileup1_t*)p)->level = tv->cur_level[i]; + } + assert(l == tv->n_pre); + tv->func(tid, pos, n, pl, tv->user_data); + // sort the linked list + if (tv->n_nodes) { + freenode_t *q; + if (tv->n_nodes + 1 > tv->m_aux) { // enlarge + tv->m_aux = tv->n_nodes + 1; + kroundup32(tv->m_aux); + tv->aux = (freenode_t**)realloc(tv->aux, sizeof(void*) * tv->m_aux); + } + for (p = tv->head, i = l = 0; p->next;) { + if (p->level > max_level) { // then discard this entry + q = p->next; + mp_free(tv->mp, p); + p = q; + } else { + tv->aux[i++] = p; + p = p->next; + } + } + tv->aux[i] = tv->tail; // add a proper tail for the loop below + tv->n_nodes = i; + if (tv->n_nodes) { + ks_introsort(node, tv->n_nodes, tv->aux); + for (i = 0; i < tv->n_nodes; ++i) tv->aux[i]->next = tv->aux[i+1]; + tv->head = tv->aux[0]; + } else tv->head = tv->tail; + } + // clean up + tv->max_level = max_level; + memcpy(tv->pre_level, tv->cur_level, tv->n_cur * 4); + // squeeze out terminated levels + for (i = l = 0; i < n; ++i) { + const bam_pileup1_t *p = pl + i; + if (!p->is_tail) + tv->pre_level[l++] = tv->pre_level[i]; + } + tv->n_pre = l; +/* + fprintf(stderr, "%d\t", pos+1); + for (i = 0; i < n; ++i) { + const bam_pileup1_t *p = pl + i; + if (p->is_head) fprintf(stderr, "^"); + if (p->is_tail) fprintf(stderr, "$"); + fprintf(stderr, "%d,", p->level); + } + fprintf(stderr, "\n"); +*/ + return 0; +} + +bam_lplbuf_t *bam_lplbuf_init(bam_pileup_f func, void *data) +{ + bam_lplbuf_t *tv; + tv = (bam_lplbuf_t*)calloc(1, sizeof(bam_lplbuf_t)); + tv->mp = mp_init(); + tv->head = tv->tail = mp_alloc(tv->mp); + tv->func = func; + tv->user_data = data; + tv->plbuf = bam_plbuf_init(tview_func, tv); + return (bam_lplbuf_t*)tv; +} + +void bam_lplbuf_destroy(bam_lplbuf_t *tv) +{ + freenode_t *p, *q; + free(tv->cur_level); free(tv->pre_level); + bam_plbuf_destroy(tv->plbuf); + free(tv->aux); + for (p = tv->head; p->next;) { + q = p->next; + mp_free(tv->mp, p); p = q; + } + mp_free(tv->mp, p); + assert(tv->mp->cnt == 0); + mp_destroy(tv->mp); + free(tv); +} + +int bam_lplbuf_push(const bam1_t *b, bam_lplbuf_t *tv) +{ + return bam_plbuf_push(b, tv->plbuf); +}
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/SNV/SNVMix2_source/SNVMix2-v0.12.1-rc1/samtools-0.1.6/bam_maqcns.c Wed Oct 12 19:50:38 2011 -0400 @@ -0,0 +1,535 @@ +#include <math.h> +#include "bam.h" +#include "bam_maqcns.h" +#include "ksort.h" +KSORT_INIT_GENERIC(uint32_t) + +#define MAX_WINDOW 33 + +typedef struct __bmc_aux_t { + int max; + uint32_t *info; +} bmc_aux_t; + +typedef struct { + float esum[4], fsum[4]; + uint32_t c[4]; + uint32_t rms_mapQ; +} glf_call_aux_t; + +char bam_nt16_nt4_table[] = { 4, 0, 1, 4, 2, 4, 4, 4, 3, 4, 4, 4, 4, 4, 4, 4 }; + +/* + P(<b1,b2>) = \theta \sum_{i=1}^{N-1} 1/i + P(D|<b1,b2>) = \sum_{k=1}^{N-1} p_k 1/2 [(k/N)^n_2(1-k/N)^n_1 + (k/N)^n1(1-k/N)^n_2] + p_k = i/k / \sum_{i=1}^{N-1} 1/i + */ +static void cal_het(bam_maqcns_t *aa) +{ + int k, n1, n2; + double sum_harmo; // harmonic sum + double poly_rate; + double p1 = 0.0, p3 = 0.0; // just for testing + + free(aa->lhet); + aa->lhet = (double*)calloc(256 * 256, sizeof(double)); + sum_harmo = 0.0; + for (k = 1; k <= aa->n_hap - 1; ++k) + sum_harmo += 1.0 / k; + for (n1 = 0; n1 < 256; ++n1) { + for (n2 = 0; n2 < 256; ++n2) { + long double sum = 0.0; + double lC = lgamma(n1+n2+1) - lgamma(n1+1) - lgamma(n2+1); // \binom{n1+n2}{n1} + for (k = 1; k <= aa->n_hap - 1; ++k) { + double pk = 1.0 / k / sum_harmo; + double log1 = log((double)k/aa->n_hap); + double log2 = log(1.0 - (double)k/aa->n_hap); + sum += pk * 0.5 * (expl(log1*n2) * expl(log2*n1) + expl(log1*n1) * expl(log2*n2)); + } + aa->lhet[n1<<8|n2] = lC + logl(sum); + if (n1 == 17 && n2 == 3) p3 = lC + logl(expl(logl(0.5) * 20)); + if (n1 == 19 && n2 == 1) p1 = lC + logl(expl(logl(0.5) * 20)); + } + } + poly_rate = aa->het_rate * sum_harmo; + aa->q_r = -4.343 * log(2.0 * poly_rate / (1.0 - poly_rate)); +} + +/** initialize the helper structure */ +static void cal_coef(bam_maqcns_t *aa) +{ + int k, n, q; + long double sum_a[257], b[256], q_c[256], tmp[256], fk2[256]; + double *lC; + + lC = (double*)calloc(256 * 256, sizeof(double)); + // aa->lhet will be allocated and initialized + free(aa->fk); free(aa->coef); + aa->fk = (double*)calloc(256, sizeof(double)); + aa->coef = (double*)calloc(256*256*64, sizeof(double)); + aa->fk[0] = fk2[0] = 1.0; + for (n = 1; n != 256; ++n) { + aa->fk[n] = pow(aa->theta, n) * (1.0 - aa->eta) + aa->eta; + fk2[n] = aa->fk[n>>1]; // this is an approximation, assuming reads equally likely come from both strands + } + for (n = 1; n != 256; ++n) + for (k = 1; k <= n; ++k) + lC[n<<8|k] = lgamma(n+1) - lgamma(k+1) - lgamma(n-k+1); + for (q = 1; q != 64; ++q) { + double e = pow(10.0, -q/10.0); + double le = log(e); + double le1 = log(1.0-e); + for (n = 1; n != 256; ++n) { + double *coef = aa->coef + (q<<16|n<<8); + sum_a[n+1] = 0.0; + for (k = n; k >= 0; --k) { // a_k = \sum_{i=k}^n C^n_k \epsilon^k (1-\epsilon)^{n-k} + sum_a[k] = sum_a[k+1] + expl(lC[n<<8|k] + k*le + (n-k)*le1); + b[k] = sum_a[k+1] / sum_a[k]; + if (b[k] > 0.99) b[k] = 0.99; + } + for (k = 0; k != n; ++k) // log(\bar\beta_{nk}(\bar\epsilon)^{f_k}) + q_c[k] = -4.343 * fk2[k] * logl(b[k] / e); + for (k = 1; k != n; ++k) q_c[k] += q_c[k-1]; // \prod_{i=0}^k c_i + for (k = 0; k <= n; ++k) { // powl() in 64-bit mode seems broken on my Mac OS X 10.4.9 + tmp[k] = -4.343 * logl(1.0 - expl(fk2[k] * logl(b[k]))); + coef[k] = (k? q_c[k-1] : 0) + tmp[k]; // this is the final c_{nk} + } + } + } + free(lC); +} + +bam_maqcns_t *bam_maqcns_init() +{ + bam_maqcns_t *bm; + bm = (bam_maqcns_t*)calloc(1, sizeof(bam_maqcns_t)); + bm->aux = (bmc_aux_t*)calloc(1, sizeof(bmc_aux_t)); + bm->het_rate = 0.001; + bm->theta = 0.85; + bm->n_hap = 2; + bm->eta = 0.03; + bm->cap_mapQ = 60; + return bm; +} + +void bam_maqcns_prepare(bam_maqcns_t *bm) +{ + cal_coef(bm); cal_het(bm); +} + +void bam_maqcns_destroy(bam_maqcns_t *bm) +{ + if (bm == 0) return; + free(bm->lhet); free(bm->fk); free(bm->coef); free(bm->aux->info); + free(bm->aux); free(bm); +} + +glf1_t *bam_maqcns_glfgen(int _n, const bam_pileup1_t *pl, uint8_t ref_base, bam_maqcns_t *bm) +{ + glf_call_aux_t *b; + int i, j, k, w[8], c, n; + glf1_t *g = (glf1_t*)calloc(1, sizeof(glf1_t)); + float p[16], min_p = 1e30; + uint64_t rms; + + g->ref_base = ref_base; + if (_n == 0) return g; + + // construct aux array + if (bm->aux->max < _n) { + bm->aux->max = _n; + kroundup32(bm->aux->max); + bm->aux->info = (uint32_t*)realloc(bm->aux->info, 4 * bm->aux->max); + } + for (i = n = 0; i < _n; ++i) { + const bam_pileup1_t *p = pl + i; + uint32_t q, x = 0, qq; + if (p->is_del || (p->b->core.flag&BAM_FUNMAP)) continue; + q = (uint32_t)bam1_qual(p->b)[p->qpos]; + x |= (uint32_t)bam1_strand(p->b) << 18 | q << 8 | p->b->core.qual; + if (p->b->core.qual < q) q = p->b->core.qual; + x |= q << 24; + qq = bam1_seqi(bam1_seq(p->b), p->qpos); + q = bam_nt16_nt4_table[qq? qq : ref_base]; + if (!p->is_del && q < 4) x |= 1 << 21 | q << 16; + bm->aux->info[n++] = x; + } + ks_introsort(uint32_t, n, bm->aux->info); + // generate esum and fsum + b = (glf_call_aux_t*)calloc(1, sizeof(glf_call_aux_t)); + for (k = 0; k != 8; ++k) w[k] = 0; + rms = 0; + for (j = n - 1; j >= 0; --j) { // calculate esum and fsum + uint32_t info = bm->aux->info[j]; + int tmp; + if (info>>24 < 4 && (info>>8&0x3f) != 0) info = 4<<24 | (info&0xffffff); + k = info>>16&7; + if (info>>24 > 0) { + b->esum[k&3] += bm->fk[w[k]] * (info>>24); + b->fsum[k&3] += bm->fk[w[k]]; + if (w[k] < 0xff) ++w[k]; + ++b->c[k&3]; + } + tmp = (int)(info&0x7f) < bm->cap_mapQ? (int)(info&0x7f) : bm->cap_mapQ; + rms += tmp * tmp; + } + b->rms_mapQ = (uint8_t)(sqrt((double)rms / n) + .499); + // rescale ->c[] + for (j = c = 0; j != 4; ++j) c += b->c[j]; + if (c > 255) { + for (j = 0; j != 4; ++j) b->c[j] = (int)(254.0 * b->c[j] / c + 0.5); + for (j = c = 0; j != 4; ++j) c += b->c[j]; + } + // generate likelihood + for (j = 0; j != 4; ++j) { + // homozygous + float tmp1, tmp3; + int tmp2, bar_e; + for (k = 0, tmp1 = tmp3 = 0.0, tmp2 = 0; k != 4; ++k) { + if (j == k) continue; + tmp1 += b->esum[k]; tmp2 += b->c[k]; tmp3 += b->fsum[k]; + } + if (tmp2) { + bar_e = (int)(tmp1 / tmp3 + 0.5); + if (bar_e < 4) bar_e = 4; // should not happen + if (bar_e > 63) bar_e = 63; + p[j<<2|j] = tmp1 + bm->coef[bar_e<<16|c<<8|tmp2]; + } else p[j<<2|j] = 0.0; // all the bases are j + // heterozygous + for (k = j + 1; k < 4; ++k) { + for (i = 0, tmp2 = 0, tmp1 = tmp3 = 0.0; i != 4; ++i) { + if (i == j || i == k) continue; + tmp1 += b->esum[i]; tmp2 += b->c[i]; tmp3 += b->fsum[i]; + } + if (tmp2) { + bar_e = (int)(tmp1 / tmp3 + 0.5); + if (bar_e < 4) bar_e = 4; + if (bar_e > 63) bar_e = 63; + p[j<<2|k] = p[k<<2|j] = -4.343 * bm->lhet[b->c[j]<<8|b->c[k]] + tmp1 + bm->coef[bar_e<<16|c<<8|tmp2]; + } else p[j<<2|k] = p[k<<2|j] = -4.343 * bm->lhet[b->c[j]<<8|b->c[k]]; // all the bases are either j or k + } + // + for (k = 0; k != 4; ++k) + if (p[j<<2|k] < 0.0) p[j<<2|k] = 0.0; + } + + { // fix p[k<<2|k] + float max1, max2, min1, min2; + int max_k, min_k; + max_k = min_k = -1; + max1 = max2 = -1.0; min1 = min2 = 1e30; + for (k = 0; k < 4; ++k) { + if (b->esum[k] > max1) { + max2 = max1; max1 = b->esum[k]; max_k = k; + } else if (b->esum[k] > max2) max2 = b->esum[k]; + } + for (k = 0; k < 4; ++k) { + if (p[k<<2|k] < min1) { + min2 = min1; min1 = p[k<<2|k]; min_k = k; + } else if (p[k<<2|k] < min2) min2 = p[k<<2|k]; + } + if (max1 > max2 && (min_k != max_k || min1 + 1.0 > min2)) + p[max_k<<2|max_k] = min1 > 1.0? min1 - 1.0 : 0.0; + } + + // convert necessary information to glf1_t + g->ref_base = ref_base; g->max_mapQ = b->rms_mapQ; + g->depth = n > 16777215? 16777215 : n; + for (j = 0; j != 4; ++j) + for (k = j; k < 4; ++k) + if (p[j<<2|k] < min_p) min_p = p[j<<2|k]; + g->min_lk = min_p > 255.0? 255 : (int)(min_p + 0.5); + for (j = c = 0; j != 4; ++j) + for (k = j; k < 4; ++k) + g->lk[c++] = p[j<<2|k]-min_p > 255.0? 255 : (int)(p[j<<2|k]-min_p + 0.5); + + free(b); + return g; +} + +uint32_t glf2cns(const glf1_t *g, int q_r) +{ + int i, j, k, tmp[16], min = 10000, min2 = 10000, min3 = 10000, min_g = -1, min_g2 = -1; + uint32_t x = 0; + for (i = k = 0; i < 4; ++i) + for (j = i; j < 4; ++j) { + tmp[j<<2|i] = -1; + tmp[i<<2|j] = g->lk[k++] + (i == j? 0 : q_r); + } + for (i = 0; i < 16; ++i) { + if (tmp[i] < 0) continue; + if (tmp[i] < min) { + min3 = min2; min2 = min; min = tmp[i]; min_g2 = min_g; min_g = i; + } else if (tmp[i] < min2) { + min3 = min2; min2 = tmp[i]; min_g2 = i; + } else if (tmp[i] < min3) min3 = tmp[i]; + } + x = min_g >= 0? (1U<<(min_g>>2&3) | 1U<<(min_g&3)) << 28 : 0xf << 28; + x |= min_g2 >= 0? (1U<<(min_g2>>2&3) | 1U<<(min_g2&3)) << 24 : 0xf << 24; + x |= (uint32_t)g->max_mapQ << 16; + x |= min2 < 10000? (min2 - min < 256? min2 - min : 255) << 8 : 0xff << 8; + x |= min2 < 10000 && min3 < 10000? (min3 - min2 < 256? min3 - min2 : 255) : 0xff; + return x; +} + +uint32_t bam_maqcns_call(int n, const bam_pileup1_t *pl, bam_maqcns_t *bm) +{ + glf1_t *g; + uint32_t x; + if (n) { + g = bam_maqcns_glfgen(n, pl, 0xf, bm); + x = glf2cns(g, (int)(bm->q_r + 0.5)); + free(g); + } else x = 0xfU<<28 | 0xfU<<24; + return x; +} + +/************** *****************/ + +bam_maqindel_opt_t *bam_maqindel_opt_init() +{ + bam_maqindel_opt_t *mi = (bam_maqindel_opt_t*)calloc(1, sizeof(bam_maqindel_opt_t)); + mi->q_indel = 40; + mi->r_indel = 0.00015; + // + mi->mm_penalty = 3; + mi->indel_err = 4; + mi->ambi_thres = 10; + return mi; +} + +void bam_maqindel_ret_destroy(bam_maqindel_ret_t *mir) +{ + if (mir == 0) return; + free(mir->s[0]); free(mir->s[1]); free(mir); +} + +#define MINUS_CONST 0x10000000 + +bam_maqindel_ret_t *bam_maqindel(int n, int pos, const bam_maqindel_opt_t *mi, const bam_pileup1_t *pl, const char *ref, + int _n_types, int *_types) +{ + int i, j, n_types, *types, left, right; + bam_maqindel_ret_t *ret = 0; + // if there is no proposed indel, check if there is an indel from the alignment + if (_n_types == 0) { + for (i = 0; i < n; ++i) { + const bam_pileup1_t *p = pl + i; + if (!(p->b->core.flag&BAM_FUNMAP) && p->indel != 0) break; + } + if (i == n) return 0; // no indel + } + { // calculate how many types of indels are available (set n_types and types) + int m; + uint32_t *aux; + aux = (uint32_t*)calloc(n + _n_types + 1, 4); + m = 0; + aux[m++] = MINUS_CONST; // zero indel is always a type + for (i = 0; i < n; ++i) { + const bam_pileup1_t *p = pl + i; + if (!(p->b->core.flag&BAM_FUNMAP) && p->indel != 0) + aux[m++] = MINUS_CONST + p->indel; + } + if (_n_types) // then also add this to aux[] + for (i = 0; i < _n_types; ++i) + if (_types[i]) aux[m++] = MINUS_CONST + _types[i]; + ks_introsort(uint32_t, m, aux); + // squeeze out identical types + for (i = 1, n_types = 1; i < m; ++i) + if (aux[i] != aux[i-1]) ++n_types; + types = (int*)calloc(n_types, sizeof(int)); + j = 0; + types[j++] = aux[0] - MINUS_CONST; + for (i = 1; i < m; ++i) { + if (aux[i] != aux[i-1]) + types[j++] = aux[i] - MINUS_CONST; + } + free(aux); + } + { // calculate left and right boundary + bam_segreg_t seg; + left = 0x7fffffff; right = 0; + for (i = 0; i < n; ++i) { + const bam_pileup1_t *p = pl + i; + if (!(p->b->core.flag&BAM_FUNMAP)) { + bam_segreg(pos, &p->b->core, bam1_cigar(p->b), &seg); + if (seg.tbeg < left) left = seg.tbeg; + if (seg.tend > right) right = seg.tend; + } + } + if (pos - left > MAX_WINDOW) left = pos - MAX_WINDOW; + if (right - pos> MAX_WINDOW) right = pos + MAX_WINDOW; + } + { // the core part + char *ref2, *inscns = 0; + int k, l, *score, *pscore, max_ins = types[n_types-1]; + ref2 = (char*)calloc(right - left + types[n_types-1] + 2, 1); + if (max_ins > 0) { // get the consensus of inserted sequences + int *inscns_aux = (int*)calloc(4 * n_types * max_ins, sizeof(int)); + // count occurrences + for (i = 0; i < n_types; ++i) { + if (types[i] <= 0) continue; // not insertion + for (j = 0; j < n; ++j) { + const bam_pileup1_t *p = pl + j; + if (!(p->b->core.flag&BAM_FUNMAP) && p->indel == types[i]) { + for (k = 1; k <= p->indel; ++k) { + int c = bam_nt16_nt4_table[bam1_seqi(bam1_seq(p->b), p->qpos + k)]; + if (c < 4) ++inscns_aux[i*max_ins*4 + (k-1)*4 + c]; + } + } + } + } + // construct the consensus of inserted sequence + inscns = (char*)calloc(n_types * max_ins, sizeof(char)); + for (i = 0; i < n_types; ++i) { + for (j = 0; j < types[i]; ++j) { + int max = 0, max_k = -1, *ia = inscns_aux + i*max_ins*4 + j*4; + for (k = 0; k < 4; ++k) { + if (ia[k] > max) { + max = ia[k]; + max_k = k; + } + } + inscns[i*max_ins + j] = max? 1<<max_k : 15; + } + } + free(inscns_aux); + } + // calculate score + score = (int*)calloc(n_types * n, sizeof(int)); + pscore = (int*)calloc(n_types * n, sizeof(int)); + for (i = 0; i < n_types; ++i) { + // write ref2 + for (k = 0, j = left; j <= pos; ++j) + ref2[k++] = bam_nt16_table[(int)ref[j]]; + if (types[i] <= 0) j += -types[i]; + else for (l = 0; l < types[i]; ++l) + ref2[k++] = inscns[i*max_ins + l]; + for (; j < right && ref[j]; ++j) + ref2[k++] = bam_nt16_table[(int)ref[j]]; + // calculate score for each read + for (j = 0; j < n; ++j) { + const bam_pileup1_t *p = pl + j; + uint32_t *cigar; + bam1_core_t *c = &p->b->core; + int s, ps; + bam_segreg_t seg; + if (c->flag&BAM_FUNMAP) continue; + cigar = bam1_cigar(p->b); + bam_segreg(pos, c, cigar, &seg); + for (ps = s = 0, l = seg.qbeg; c->pos + l < right && l < seg.qend; ++l) { + int cq = bam1_seqi(bam1_seq(p->b), l), ct; + // in the following line, "<" will happen if reads are too long + ct = c->pos + l - seg.qbeg >= left? ref2[c->pos + l - seg.qbeg - left] : 15; + if (cq < 15 && ct < 15) { + s += cq == ct? 1 : -mi->mm_penalty; + if (cq != ct) ps += bam1_qual(p->b)[l]; + } + } + score[i*n + j] = s; pscore[i*n + j] = ps; + if (types[i] != 0) { // then try the other way to calculate the score + for (ps = s = 0, l = seg.qbeg; c->pos + l + types[i] < right && l < seg.qend; ++l) { + int cq = bam1_seqi(bam1_seq(p->b), l), ct; + ct = c->pos + l - seg.qbeg + types[i] >= left? ref2[c->pos + l - seg.qbeg + types[i] - left] : 15; + if (cq < 15 && ct < 15) { + s += cq == ct? 1 : -mi->mm_penalty; + if (cq != ct) ps += bam1_qual(p->b)[l]; + } + } + } + if (score[i*n+j] < s) score[i*n+j] = s; // choose the higher of the two scores + if (pscore[i*n+j] > ps) pscore[i*n+j] = ps; + //if (types[i] != 0) score[i*n+j] -= mi->indel_err; + //printf("%d, %d, %d, %d, %d, %d, %d\n", p->b->core.pos + 1, seg.qbeg, i, types[i], j, + // score[i*n+j], pscore[i*n+j]); + } + } + { // get final result + int *sum, max1, max2, max1_i, max2_i; + // pick up the best two score + sum = (int*)calloc(n_types, sizeof(int)); + for (i = 0; i < n_types; ++i) + for (j = 0; j < n; ++j) + sum[i] += -pscore[i*n+j]; + max1 = max2 = -0x7fffffff; max1_i = max2_i = -1; + for (i = 0; i < n_types; ++i) { + if (sum[i] > max1) { + max2 = max1; max2_i = max1_i; max1 = sum[i]; max1_i = i; + } else if (sum[i] > max2) { + max2 = sum[i]; max2_i = i; + } + } + free(sum); + // write ret + ret = (bam_maqindel_ret_t*)calloc(1, sizeof(bam_maqindel_ret_t)); + ret->indel1 = types[max1_i]; ret->indel2 = types[max2_i]; + ret->s[0] = (char*)calloc(abs(ret->indel1) + 2, 1); + ret->s[1] = (char*)calloc(abs(ret->indel2) + 2, 1); + // write indel sequence + if (ret->indel1 > 0) { + ret->s[0][0] = '+'; + for (k = 0; k < ret->indel1; ++k) + ret->s[0][k+1] = bam_nt16_rev_table[(int)inscns[max1_i*max_ins + k]]; + } else if (ret->indel1 < 0) { + ret->s[0][0] = '-'; + for (k = 0; k < -ret->indel1 && ref[pos + k + 1]; ++k) + ret->s[0][k+1] = ref[pos + k + 1]; + } else ret->s[0][0] = '*'; + if (ret->indel2 > 0) { + ret->s[1][0] = '+'; + for (k = 0; k < ret->indel2; ++k) + ret->s[1][k+1] = bam_nt16_rev_table[(int)inscns[max2_i*max_ins + k]]; + } else if (ret->indel2 < 0) { + ret->s[1][0] = '-'; + for (k = 0; k < -ret->indel2 && ref[pos + k + 1]; ++k) + ret->s[1][k+1] = ref[pos + k + 1]; + } else ret->s[1][0] = '*'; + // write count + for (i = 0; i < n; ++i) { + const bam_pileup1_t *p = pl + i; + if (p->indel == ret->indel1) ++ret->cnt1; + else if (p->indel == ret->indel2) ++ret->cnt2; + else ++ret->cnt_anti; + } + // write gl[] + ret->gl[0] = ret->gl[1] = 0; + for (j = 0; j < n; ++j) { + int s1 = pscore[max1_i*n + j], s2 = pscore[max2_i*n + j]; + //printf("%d, %d, %d, %d, %d\n", pl[j].b->core.pos+1, max1_i, max2_i, s1, s2); + if (s1 > s2) ret->gl[0] += s1 - s2 < mi->q_indel? s1 - s2 : mi->q_indel; + else ret->gl[1] += s2 - s1 < mi->q_indel? s2 - s1 : mi->q_indel; + } + // write cnt_ref and cnt_ambi + if (max1_i != 0 && max2_i != 0) { + for (j = 0; j < n; ++j) { + int diff1 = score[j] - score[max1_i * n + j]; + int diff2 = score[j] - score[max2_i * n + j]; + if (diff1 > 0 && diff2 > 0) ++ret->cnt_ref; + else if (diff1 == 0 || diff2 == 0) ++ret->cnt_ambi; + } + } + } + free(score); free(pscore); free(ref2); free(inscns); + } + { // call genotype + int q[3], qr_indel = (int)(-4.343 * log(mi->r_indel) + 0.5); + int min1, min2, min1_i; + q[0] = ret->gl[0] + (ret->s[0][0] != '*'? 0 : 0) * qr_indel; + q[1] = ret->gl[1] + (ret->s[1][0] != '*'? 0 : 0) * qr_indel; + q[2] = n * 3 + (ret->s[0][0] == '*' || ret->s[1][0] == '*'? 1 : 1) * qr_indel; + min1 = min2 = 0x7fffffff; min1_i = -1; + for (i = 0; i < 3; ++i) { + if (q[i] < min1) { + min2 = min1; min1 = q[i]; min1_i = i; + } else if (q[i] < min2) min2 = q[i]; + } + ret->gt = min1_i; + ret->q_cns = min2 - min1; + // set q_ref + if (ret->gt < 2) ret->q_ref = (ret->s[ret->gt][0] == '*')? 0 : q[1-ret->gt] - q[ret->gt] - qr_indel - 3; + else ret->q_ref = (ret->s[0][0] == '*')? q[0] - q[2] : q[1] - q[2]; + if (ret->q_ref < 0) ret->q_ref = 0; + } + free(types); + return ret; +}
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/SNV/SNVMix2_source/SNVMix2-v0.12.1-rc1/samtools-0.1.6/bam_maqcns.h Wed Oct 12 19:50:38 2011 -0400 @@ -0,0 +1,56 @@ +#ifndef BAM_MAQCNS_H +#define BAM_MAQCNS_H + +#include "glf.h" + +struct __bmc_aux_t; + +typedef struct { + float het_rate, theta; + int n_hap, cap_mapQ; + + float eta, q_r; + double *fk, *coef; + double *lhet; + struct __bmc_aux_t *aux; +} bam_maqcns_t; + +typedef struct { + int q_indel; + float r_indel; + // hidden parameters, unchangeable from command line + int mm_penalty, indel_err, ambi_thres; +} bam_maqindel_opt_t; + +typedef struct { + int indel1, indel2; + int cnt1, cnt2, cnt_anti; + int cnt_ref, cnt_ambi; + char *s[2]; + // + int gt, gl[2]; + int q_cns, q_ref; +} bam_maqindel_ret_t; + +#ifdef __cplusplus +extern "C" { +#endif + + bam_maqcns_t *bam_maqcns_init(); + void bam_maqcns_prepare(bam_maqcns_t *bm); + void bam_maqcns_destroy(bam_maqcns_t *bm); + glf1_t *bam_maqcns_glfgen(int n, const bam_pileup1_t *pl, uint8_t ref_base, bam_maqcns_t *bm); + uint32_t bam_maqcns_call(int n, const bam_pileup1_t *pl, bam_maqcns_t *bm); + // return: cns<<28 | cns2<<24 | mapQ<<16 | cnsQ<<8 | cnsQ2 + uint32_t glf2cns(const glf1_t *g, int q_r); + + bam_maqindel_opt_t *bam_maqindel_opt_init(); + bam_maqindel_ret_t *bam_maqindel(int n, int pos, const bam_maqindel_opt_t *mi, const bam_pileup1_t *pl, const char *ref, + int _n_types, int *_types); + void bam_maqindel_ret_destroy(bam_maqindel_ret_t*); + +#ifdef __cplusplus +} +#endif + +#endif
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/SNV/SNVMix2_source/SNVMix2-v0.12.1-rc1/samtools-0.1.6/bam_mate.c Wed Oct 12 19:50:38 2011 -0400 @@ -0,0 +1,70 @@ +#include <stdlib.h> +#include <string.h> +#include "bam.h" + +// currently, this function ONLY works if each read has one hit +void bam_mating_core(bamFile in, bamFile out) +{ + bam_header_t *header; + bam1_t *b[2]; + int curr, has_prev; + + header = bam_header_read(in); + bam_header_write(out, header); + + b[0] = bam_init1(); + b[1] = bam_init1(); + curr = 0; has_prev = 0; + while (bam_read1(in, b[curr]) >= 0) { + bam1_t *cur = b[curr], *pre = b[1-curr]; + if (has_prev) { + if (strcmp(bam1_qname(cur), bam1_qname(pre)) == 0) { // identical pair name + cur->core.mtid = pre->core.tid; cur->core.mpos = pre->core.pos; + pre->core.mtid = cur->core.tid; pre->core.mpos = cur->core.pos; + if (pre->core.tid == cur->core.tid && !(cur->core.flag&(BAM_FUNMAP|BAM_FMUNMAP)) + && !(pre->core.flag&(BAM_FUNMAP|BAM_FMUNMAP))) + { + uint32_t cur5, pre5; + cur5 = (cur->core.flag&BAM_FREVERSE)? bam_calend(&cur->core, bam1_cigar(cur)) : cur->core.pos; + pre5 = (pre->core.flag&BAM_FREVERSE)? bam_calend(&pre->core, bam1_cigar(pre)) : pre->core.pos; + cur->core.isize = pre5 - cur5; pre->core.isize = cur5 - pre5; + } else cur->core.isize = pre->core.isize = 0; + if (pre->core.flag&BAM_FREVERSE) cur->core.flag |= BAM_FMREVERSE; + else cur->core.flag &= ~BAM_FMREVERSE; + if (cur->core.flag&BAM_FREVERSE) pre->core.flag |= BAM_FMREVERSE; + else pre->core.flag &= ~BAM_FMREVERSE; + if (cur->core.flag & BAM_FUNMAP) { pre->core.flag |= BAM_FMUNMAP; pre->core.flag &= ~BAM_FPROPER_PAIR; } + if (pre->core.flag & BAM_FUNMAP) { cur->core.flag |= BAM_FMUNMAP; cur->core.flag &= ~BAM_FPROPER_PAIR; } + bam_write1(out, pre); + bam_write1(out, cur); + has_prev = 0; + } else { // unpaired or singleton + pre->core.mtid = -1; pre->core.mpos = -1; pre->core.isize = 0; + if (pre->core.flag & BAM_FPAIRED) { + pre->core.flag |= BAM_FMUNMAP; + pre->core.flag &= ~BAM_FMREVERSE & ~BAM_FPROPER_PAIR; + } + bam_write1(out, pre); + } + } else has_prev = 1; + curr = 1 - curr; + } + if (has_prev) bam_write1(out, b[1-curr]); + bam_header_destroy(header); + bam_destroy1(b[0]); + bam_destroy1(b[1]); +} + +int bam_mating(int argc, char *argv[]) +{ + bamFile in, out; + if (argc < 3) { + fprintf(stderr, "samtools fixmate <in.nameSrt.bam> <out.nameSrt.bam>\n"); + return 1; + } + in = (strcmp(argv[1], "-") == 0)? bam_dopen(fileno(stdin), "r") : bam_open(argv[1], "r"); + out = (strcmp(argv[2], "-") == 0)? bam_dopen(fileno(stdout), "w") : bam_open(argv[2], "w"); + bam_mating_core(in, out); + bam_close(in); bam_close(out); + return 0; +}
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/SNV/SNVMix2_source/SNVMix2-v0.12.1-rc1/samtools-0.1.6/bam_md.c Wed Oct 12 19:50:38 2011 -0400 @@ -0,0 +1,146 @@ +#include <unistd.h> +#include <assert.h> +#include <string.h> +#include <ctype.h> +#include "faidx.h" +#include "sam.h" +#include "kstring.h" + +void bam_fillmd1(bam1_t *b, char *ref, int is_equal) +{ + uint8_t *seq = bam1_seq(b); + uint32_t *cigar = bam1_cigar(b); + bam1_core_t *c = &b->core; + int i, x, y, u = 0; + kstring_t *str; + uint8_t *old_md, *old_nm; + int32_t old_nm_i = -1, nm = 0; + + str = (kstring_t*)calloc(1, sizeof(kstring_t)); + for (i = y = 0, x = c->pos; i < c->n_cigar; ++i) { + int j, l = cigar[i]>>4, op = cigar[i]&0xf; + if (op == BAM_CMATCH) { + for (j = 0; j < l; ++j) { + int z = y + j; + int c1 = bam1_seqi(seq, z), c2 = bam_nt16_table[(int)ref[x+j]]; + if (ref[x+j] == 0) break; // out of boundary + if ((c1 == c2 && c1 != 15 && c2 != 15) || c1 == 0) { // a match + if (is_equal) seq[z/2] &= (z&1)? 0xf0 : 0x0f; + ++u; + } else { + ksprintf(str, "%d", u); + kputc(ref[x+j], str); + u = 0; ++nm; + } + } + if (j < l) break; + x += l; y += l; + } else if (op == BAM_CDEL) { + ksprintf(str, "%d", u); + kputc('^', str); + for (j = 0; j < l; ++j) { + if (ref[x+j] == 0) break; + kputc(ref[x+j], str); + } + u = 0; + if (j < l) break; + x += l; nm += l; + } else if (op == BAM_CINS || op == BAM_CSOFT_CLIP) { + y += l; + if (op == BAM_CINS) nm += l; + } else if (op == BAM_CREF_SKIP) { + x += l; + } + } + ksprintf(str, "%d", u); + // update NM + old_nm = bam_aux_get(b, "NM"); + if (c->flag & BAM_FUNMAP) return; + if (old_nm) old_nm_i = bam_aux2i(old_nm); + if (!old_nm) bam_aux_append(b, "NM", 'i', 4, (uint8_t*)&nm); + else if (nm != old_nm_i) { + fprintf(stderr, "[bam_fillmd1] different NM for read '%s': %d -> %d\n", bam1_qname(b), old_nm_i, nm); + bam_aux_del(b, old_nm); + bam_aux_append(b, "NM", 'i', 4, (uint8_t*)&nm); + } + // update MD + old_md = bam_aux_get(b, "MD"); + if (!old_md) bam_aux_append(b, "MD", 'Z', str->l + 1, (uint8_t*)str->s); + else { + int is_diff = 0; + if (strlen((char*)old_md+1) == str->l) { + for (i = 0; i < str->l; ++i) + if (toupper(old_md[i+1]) != toupper(str->s[i])) + break; + if (i < str->l) is_diff = 1; + } else is_diff = 1; + if (is_diff) { + fprintf(stderr, "[bam_fillmd1] different MD for read '%s': '%s' -> '%s'\n", bam1_qname(b), old_md+1, str->s); + bam_aux_del(b, old_md); + bam_aux_append(b, "MD", 'Z', str->l + 1, (uint8_t*)str->s); + } + } + free(str->s); free(str); +} + +int bam_fillmd(int argc, char *argv[]) +{ + int c, is_equal = 0, tid = -2, ret, len, is_bam_out, is_sam_in, is_uncompressed; + samfile_t *fp, *fpout = 0; + faidx_t *fai; + char *ref = 0, mode_w[8], mode_r[8]; + bam1_t *b; + + is_bam_out = is_sam_in = is_uncompressed = 0; + mode_w[0] = mode_r[0] = 0; + strcpy(mode_r, "r"); strcpy(mode_w, "w"); + while ((c = getopt(argc, argv, "eubS")) >= 0) { + switch (c) { + case 'e': is_equal = 1; break; + case 'b': is_bam_out = 1; break; + case 'u': is_uncompressed = is_bam_out = 1; break; + case 'S': is_sam_in = 1; break; + default: fprintf(stderr, "[bam_fillmd] unrecognized option '-%c'\n", c); return 1; + } + } + if (!is_sam_in) strcat(mode_r, "b"); + if (is_bam_out) strcat(mode_w, "b"); + else strcat(mode_w, "h"); + if (is_uncompressed) strcat(mode_w, "u"); + if (optind + 1 >= argc) { + fprintf(stderr, "\n"); + fprintf(stderr, "Usage: samtools fillmd [-eubS] <aln.bam> <ref.fasta>\n\n"); + fprintf(stderr, "Options: -e change identical bases to '='\n"); + fprintf(stderr, " -u uncompressed BAM output (for piping)\n"); + fprintf(stderr, " -b compressed BAM output\n"); + fprintf(stderr, " -S the input is SAM with header\n\n"); + return 1; + } + fp = samopen(argv[optind], mode_r, 0); + if (fp == 0) return 1; + if (is_sam_in && (fp->header == 0 || fp->header->n_targets == 0)) { + fprintf(stderr, "[bam_fillmd] input SAM does not have header. Abort!\n"); + return 1; + } + fpout = samopen("-", mode_w, fp->header); + fai = fai_load(argv[optind+1]); + + b = bam_init1(); + while ((ret = samread(fp, b)) >= 0) { + if (b->core.tid >= 0) { + if (tid != b->core.tid) { + free(ref); + ref = fai_fetch(fai, fp->header->target_name[b->core.tid], &len); + tid = b->core.tid; + } + bam_fillmd1(b, ref, is_equal); + } + samwrite(fpout, b); + } + bam_destroy1(b); + + free(ref); + fai_destroy(fai); + samclose(fp); samclose(fpout); + return 0; +}
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/SNV/SNVMix2_source/SNVMix2-v0.12.1-rc1/samtools-0.1.6/bam_pileup.c Wed Oct 12 19:50:38 2011 -0400 @@ -0,0 +1,238 @@ +#include <stdio.h> +#include <stdlib.h> +#include <ctype.h> +#include <assert.h> +#include "sam.h" + +typedef struct __linkbuf_t { + bam1_t b; + uint32_t beg, end; + struct __linkbuf_t *next; +} lbnode_t; + +/* --- BEGIN: Memory pool */ + +typedef struct { + int cnt, n, max; + lbnode_t **buf; +} mempool_t; + +static mempool_t *mp_init() +{ + mempool_t *mp; + mp = (mempool_t*)calloc(1, sizeof(mempool_t)); + return mp; +} +static void mp_destroy(mempool_t *mp) +{ + int k; + for (k = 0; k < mp->n; ++k) { + free(mp->buf[k]->b.data); + free(mp->buf[k]); + } + free(mp->buf); + free(mp); +} +static inline lbnode_t *mp_alloc(mempool_t *mp) +{ + ++mp->cnt; + if (mp->n == 0) return (lbnode_t*)calloc(1, sizeof(lbnode_t)); + else return mp->buf[--mp->n]; +} +static inline void mp_free(mempool_t *mp, lbnode_t *p) +{ + --mp->cnt; p->next = 0; // clear lbnode_t::next here + if (mp->n == mp->max) { + mp->max = mp->max? mp->max<<1 : 256; + mp->buf = (lbnode_t**)realloc(mp->buf, sizeof(lbnode_t*) * mp->max); + } + mp->buf[mp->n++] = p; +} + +/* --- END: Memory pool */ + +/* --- BEGIN: Auxiliary functions */ + +static inline int resolve_cigar(bam_pileup1_t *p, uint32_t pos) +{ + unsigned k; + bam1_t *b = p->b; + bam1_core_t *c = &b->core; + uint32_t x = c->pos, y = 0; + int ret = 1, is_restart = 1; + + if (c->flag&BAM_FUNMAP) return 0; // unmapped read + assert(x <= pos); // otherwise a bug + p->qpos = -1; p->indel = 0; p->is_del = p->is_head = p->is_tail = 0; + for (k = 0; k < c->n_cigar; ++k) { + int op = bam1_cigar(b)[k] & BAM_CIGAR_MASK; // operation + int l = bam1_cigar(b)[k] >> BAM_CIGAR_SHIFT; // length + if (op == BAM_CMATCH) { // NOTE: this assumes the first and the last operation MUST BE a match or a clip + if (x + l > pos) { // overlap with pos + p->indel = p->is_del = 0; + p->qpos = y + (pos - x); + if (x == pos && is_restart) p->is_head = 1; + if (x + l - 1 == pos) { // come to the end of a match + if (k < c->n_cigar - 1) { // there are additional operation(s) + uint32_t cigar = bam1_cigar(b)[k+1]; // next CIGAR + int op_next = cigar&BAM_CIGAR_MASK; // next CIGAR operation + if (op_next == BAM_CDEL) p->indel = -(int32_t)(cigar>>BAM_CIGAR_SHIFT); // del + else if (op_next == BAM_CINS) p->indel = cigar>>BAM_CIGAR_SHIFT; // ins + if (op_next == BAM_CDEL || op_next == BAM_CINS) { + if (k + 2 < c->n_cigar) op_next = bam1_cigar(b)[k+2]&BAM_CIGAR_MASK; + else p->is_tail = 1; + } + if (op_next == BAM_CSOFT_CLIP || op_next == BAM_CREF_SKIP || op_next == BAM_CHARD_CLIP) + p->is_tail = 1; // tail + } else p->is_tail = 1; // this is the last operation; set tail + } + } + x += l; y += l; + } else if (op == BAM_CDEL) { // then set ->is_del + if (x + l > pos) { + p->indel = 0; p->is_del = 1; + p->qpos = y + (pos - x); + } + x += l; + } else if (op == BAM_CREF_SKIP) x += l; + else if (op == BAM_CINS || op == BAM_CSOFT_CLIP) y += l; + is_restart = (op == BAM_CREF_SKIP || op == BAM_CSOFT_CLIP || op == BAM_CHARD_CLIP); + if (x > pos) { + if (op == BAM_CREF_SKIP) ret = 0; // then do not put it into pileup at all + break; + } + } + assert(x > pos); // otherwise a bug + return ret; +} + +/* --- END: Auxiliary functions */ + +struct __bam_plbuf_t { + mempool_t *mp; + lbnode_t *head, *tail, *dummy; + bam_pileup_f func; + void *func_data; + int32_t tid, pos, max_tid, max_pos; + int max_pu, is_eof; + bam_pileup1_t *pu; + int flag_mask; +}; + +void bam_plbuf_reset(bam_plbuf_t *buf) +{ + lbnode_t *p, *q; + buf->max_tid = buf->max_pos = -1; + buf->tid = buf->pos = 0; + buf->is_eof = 0; + for (p = buf->head; p->next;) { + q = p->next; + mp_free(buf->mp, p); + p = q; + } + buf->head = buf->tail; +} + +void bam_plbuf_set_mask(bam_plbuf_t *buf, int mask) +{ + if (mask < 0) buf->flag_mask = BAM_DEF_MASK; + else buf->flag_mask = BAM_FUNMAP | mask; +} + +bam_plbuf_t *bam_plbuf_init(bam_pileup_f func, void *data) +{ + bam_plbuf_t *buf; + buf = (bam_plbuf_t*)calloc(1, sizeof(bam_plbuf_t)); + buf->func = func; buf->func_data = data; + buf->mp = mp_init(); + buf->head = buf->tail = mp_alloc(buf->mp); + buf->dummy = mp_alloc(buf->mp); + buf->max_tid = buf->max_pos = -1; + buf->flag_mask = BAM_DEF_MASK; + return buf; +} + +void bam_plbuf_destroy(bam_plbuf_t *buf) +{ + mp_free(buf->mp, buf->dummy); + mp_free(buf->mp, buf->head); + if (buf->mp->cnt != 0) + fprintf(stderr, "[bam_plbuf_destroy] memory leak: %d. Continue anyway.\n", buf->mp->cnt); + mp_destroy(buf->mp); + free(buf->pu); + free(buf); +} + +int bam_plbuf_push(const bam1_t *b, bam_plbuf_t *buf) +{ + if (b) { // fill buffer + if (b->core.tid < 0) return 0; + if (b->core.flag & buf->flag_mask) return 0; + bam_copy1(&buf->tail->b, b); + buf->tail->beg = b->core.pos; buf->tail->end = bam_calend(&b->core, bam1_cigar(b)); + if (b->core.tid < buf->max_tid) { + fprintf(stderr, "[bam_pileup_core] the input is not sorted (chromosomes out of order)\n"); + return -1; + } + if ((b->core.tid == buf->max_tid) && (buf->tail->beg < buf->max_pos)) { + fprintf(stderr, "[bam_pileup_core] the input is not sorted (reads out of order)\n"); + return -1; + } + buf->max_tid = b->core.tid; buf->max_pos = buf->tail->beg; + if (buf->tail->end > buf->pos || buf->tail->b.core.tid > buf->tid) { + buf->tail->next = mp_alloc(buf->mp); + buf->tail = buf->tail->next; + } + } else buf->is_eof = 1; + while (buf->is_eof || buf->max_tid > buf->tid || (buf->max_tid == buf->tid && buf->max_pos > buf->pos)) { + int n_pu = 0; + lbnode_t *p, *q; + buf->dummy->next = buf->head; + for (p = buf->head, q = buf->dummy; p->next; q = p, p = p->next) { + if (p->b.core.tid < buf->tid || (p->b.core.tid == buf->tid && p->end <= buf->pos)) { // then remove from the list + q->next = p->next; mp_free(buf->mp, p); p = q; + } else if (p->b.core.tid == buf->tid && p->beg <= buf->pos) { // here: p->end > pos; then add to pileup + if (n_pu == buf->max_pu) { // then double the capacity + buf->max_pu = buf->max_pu? buf->max_pu<<1 : 256; + buf->pu = (bam_pileup1_t*)realloc(buf->pu, sizeof(bam_pileup1_t) * buf->max_pu); + } + buf->pu[n_pu].b = &p->b; + if (resolve_cigar(buf->pu + n_pu, buf->pos)) ++n_pu; // skip the read if we are looking at BAM_CREF_SKIP + } + } + buf->head = buf->dummy->next; // dummy->next may be changed + if (n_pu) { // then call user defined function + buf->func(buf->tid, buf->pos, n_pu, buf->pu, buf->func_data); + } + // update tid and pos + if (buf->head->next) { + if (buf->tid > buf->head->b.core.tid) { + fprintf(stderr, "[bam_plbuf_push] unsorted input. Pileup aborts.\n"); + return 1; + } + } + if (buf->tid < buf->head->b.core.tid) { // come to a new reference sequence + buf->tid = buf->head->b.core.tid; buf->pos = buf->head->beg; // jump to the next reference + } else if (buf->pos < buf->head->beg) { // here: tid == head->b.core.tid + buf->pos = buf->head->beg; // jump to the next position + } else ++buf->pos; // scan contiguously + if (buf->is_eof && buf->head->next == 0) break; + } + return 0; +} + +int bam_pileup_file(bamFile fp, int mask, bam_pileup_f func, void *func_data) +{ + bam_plbuf_t *buf; + int ret; + bam1_t *b; + b = bam_init1(); + buf = bam_plbuf_init(func, func_data); + bam_plbuf_set_mask(buf, mask); + while ((ret = bam_read1(fp, b)) >= 0) + bam_plbuf_push(b, buf); + bam_plbuf_push(0, buf); + bam_plbuf_destroy(buf); + bam_destroy1(b); + return 0; +}
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/SNV/SNVMix2_source/SNVMix2-v0.12.1-rc1/samtools-0.1.6/bam_plcmd.c Wed Oct 12 19:50:38 2011 -0400 @@ -0,0 +1,388 @@ +#include <math.h> +#include <stdio.h> +#include <unistd.h> +#include <ctype.h> +#include "sam.h" +#include "faidx.h" +#include "bam_maqcns.h" +#include "khash.h" +#include "glf.h" +#include "kstring.h" + +typedef int *indel_list_t; +KHASH_MAP_INIT_INT64(64, indel_list_t) + +#define BAM_PLF_SIMPLE 0x01 +#define BAM_PLF_CNS 0x02 +#define BAM_PLF_INDEL_ONLY 0x04 +#define BAM_PLF_GLF 0x08 +#define BAM_PLF_VAR_ONLY 0x10 +#define BAM_PLF_2ND 0x20 + +typedef struct { + bam_header_t *h; + bam_maqcns_t *c; + bam_maqindel_opt_t *ido; + faidx_t *fai; + khash_t(64) *hash; + uint32_t format; + int tid, len, last_pos; + int mask; + char *ref; + glfFile fp_glf; // for glf output only +} pu_data_t; + +char **__bam_get_lines(const char *fn, int *_n); +void bam_init_header_hash(bam_header_t *header); +int32_t bam_get_tid(const bam_header_t *header, const char *seq_name); + +static khash_t(64) *load_pos(const char *fn, bam_header_t *h) +{ + char **list; + int i, j, n, *fields, max_fields; + khash_t(64) *hash; + bam_init_header_hash(h); + list = __bam_get_lines(fn, &n); + hash = kh_init(64); + max_fields = 0; fields = 0; + for (i = 0; i < n; ++i) { + char *str = list[i]; + int chr, n_fields, ret; + khint_t k; + uint64_t x; + n_fields = ksplit_core(str, 0, &max_fields, &fields); + if (n_fields < 2) continue; + chr = bam_get_tid(h, str + fields[0]); + if (chr < 0) { + fprintf(stderr, "[load_pos] unknown reference sequence name: %s\n", str + fields[0]); + continue; + } + x = (uint64_t)chr << 32 | (atoi(str + fields[1]) - 1); + k = kh_put(64, hash, x, &ret); + if (ret == 0) { + fprintf(stderr, "[load_pos] position %s:%s has been loaded.\n", str+fields[0], str+fields[1]); + continue; + } + kh_val(hash, k) = 0; + if (n_fields > 2) { + // count + for (j = 2; j < n_fields; ++j) { + char *s = str + fields[j]; + if ((*s != '+' && *s != '-') || !isdigit(s[1])) break; + } + if (j > 2) { // update kh_val() + int *q, y, z; + q = kh_val(hash, k) = (int*)calloc(j - 1, sizeof(int)); + q[0] = j - 2; z = j; y = 1; + for (j = 2; j < z; ++j) + q[y++] = atoi(str + fields[j]); + } + } + free(str); + } + free(list); free(fields); + return hash; +} + +// an analogy to pileup_func() below +static int glt3_func(uint32_t tid, uint32_t pos, int n, const bam_pileup1_t *pu, void *data) +{ + pu_data_t *d = (pu_data_t*)data; + bam_maqindel_ret_t *r = 0; + int rb, *proposed_indels = 0; + glf1_t *g; + glf3_t *g3; + + if (d->fai == 0) { + fprintf(stderr, "[glt3_func] reference sequence is required for generating GLT. Abort!\n"); + exit(1); + } + if (d->hash) { // only output a list of sites + khint_t k = kh_get(64, d->hash, (uint64_t)tid<<32|pos); + if (k == kh_end(d->hash)) return 0; + proposed_indels = kh_val(d->hash, k); + } + g3 = glf3_init1(); + if (d->fai && (int)tid != d->tid) { + if (d->ref) { // then write the end mark + g3->rtype = GLF3_RTYPE_END; + glf3_write1(d->fp_glf, g3); + } + glf3_ref_write(d->fp_glf, d->h->target_name[tid], d->h->target_len[tid]); // write reference + free(d->ref); + d->ref = fai_fetch(d->fai, d->h->target_name[tid], &d->len); + d->tid = tid; + d->last_pos = 0; + } + rb = (d->ref && (int)pos < d->len)? d->ref[pos] : 'N'; + g = bam_maqcns_glfgen(n, pu, bam_nt16_table[rb], d->c); + memcpy(g3, g, sizeof(glf1_t)); + g3->rtype = GLF3_RTYPE_SUB; + g3->offset = pos - d->last_pos; + d->last_pos = pos; + glf3_write1(d->fp_glf, g3); + if (proposed_indels) + r = bam_maqindel(n, pos, d->ido, pu, d->ref, proposed_indels[0], proposed_indels+1); + else r = bam_maqindel(n, pos, d->ido, pu, d->ref, 0, 0); + if (r) { // then write indel line + int het = 3 * n, min; + min = het; + if (min > r->gl[0]) min = r->gl[0]; + if (min > r->gl[1]) min = r->gl[1]; + g3->ref_base = 0; + g3->rtype = GLF3_RTYPE_INDEL; + memset(g3->lk, 0, 10); + g3->lk[0] = r->gl[0] - min < 255? r->gl[0] - min : 255; + g3->lk[1] = r->gl[1] - min < 255? r->gl[1] - min : 255; + g3->lk[2] = het - min < 255? het - min : 255; + g3->offset = 0; + g3->indel_len[0] = r->indel1; + g3->indel_len[1] = r->indel2; + g3->min_lk = min < 255? min : 255; + g3->max_len = (abs(r->indel1) > abs(r->indel2)? abs(r->indel1) : abs(r->indel2)) + 1; + g3->indel_seq[0] = strdup(r->s[0]+1); + g3->indel_seq[1] = strdup(r->s[1]+1); + glf3_write1(d->fp_glf, g3); + bam_maqindel_ret_destroy(r); + } + free(g); + glf3_destroy1(g3); + return 0; +} + +static int pileup_func(uint32_t tid, uint32_t pos, int n, const bam_pileup1_t *pu, void *data) +{ + pu_data_t *d = (pu_data_t*)data; + bam_maqindel_ret_t *r = 0; + int i, j, rb, rms_mapq = -1, *proposed_indels = 0; + uint64_t rms_aux; + uint32_t cns = 0; + + // if GLF is required, suppress -c completely + if (d->format & BAM_PLF_GLF) return glt3_func(tid, pos, n, pu, data); + // if d->hash is initialized, only output the sites in the hash table + if (d->hash) { + khint_t k = kh_get(64, d->hash, (uint64_t)tid<<32|pos); + if (k == kh_end(d->hash)) return 0; + proposed_indels = kh_val(d->hash, k); + } + // update d->ref if necessary + if (d->fai && (int)tid != d->tid) { + free(d->ref); + d->ref = fai_fetch(d->fai, d->h->target_name[tid], &d->len); + d->tid = tid; + } + rb = (d->ref && (int)pos < d->len)? d->ref[pos] : 'N'; + // when the indel-only mode is asked for, return if no reads mapped with indels + if (d->format & BAM_PLF_INDEL_ONLY) { + for (i = 0; i < n; ++i) + if (pu[i].indel != 0) break; + if (i == n) return 0; + } + // call the consensus and indel + if (d->format & BAM_PLF_CNS) // call consensus + cns = bam_maqcns_call(n, pu, d->c); + if ((d->format & (BAM_PLF_CNS|BAM_PLF_INDEL_ONLY)) && d->ref) { // call indels + if (proposed_indels) // the first element gives the size of the array + r = bam_maqindel(n, pos, d->ido, pu, d->ref, proposed_indels[0], proposed_indels+1); + else r = bam_maqindel(n, pos, d->ido, pu, d->ref, 0, 0); + } + // when only variant sites are asked for, test if the site is a variant + if ((d->format & BAM_PLF_CNS) && (d->format & BAM_PLF_VAR_ONLY)) { + if (!(bam_nt16_table[rb] != 15 && cns>>28 != bam_nt16_table[rb])) { // not a SNP + if (!(r && (r->gt == 2 || strcmp(r->s[r->gt], "*")))) { // not an indel + if (r) bam_maqindel_ret_destroy(r); + return 0; + } + } + } + // print the first 3 columns + printf("%s\t%d\t%c\t", d->h->target_name[tid], pos + 1, rb); + // print consensus information if required + if (d->format & BAM_PLF_CNS) { + int ref_q, rb4 = bam_nt16_table[rb]; + ref_q = 0; + if (rb4 != 15 && cns>>28 != 15 && cns>>28 != rb4) { // a SNP + ref_q = ((cns>>24&0xf) == rb4)? cns>>8&0xff : (cns>>8&0xff) + (cns&0xff); + if (ref_q > 255) ref_q = 255; + } + rms_mapq = cns>>16&0xff; + printf("%c\t%d\t%d\t%d\t", bam_nt16_rev_table[cns>>28], cns>>8&0xff, ref_q, rms_mapq); + } + // print pileup sequences + printf("%d\t", n); + rms_aux = 0; // we need to recalculate rms_mapq when -c is not flagged on the command line + for (i = 0; i < n; ++i) { + const bam_pileup1_t *p = pu + i; + int tmp = p->b->core.qual < d->c->cap_mapQ? p->b->core.qual : d->c->cap_mapQ; + rms_aux += tmp * tmp; + if (p->is_head) printf("^%c", p->b->core.qual > 93? 126 : p->b->core.qual + 33); + if (!p->is_del) { + int c = bam_nt16_rev_table[bam1_seqi(bam1_seq(p->b), p->qpos)]; + if (c == '=' || toupper(c) == toupper(rb)) c = bam1_strand(p->b)? ',' : '.'; + else c = bam1_strand(p->b)? tolower(c) : toupper(c); + putchar(c); + if (p->indel > 0) { + printf("+%d", p->indel); + for (j = 1; j <= p->indel; ++j) { + c = bam_nt16_rev_table[bam1_seqi(bam1_seq(p->b), p->qpos + j)]; + putchar(bam1_strand(p->b)? tolower(c) : toupper(c)); + } + } else if (p->indel < 0) { + printf("%d", p->indel); + for (j = 1; j <= -p->indel; ++j) { + c = (d->ref && (int)pos+j < d->len)? d->ref[pos+j] : 'N'; + putchar(bam1_strand(p->b)? tolower(c) : toupper(c)); + } + } + } else putchar('*'); + if (p->is_tail) putchar('$'); + } + // finalize rms_mapq + rms_aux = (uint64_t)(sqrt((double)rms_aux / n) + .499); + if (rms_mapq < 0) rms_mapq = rms_aux; + putchar('\t'); + // print quality + for (i = 0; i < n; ++i) { + const bam_pileup1_t *p = pu + i; + int c = bam1_qual(p->b)[p->qpos] + 33; + if (c > 126) c = 126; + putchar(c); + } + if (d->format & BAM_PLF_2ND) { // print 2nd calls and qualities + const unsigned char *q; + putchar('\t'); + for (i = 0; i < n; ++i) { + const bam_pileup1_t *p = pu + i; + q = bam_aux_get(p->b, "E2"); + putchar(q? q[p->qpos + 1] : 'N'); + } + putchar('\t'); + for (i = 0; i < n; ++i) { + const bam_pileup1_t *p = pu + i; + q = bam_aux_get(p->b, "U2"); + putchar(q? q[p->qpos + 1] : '!'); + } + } + // print mapping quality if -s is flagged on the command line + if (d->format & BAM_PLF_SIMPLE) { + putchar('\t'); + for (i = 0; i < n; ++i) { + int c = pu[i].b->core.qual + 33; + if (c > 126) c = 126; + putchar(c); + } + } + putchar('\n'); + // print the indel line if r has been calculated. This only happens if: + // a) -c or -i are flagged, AND b) the reference sequence is available + if (r) { + printf("%s\t%d\t*\t", d->h->target_name[tid], pos + 1); + if (r->gt < 2) printf("%s/%s\t", r->s[r->gt], r->s[r->gt]); + else printf("%s/%s\t", r->s[0], r->s[1]); + printf("%d\t%d\t", r->q_cns, r->q_ref); + printf("%d\t%d\t", rms_mapq, n); + printf("%s\t%s\t", r->s[0], r->s[1]); + //printf("%d\t%d\t", r->gl[0], r->gl[1]); + printf("%d\t%d\t%d\t", r->cnt1, r->cnt2, r->cnt_anti); + printf("%d\t%d\n", r->cnt_ref, r->cnt_ambi); + bam_maqindel_ret_destroy(r); + } + return 0; +} + +int bam_pileup(int argc, char *argv[]) +{ + int c, is_SAM = 0; + char *fn_list = 0, *fn_fa = 0, *fn_pos = 0; + pu_data_t *d = (pu_data_t*)calloc(1, sizeof(pu_data_t)); + d->tid = -1; d->mask = BAM_DEF_MASK; + d->c = bam_maqcns_init(); + d->ido = bam_maqindel_opt_init(); + while ((c = getopt(argc, argv, "st:f:cT:N:r:l:im:gI:G:vM:S2")) >= 0) { + switch (c) { + case 's': d->format |= BAM_PLF_SIMPLE; break; + case 't': fn_list = strdup(optarg); break; + case 'l': fn_pos = strdup(optarg); break; + case 'f': fn_fa = strdup(optarg); break; + case 'T': d->c->theta = atof(optarg); break; + case 'N': d->c->n_hap = atoi(optarg); break; + case 'r': d->c->het_rate = atof(optarg); break; + case 'M': d->c->cap_mapQ = atoi(optarg); break; + case 'c': d->format |= BAM_PLF_CNS; break; + case 'i': d->format |= BAM_PLF_INDEL_ONLY; break; + case 'v': d->format |= BAM_PLF_VAR_ONLY; break; + case 'm': d->mask = strtol(optarg, 0, 0); break; + case 'g': d->format |= BAM_PLF_GLF; break; + case '2': d->format |= BAM_PLF_2ND; break; + case 'I': d->ido->q_indel = atoi(optarg); break; + case 'G': d->ido->r_indel = atof(optarg); break; + case 'S': is_SAM = 1; break; + default: fprintf(stderr, "Unrecognizd option '-%c'.\n", c); return 1; + } + } + if (fn_list) is_SAM = 1; + if (optind == argc) { + fprintf(stderr, "\n"); + fprintf(stderr, "Usage: samtools pileup [options] <in.bam>|<in.sam>\n\n"); + fprintf(stderr, "Option: -s simple (yet incomplete) pileup format\n"); + fprintf(stderr, " -S the input is in SAM\n"); + fprintf(stderr, " -2 output the 2nd best call and quality\n"); + fprintf(stderr, " -i only show lines/consensus with indels\n"); + fprintf(stderr, " -m INT filtering reads with bits in INT [%d]\n", d->mask); + fprintf(stderr, " -M INT cap mapping quality at INT [%d]\n", d->c->cap_mapQ); + fprintf(stderr, " -t FILE list of reference sequences (force -S)\n"); + fprintf(stderr, " -l FILE list of sites at which pileup is output\n"); + fprintf(stderr, " -f FILE reference sequence in the FASTA format\n\n"); + fprintf(stderr, " -c output the maq consensus sequence\n"); + fprintf(stderr, " -v print variants only (for -c)\n"); + fprintf(stderr, " -g output in the GLFv3 format (suppressing -c/-i/-s)\n"); + fprintf(stderr, " -T FLOAT theta in maq consensus calling model (for -c/-g) [%f]\n", d->c->theta); + fprintf(stderr, " -N INT number of haplotypes in the sample (for -c/-g) [%d]\n", d->c->n_hap); + fprintf(stderr, " -r FLOAT prior of a difference between two haplotypes (for -c/-g) [%f]\n", d->c->het_rate); + fprintf(stderr, " -G FLOAT prior of an indel between two haplotypes (for -c/-g) [%f]\n", d->ido->r_indel); + fprintf(stderr, " -I INT phred prob. of an indel in sequencing/prep. (for -c/-g) [%d]\n", d->ido->q_indel); + fprintf(stderr, "\n"); + free(fn_list); free(fn_fa); free(d); + return 1; + } + if (fn_fa) d->fai = fai_load(fn_fa); + if (d->format & (BAM_PLF_CNS|BAM_PLF_GLF)) bam_maqcns_prepare(d->c); // consensus calling + if (d->format & BAM_PLF_GLF) { // for glf output + glf3_header_t *h; + h = glf3_header_init(); + d->fp_glf = bgzf_fdopen(fileno(stdout), "w"); + glf3_header_write(d->fp_glf, h); + glf3_header_destroy(h); + } + if (d->fai == 0 && (d->format & (BAM_PLF_CNS|BAM_PLF_INDEL_ONLY))) + fprintf(stderr, "[bam_pileup] indels will not be called when -f is absent.\n"); + if (fn_fa && is_SAM && fn_list == 0) fn_list = samfaipath(fn_fa); + + { + samfile_t *fp; + fp = is_SAM? samopen(argv[optind], "r", fn_list) : samopen(argv[optind], "rb", 0); + if (fp == 0 || fp->header == 0) { + fprintf(stderr, "[bam_pileup] fail to read the header: non-exisiting file or wrong format.\n"); + return 1; + } + d->h = fp->header; + if (fn_pos) d->hash = load_pos(fn_pos, d->h); + sampileup(fp, d->mask, pileup_func, d); + samclose(fp); // d->h will be destroyed here + } + + // free + if (d->format & BAM_PLF_GLF) bgzf_close(d->fp_glf); + if (fn_pos) { // free the hash table + khint_t k; + for (k = kh_begin(d->hash); k < kh_end(d->hash); ++k) + if (kh_exist(d->hash, k)) free(kh_val(d->hash, k)); + kh_destroy(64, d->hash); + } + free(fn_pos); free(fn_list); free(fn_fa); + if (d->fai) fai_destroy(d->fai); + bam_maqcns_destroy(d->c); + free(d->ido); free(d->ref); free(d); + return 0; +}
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/SNV/SNVMix2_source/SNVMix2-v0.12.1-rc1/samtools-0.1.6/bam_rmdup.c Wed Oct 12 19:50:38 2011 -0400 @@ -0,0 +1,145 @@ +#include <stdlib.h> +#include <string.h> +#include <stdio.h> +#include <zlib.h> +#include "bam.h" + +typedef bam1_t *bam1_p; +#include "khash.h" +KHASH_SET_INIT_STR(name) +KHASH_MAP_INIT_INT64(pos, bam1_p) + +#define BUFFER_SIZE 0x40000 + +typedef struct { + int n, max; + bam1_t **a; +} tmp_stack_t; + +static inline void stack_insert(tmp_stack_t *stack, bam1_t *b) +{ + if (stack->n == stack->max) { + stack->max = stack->max? stack->max<<1 : 0x10000; + stack->a = (bam1_t**)realloc(stack->a, sizeof(bam1_t*) * stack->max); + } + stack->a[stack->n++] = b; +} + +static inline void dump_best(tmp_stack_t *stack, khash_t(pos) *best_hash, bamFile out) +{ + int i; + for (i = 0; i != stack->n; ++i) { + bam_write1(out, stack->a[i]); + bam_destroy1(stack->a[i]); + } + stack->n = 0; + if (kh_size(best_hash) > BUFFER_SIZE) kh_clear(pos, best_hash); +} + +static void clear_del_set(khash_t(name) *del_set) +{ + khint_t k; + for (k = kh_begin(del_set); k < kh_end(del_set); ++k) + if (kh_exist(del_set, k)) + free((char*)kh_key(del_set, k)); + kh_clear(name, del_set); +} + +void bam_rmdup_core(bamFile in, bamFile out) +{ + bam_header_t *header; + bam1_t *b; + int last_tid = -1, last_pos = -1; + uint64_t n_checked = 0, n_removed = 0; + tmp_stack_t stack; + khint_t k; + khash_t(pos) *best_hash; + khash_t(name) *del_set; + + best_hash = kh_init(pos); + del_set = kh_init(name); + b = bam_init1(); + memset(&stack, 0, sizeof(tmp_stack_t)); + header = bam_header_read(in); + bam_header_write(out, header); + + kh_resize(name, del_set, 4 * BUFFER_SIZE); + kh_resize(pos, best_hash, 3 * BUFFER_SIZE); + while (bam_read1(in, b) >= 0) { + bam1_core_t *c = &b->core; + if (c->tid != last_tid || last_pos != c->pos) { + dump_best(&stack, best_hash, out); // write the result + if (c->tid != last_tid) { + kh_clear(pos, best_hash); + if (kh_size(del_set)) { // check + fprintf(stderr, "[bam_rmdup_core] %llu unmatched pairs\n", (long long)kh_size(del_set)); + clear_del_set(del_set); + } + if ((int)c->tid == -1) { // append unmapped reads + bam_write1(out, b); + while (bam_read1(in, b) >= 0) bam_write1(out, b); + break; + } + last_tid = c->tid; + fprintf(stderr, "[bam_rmdup_core] processing reference %s...\n", header->target_name[c->tid]); + } + } + if (!(c->flag&BAM_FPAIRED) || (c->flag&(BAM_FUNMAP|BAM_FMUNMAP)) || (c->mtid >= 0 && c->tid != c->mtid)) { + bam_write1(out, b); + } else if (c->isize > 0) { // paired, head + uint64_t key = (uint64_t)c->pos<<32 | c->isize; + int ret; + ++n_checked; + k = kh_put(pos, best_hash, key, &ret); + if (ret == 0) { // found in best_hash + bam1_t *p = kh_val(best_hash, k); + ++n_removed; + if (p->core.qual < c->qual) { // the current alignment is better + kh_put(name, del_set, strdup(bam1_qname(p)), &ret); // p will be removed + bam_copy1(p, b); // replaced as b + } else kh_put(name, del_set, strdup(bam1_qname(b)), &ret); // b will be removed + if (ret == 0) + fprintf(stderr, "[bam_rmdup_core] inconsistent BAM file for pair '%s'. Continue anyway.\n", bam1_qname(b)); + } else { // not found in best_hash + kh_val(best_hash, k) = bam_dup1(b); + stack_insert(&stack, kh_val(best_hash, k)); + } + } else { // paired, tail + k = kh_get(name, del_set, bam1_qname(b)); + if (k != kh_end(del_set)) { + free((char*)kh_key(del_set, k)); + kh_del(name, del_set, k); + } else bam_write1(out, b); + } + last_pos = c->pos; + } + dump_best(&stack, best_hash, out); + + bam_header_destroy(header); + clear_del_set(del_set); + kh_destroy(name, del_set); + kh_destroy(pos, best_hash); + free(stack.a); + bam_destroy1(b); + fprintf(stderr, "[bam_rmdup_core] %lld / %lld = %.4lf\n", (long long)n_removed, (long long)n_checked, + (double)n_removed/n_checked); +} +int bam_rmdup(int argc, char *argv[]) +{ + bamFile in, out; + if (argc < 3) { + fprintf(stderr, "Usage: samtools rmdup <input.srt.bam> <output.bam>\n\n"); + fprintf(stderr, "Note: Picard is recommended for this task.\n"); + return 1; + } + in = (strcmp(argv[1], "-") == 0)? bam_dopen(fileno(stdin), "r") : bam_open(argv[1], "r"); + out = (strcmp(argv[2], "-") == 0)? bam_dopen(fileno(stdout), "w") : bam_open(argv[2], "w"); + if (in == 0 || out == 0) { + fprintf(stderr, "[bam_rmdup] fail to read/write input files\n"); + return 1; + } + bam_rmdup_core(in, out); + bam_close(in); + bam_close(out); + return 0; +}
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/SNV/SNVMix2_source/SNVMix2-v0.12.1-rc1/samtools-0.1.6/bam_rmdupse.c Wed Oct 12 19:50:38 2011 -0400 @@ -0,0 +1,178 @@ +#include <math.h> +#include "sam.h" +#include "khash.h" + +typedef struct { + int n, m; + int *a; +} listelem_t; + +KHASH_MAP_INIT_INT(32, listelem_t) + +#define BLOCK_SIZE 65536 + +typedef struct { + bam1_t *b; + int rpos, score; +} elem_t; + +typedef struct { + int n, max, x; + elem_t *buf; +} buffer_t; + +static int fill_buf(samfile_t *in, buffer_t *buf) +{ + int i, ret, last_tid, min_rpos = 0x7fffffff, capacity; + bam1_t *b = bam_init1(); + bam1_core_t *c = &b->core; + // squeeze out the empty cells at the beginning + for (i = 0; i < buf->n; ++i) + if (buf->buf[i].b) break; + if (i < buf->n) { // squeeze + if (i > 0) { + memmove(buf->buf, buf->buf + i, sizeof(elem_t) * (buf->n - i)); + buf->n = buf->n - i; + } + } else buf->n = 0; + // calculate min_rpos + for (i = 0; i < buf->n; ++i) { + elem_t *e = buf->buf + i; + if (e->b && e->rpos >= 0 && e->rpos < min_rpos) + min_rpos = buf->buf[i].rpos; + } + // fill the buffer + buf->x = -1; + last_tid = buf->n? buf->buf[0].b->core.tid : -1; + capacity = buf->n + BLOCK_SIZE; + while ((ret = samread(in, b)) >= 0) { + elem_t *e; + uint8_t *qual = bam1_qual(b); + int is_mapped; + if (last_tid < 0) last_tid = c->tid; + if (c->tid != last_tid) { + if (buf->x < 0) buf->x = buf->n; + } + if (buf->n >= buf->max) { // enlarge + buf->max = buf->max? buf->max<<1 : 8; + buf->buf = (elem_t*)realloc(buf->buf, sizeof(elem_t) * buf->max); + } + e = &buf->buf[buf->n++]; + e->b = bam_dup1(b); + e->rpos = -1; e->score = 0; + for (i = 0; i < c->l_qseq; ++i) e->score += qual[i] + 1; + e->score = (double)e->score / sqrt(c->l_qseq + 1); + is_mapped = (c->tid < 0 || c->tid >= in->header->n_targets || (c->flag&BAM_FUNMAP))? 0 : 1; + if (!is_mapped) e->score = -1; + if (is_mapped && (c->flag & BAM_FREVERSE)) { + e->rpos = b->core.pos + bam_calend(&b->core, bam1_cigar(b)); + if (min_rpos > e->rpos) min_rpos = e->rpos; + } + if (buf->n >= capacity) { + if (is_mapped && c->pos <= min_rpos) capacity += BLOCK_SIZE; + else break; + } + } + if (ret >= 0 && buf->x < 0) buf->x = buf->n; + bam_destroy1(b); + return buf->n; +} + +static void rmdupse_buf(buffer_t *buf) +{ + khash_t(32) *h; + uint32_t key; + khint_t k; + int mpos, i, upper; + listelem_t *p; + mpos = 0x7fffffff; + mpos = (buf->x == buf->n)? buf->buf[buf->x-1].b->core.pos : 0x7fffffff; + upper = (buf->x < 0)? buf->n : buf->x; + // fill the hash table + h = kh_init(32); + for (i = 0; i < upper; ++i) { + elem_t *e = buf->buf + i; + int ret; + if (e->score < 0) continue; + if (e->rpos >= 0) { + if (e->rpos <= mpos) key = (uint32_t)e->rpos<<1 | 1; + else continue; + } else { + if (e->b->core.pos < mpos) key = (uint32_t)e->b->core.pos<<1; + else continue; + } + k = kh_put(32, h, key, &ret); + p = &kh_val(h, k); + if (ret == 0) { // present in the hash table + if (p->n == p->m) { + p->m <<= 1; + p->a = (int*)realloc(p->a, p->m * sizeof(int)); + } + p->a[p->n++] = i; + } else { + p->m = p->n = 1; + p->a = (int*)calloc(p->m, sizeof(int)); + p->a[0] = i; + } + } + // rmdup + for (k = kh_begin(h); k < kh_end(h); ++k) { + if (kh_exist(h, k)) { + int max, maxi; + p = &kh_val(h, k); + // get the max + for (i = max = 0, maxi = -1; i < p->n; ++i) { + if (buf->buf[p->a[i]].score > max) { + max = buf->buf[p->a[i]].score; + maxi = i; + } + } + // mark the elements + for (i = 0; i < p->n; ++i) { + buf->buf[p->a[i]].score = -1; + if (i != maxi) { + bam_destroy1(buf->buf[p->a[i]].b); + buf->buf[p->a[i]].b = 0; + } + } + // free + free(p->a); + } + } + kh_destroy(32, h); +} + +static void dump_buf(buffer_t *buf, samfile_t *out) +{ + int i; + for (i = 0; i < buf->n; ++i) { + elem_t *e = buf->buf + i; + if (e->score != -1) break; + if (e->b) { + samwrite(out, e->b); + bam_destroy1(e->b); + e->b = 0; + } + } +} + +int bam_rmdupse(int argc, char *argv[]) +{ + samfile_t *in, *out; + buffer_t *buf; + if (argc < 3) { + fprintf(stderr, "Usage: samtools rmdupse <in.bam> <out.bam>\n\n"); + fprintf(stderr, "Note: Picard is recommended for this task.\n"); + return 1; + } + buf = calloc(1, sizeof(buffer_t)); + in = samopen(argv[1], "rb", 0); + out = samopen(argv[2], "wb", in->header); + while (fill_buf(in, buf)) { + rmdupse_buf(buf); + dump_buf(buf, out); + } + samclose(in); samclose(out); + free(buf->buf); free(buf); + return 0; +}
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/SNV/SNVMix2_source/SNVMix2-v0.12.1-rc1/samtools-0.1.6/bam_sort.c Wed Oct 12 19:50:38 2011 -0400 @@ -0,0 +1,302 @@ +#include <stdlib.h> +#include <ctype.h> +#include <assert.h> +#include <stdio.h> +#include <string.h> +#include <unistd.h> +#include "bam.h" +#include "ksort.h" + +static int g_is_by_qname = 0; + +static inline int strnum_cmp(const char *a, const char *b) +{ + char *pa, *pb; + pa = (char*)a; pb = (char*)b; + while (*pa && *pb) { + if (isdigit(*pa) && isdigit(*pb)) { + long ai, bi; + ai = strtol(pa, &pa, 10); + bi = strtol(pb, &pb, 10); + if (ai != bi) return ai<bi? -1 : ai>bi? 1 : 0; + } else { + if (*pa != *pb) break; + ++pa; ++pb; + } + } + if (*pa == *pb) + return (pa-a) < (pb-b)? -1 : (pa-a) > (pb-b)? 1 : 0; + return *pa<*pb? -1 : *pa>*pb? 1 : 0; +} + +#define HEAP_EMPTY 0xffffffffffffffffull + +typedef struct { + int i; + uint64_t pos; + bam1_t *b; +} heap1_t; + +static inline int heap_lt(const heap1_t a, const heap1_t b) +{ + if (g_is_by_qname) { + int t; + if (a.b == 0 || b.b == 0) return a.b == 0? 1 : 0; + t = strnum_cmp(bam1_qname(a.b), bam1_qname(b.b)); + return (t > 0 || (t == 0 && a.pos > b.pos)); + } else return (a.pos > b.pos); +} + +KSORT_INIT(heap, heap1_t, heap_lt) + +static void swap_header_text(bam_header_t *h1, bam_header_t *h2) +{ + int tempi; + char *temps; + tempi = h1->l_text, h1->l_text = h2->l_text, h2->l_text = tempi; + temps = h1->text, h1->text = h2->text, h2->text = temps; +} + +/*! + @abstract Merge multiple sorted BAM. + @param is_by_qname whether to sort by query name + @param out output BAM file name + @param headers name of SAM file from which to copy '@' header lines, + or NULL to copy them from the first file to be merged + @param n number of files to be merged + @param fn names of files to be merged + + @discussion Padding information may NOT correctly maintained. This + function is NOT thread safe. + */ +void bam_merge_core(int by_qname, const char *out, const char *headers, int n, char * const *fn) +{ + bamFile fpout, *fp; + heap1_t *heap; + bam_header_t *hout = 0; + bam_header_t *hheaders = NULL; + int i, j; + + if (headers) { + tamFile fpheaders = sam_open(headers); + if (fpheaders == 0) { + fprintf(stderr, "[bam_merge_core] Cannot open file `%s'. Continue anyway.\n", headers); + } else { + hheaders = sam_header_read(fpheaders); + sam_close(fpheaders); + } + } + + g_is_by_qname = by_qname; + fp = (bamFile*)calloc(n, sizeof(bamFile)); + heap = (heap1_t*)calloc(n, sizeof(heap1_t)); + for (i = 0; i != n; ++i) { + heap1_t *h; + bam_header_t *hin; + assert(fp[i] = bam_open(fn[i], "r")); + hin = bam_header_read(fp[i]); + if (i == 0) { // the first SAM + hout = hin; + if (hheaders) { + // If the text headers to be swapped in include any @SQ headers, + // check that they are consistent with the existing binary list + // of reference information. + if (hheaders->n_targets > 0) { + if (hout->n_targets != hheaders->n_targets) + fprintf(stderr, "[bam_merge_core] number of @SQ headers in `%s' differs from number of target sequences", headers); + for (j = 0; j < hout->n_targets; ++j) + if (strcmp(hout->target_name[j], hheaders->target_name[j]) != 0) + fprintf(stderr, "[bam_merge_core] @SQ header '%s' in '%s' differs from target sequence", hheaders->target_name[j], headers); + } + swap_header_text(hout, hheaders); + bam_header_destroy(hheaders); + hheaders = NULL; + } + } else { // validate multiple baf + if (hout->n_targets != hin->n_targets) { + fprintf(stderr, "[bam_merge_core] file '%s' has different number of target sequences. Abort!\n", fn[i]); + exit(1); + } + for (j = 0; j < hout->n_targets; ++j) { + if (strcmp(hout->target_name[j], hin->target_name[j])) { + fprintf(stderr, "[bam_merge_core] different target sequence name: '%s' != '%s' in file '%s'. Abort!\n", + hout->target_name[j], hin->target_name[j], fn[i]); + exit(1); + } + } + bam_header_destroy(hin); + } + h = heap + i; + h->i = i; + h->b = (bam1_t*)calloc(1, sizeof(bam1_t)); + if (bam_read1(fp[i], h->b) >= 0) + h->pos = ((uint64_t)h->b->core.tid<<32) | (uint32_t)h->b->core.pos<<1 | bam1_strand(h->b); + else h->pos = HEAP_EMPTY; + } + fpout = strcmp(out, "-")? bam_open(out, "w") : bam_dopen(fileno(stdout), "w"); + assert(fpout); + bam_header_write(fpout, hout); + bam_header_destroy(hout); + + ks_heapmake(heap, n, heap); + while (heap->pos != HEAP_EMPTY) { + bam1_t *b = heap->b; + bam_write1_core(fpout, &b->core, b->data_len, b->data); + if ((j = bam_read1(fp[heap->i], b)) >= 0) { + heap->pos = ((uint64_t)b->core.tid<<32) | (uint32_t)b->core.pos<<1 | bam1_strand(b); + } else if (j == -1) { + heap->pos = HEAP_EMPTY; + free(heap->b->data); free(heap->b); + heap->b = 0; + } else fprintf(stderr, "[bam_merge_core] '%s' is truncated. Continue anyway.\n", fn[heap->i]); + ks_heapadjust(heap, 0, n, heap); + } + + for (i = 0; i != n; ++i) bam_close(fp[i]); + bam_close(fpout); + free(fp); free(heap); +} +int bam_merge(int argc, char *argv[]) +{ + int c, is_by_qname = 0; + char *fn_headers = NULL; + + while ((c = getopt(argc, argv, "h:n")) >= 0) { + switch (c) { + case 'h': fn_headers = strdup(optarg); break; + case 'n': is_by_qname = 1; break; + } + } + if (optind + 2 >= argc) { + fprintf(stderr, "\n"); + fprintf(stderr, "Usage: samtools merge [-n] [-h inh.sam] <out.bam> <in1.bam> <in2.bam> [...]\n\n"); + fprintf(stderr, "Options: -n sort by read names\n"); + fprintf(stderr, " -h FILE copy the header in FILE to <out.bam> [in1.bam]\n\n"); + fprintf(stderr, "Note: Samtools' merge does not reconstruct the @RG dictionary in the header. Users\n"); + fprintf(stderr, " must provide the correct header with -h, or uses Picard which properly maintains\n"); + fprintf(stderr, " the header dictionary in merging.\n\n"); + return 1; + } + bam_merge_core(is_by_qname, argv[optind], fn_headers, argc - optind - 1, argv + optind + 1); + free(fn_headers); + return 0; +} + +typedef bam1_t *bam1_p; + +static inline int bam1_lt(const bam1_p a, const bam1_p b) +{ + if (g_is_by_qname) { + int t = strnum_cmp(bam1_qname(a), bam1_qname(b)); + return (t < 0 || (t == 0 && (((uint64_t)a->core.tid<<32|a->core.pos) < ((uint64_t)b->core.tid<<32|b->core.pos)))); + } else return (((uint64_t)a->core.tid<<32|a->core.pos) < ((uint64_t)b->core.tid<<32|b->core.pos)); +} +KSORT_INIT(sort, bam1_p, bam1_lt) + +static void sort_blocks(int n, int k, bam1_p *buf, const char *prefix, const bam_header_t *h) +{ + char *name; + int i; + bamFile fp; + ks_mergesort(sort, k, buf, 0); + name = (char*)calloc(strlen(prefix) + 20, 1); + if (n >= 0) sprintf(name, "%s.%.4d.bam", prefix, n); + else sprintf(name, "%s.bam", prefix); + assert(fp = bam_open(name, "w")); + free(name); + bam_header_write(fp, h); + for (i = 0; i < k; ++i) + bam_write1_core(fp, &buf[i]->core, buf[i]->data_len, buf[i]->data); + bam_close(fp); +} + +/*! + @abstract Sort an unsorted BAM file based on the chromosome order + and the leftmost position of an alignment + + @param is_by_qname whether to sort by query name + @param fn name of the file to be sorted + @param prefix prefix of the output and the temporary files; upon + sucessess, prefix.bam will be written. + @param max_mem approxiate maximum memory (very inaccurate) + + @discussion It may create multiple temporary subalignment files + and then merge them by calling bam_merge_core(). This function is + NOT thread safe. + */ +void bam_sort_core(int is_by_qname, const char *fn, const char *prefix, size_t max_mem) +{ + int n, ret, k, i; + size_t mem; + bam_header_t *header; + bamFile fp; + bam1_t *b, **buf; + + g_is_by_qname = is_by_qname; + n = k = 0; mem = 0; + fp = strcmp(fn, "-")? bam_open(fn, "r") : bam_dopen(fileno(stdin), "r"); + assert(fp); + header = bam_header_read(fp); + buf = (bam1_t**)calloc(max_mem / BAM_CORE_SIZE, sizeof(bam1_t*)); + // write sub files + for (;;) { + if (buf[k] == 0) buf[k] = (bam1_t*)calloc(1, sizeof(bam1_t)); + b = buf[k]; + if ((ret = bam_read1(fp, b)) < 0) break; + mem += ret; + ++k; + if (mem >= max_mem) { + sort_blocks(n++, k, buf, prefix, header); + mem = 0; k = 0; + } + } + if (ret != -1) + fprintf(stderr, "[bam_sort_core] truncated file. Continue anyway.\n"); + if (n == 0) sort_blocks(-1, k, buf, prefix, header); + else { // then merge + char **fns, *fnout; + fprintf(stderr, "[bam_sort_core] merging from %d files...\n", n+1); + sort_blocks(n++, k, buf, prefix, header); + fnout = (char*)calloc(strlen(prefix) + 20, 1); + sprintf(fnout, "%s.bam", prefix); + fns = (char**)calloc(n, sizeof(char*)); + for (i = 0; i < n; ++i) { + fns[i] = (char*)calloc(strlen(prefix) + 20, 1); + sprintf(fns[i], "%s.%.4d.bam", prefix, i); + } + bam_merge_core(is_by_qname, fnout, 0, n, fns); + free(fnout); + for (i = 0; i < n; ++i) { + unlink(fns[i]); + free(fns[i]); + } + free(fns); + } + for (k = 0; k < max_mem / BAM_CORE_SIZE; ++k) { + if (buf[k]) { + free(buf[k]->data); + free(buf[k]); + } + } + free(buf); + bam_header_destroy(header); + bam_close(fp); +} + +int bam_sort(int argc, char *argv[]) +{ + size_t max_mem = 500000000; + int c, is_by_qname = 0; + while ((c = getopt(argc, argv, "nm:")) >= 0) { + switch (c) { + case 'n': is_by_qname = 1; break; + case 'm': max_mem = atol(optarg); break; + } + } + if (optind + 2 > argc) { + fprintf(stderr, "Usage: samtools sort [-n] [-m <maxMem>] <in.bam> <out.prefix>\n"); + return 1; + } + bam_sort_core(is_by_qname, argv[optind], argv[optind+1], max_mem); + return 0; +}
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/SNV/SNVMix2_source/SNVMix2-v0.12.1-rc1/samtools-0.1.6/bam_stat.c Wed Oct 12 19:50:38 2011 -0400 @@ -0,0 +1,78 @@ +#include <unistd.h> +#include <assert.h> +#include "bam.h" + +typedef struct { + long long n_reads, n_mapped, n_pair_all, n_pair_map, n_pair_good; + long long n_sgltn, n_read1, n_read2; + long long n_qcfail, n_dup; + long long n_diffchr, n_diffhigh; +} bam_flagstat_t; + +#define flagstat_loop(s, c) do { \ + ++(s)->n_reads; \ + if ((c)->flag & BAM_FPAIRED) { \ + ++(s)->n_pair_all; \ + if ((c)->flag & BAM_FPROPER_PAIR) ++(s)->n_pair_good; \ + if ((c)->flag & BAM_FREAD1) ++(s)->n_read1; \ + if ((c)->flag & BAM_FREAD2) ++(s)->n_read2; \ + if (((c)->flag & BAM_FMUNMAP) && !((c)->flag & BAM_FUNMAP)) ++(s)->n_sgltn; \ + if (!((c)->flag & BAM_FUNMAP) && !((c)->flag & BAM_FMUNMAP)) { \ + ++(s)->n_pair_map; \ + if ((c)->mtid != (c)->tid) { \ + ++(s)->n_diffchr; \ + if ((c)->qual >= 5) ++(s)->n_diffhigh; \ + } \ + } \ + } \ + if (!((c)->flag & BAM_FUNMAP)) ++(s)->n_mapped; \ + if ((c)->flag & BAM_FQCFAIL) ++(s)->n_qcfail; \ + if ((c)->flag & BAM_FDUP) ++(s)->n_dup; \ + } while (0) + +bam_flagstat_t *bam_flagstat_core(bamFile fp) +{ + bam_flagstat_t *s; + bam1_t *b; + bam1_core_t *c; + int ret; + s = (bam_flagstat_t*)calloc(1, sizeof(bam_flagstat_t)); + b = bam_init1(); + c = &b->core; + while ((ret = bam_read1(fp, b)) >= 0) + flagstat_loop(s, c); + bam_destroy1(b); + if (ret != -1) + fprintf(stderr, "[bam_flagstat_core] Truncated file? Continue anyway.\n"); + return s; +} +int bam_flagstat(int argc, char *argv[]) +{ + bamFile fp; + bam_header_t *header; + bam_flagstat_t *s; + if (argc == optind) { + fprintf(stderr, "Usage: samtools flagstat <in.bam>\n"); + return 1; + } + fp = strcmp(argv[optind], "-")? bam_open(argv[optind], "r") : bam_dopen(fileno(stdin), "r"); + assert(fp); + header = bam_header_read(fp); + s = bam_flagstat_core(fp); + printf("%lld in total\n", s->n_reads); + printf("%lld QC failure\n", s->n_qcfail); + printf("%lld duplicates\n", s->n_dup); + printf("%lld mapped (%.2f%%)\n", s->n_mapped, (float)s->n_mapped / s->n_reads * 100.0); + printf("%lld paired in sequencing\n", s->n_pair_all); + printf("%lld read1\n", s->n_read1); + printf("%lld read2\n", s->n_read2); + printf("%lld properly paired (%.2f%%)\n", s->n_pair_good, (float)s->n_pair_good / s->n_pair_all * 100.0); + printf("%lld with itself and mate mapped\n", s->n_pair_map); + printf("%lld singletons (%.2f%%)\n", s->n_sgltn, (float)s->n_sgltn / s->n_pair_all * 100.0); + printf("%lld with mate mapped to a different chr\n", s->n_diffchr); + printf("%lld with mate mapped to a different chr (mapQ>=5)\n", s->n_diffhigh); + free(s); + bam_header_destroy(header); + bam_close(fp); + return 0; +}
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/SNV/SNVMix2_source/SNVMix2-v0.12.1-rc1/samtools-0.1.6/bam_tview.c Wed Oct 12 19:50:38 2011 -0400 @@ -0,0 +1,415 @@ +#undef _HAVE_CURSES + +#if _CURSES_LIB == 0 +#elif _CURSES_LIB == 1 +#include <curses.h> +#ifndef NCURSES_VERSION +#warning "_CURSES_LIB=1 but NCURSES_VERSION not defined; tview is NOT compiled" +#else +#define _HAVE_CURSES +#endif +#elif _CURSES_LIB == 2 +#include <xcurses.h> +#define _HAVE_CURSES +#else +#warning "_CURSES_LIB is not 0, 1 or 2; tview is NOT compiled" +#endif + +#ifdef _HAVE_CURSES +#include <ctype.h> +#include <assert.h> +#include <string.h> +#include "bam.h" +#include "faidx.h" +#include "bam_maqcns.h" + +char bam_aux_getCEi(bam1_t *b, int i); +char bam_aux_getCSi(bam1_t *b, int i); +char bam_aux_getCQi(bam1_t *b, int i); + +#define TV_MIN_ALNROW 2 +#define TV_MAX_GOTO 40 +#define TV_LOW_MAPQ 10 + +#define TV_COLOR_MAPQ 0 +#define TV_COLOR_BASEQ 1 +#define TV_COLOR_NUCL 2 +#define TV_COLOR_COL 3 +#define TV_COLOR_COLQ 4 + +#define TV_BASE_NUCL 0 +#define TV_BASE_COLOR_SPACE 1 + +typedef struct { + int mrow, mcol; + WINDOW *wgoto, *whelp; + + bam_index_t *idx; + bam_lplbuf_t *lplbuf; + bam_header_t *header; + bamFile fp; + int curr_tid, left_pos; + faidx_t *fai; + bam_maqcns_t *bmc; + + int ccol, last_pos, row_shift, base_for, color_for, is_dot, l_ref, ins, no_skip, show_name; + char *ref; +} tview_t; + +int tv_pl_func(uint32_t tid, uint32_t pos, int n, const bam_pileup1_t *pl, void *data) +{ + tview_t *tv = (tview_t*)data; + int i, j, c, rb, attr, max_ins = 0; + uint32_t call = 0; + if (pos < tv->left_pos || tv->ccol > tv->mcol) return 0; // out of screen + // print referece + rb = (tv->ref && pos - tv->left_pos < tv->l_ref)? tv->ref[pos - tv->left_pos] : 'N'; + for (i = tv->last_pos + 1; i < pos; ++i) { + if (i%10 == 0 && tv->mcol - tv->ccol >= 10) mvprintw(0, tv->ccol, "%-d", i+1); + c = tv->ref? tv->ref[i - tv->left_pos] : 'N'; + mvaddch(1, tv->ccol++, c); + } + if (pos%10 == 0 && tv->mcol - tv->ccol >= 10) mvprintw(0, tv->ccol, "%-d", pos+1); + // print consensus + call = bam_maqcns_call(n, pl, tv->bmc); + attr = A_UNDERLINE; + c = ",ACMGRSVTWYHKDBN"[call>>28&0xf]; + i = (call>>8&0xff)/10+1; + if (i > 4) i = 4; + attr |= COLOR_PAIR(i); + if (c == toupper(rb)) c = '.'; + attron(attr); + mvaddch(2, tv->ccol, c); + attroff(attr); + if(tv->ins) { + // calculate maximum insert + for (i = 0; i < n; ++i) { + const bam_pileup1_t *p = pl + i; + if (p->indel > 0 && max_ins < p->indel) max_ins = p->indel; + } + } + // core loop + for (j = 0; j <= max_ins; ++j) { + for (i = 0; i < n; ++i) { + const bam_pileup1_t *p = pl + i; + int row = TV_MIN_ALNROW + p->level - tv->row_shift; + if (j == 0) { + if (!p->is_del) { + if (tv->base_for == TV_BASE_COLOR_SPACE && + (c = bam_aux_getCSi(p->b, p->qpos))) { + c = bam_aux_getCSi(p->b, p->qpos); + // assume that if we found one color, we will be able to get the color error + if (tv->is_dot && '-' == bam_aux_getCEi(p->b, p->qpos)) c = bam1_strand(p->b)? ',' : '.'; + } else { + if (tv->show_name) { + char *name = bam1_qname(p->b); + c = (p->qpos + 1 >= p->b->core.l_qname)? ' ' : name[p->qpos]; + } else { + c = bam_nt16_rev_table[bam1_seqi(bam1_seq(p->b), p->qpos)]; + if (tv->is_dot && toupper(c) == toupper(rb)) c = bam1_strand(p->b)? ',' : '.'; + } + } + } else c = '*'; + } else { // padding + if (j > p->indel) c = '*'; + else { // insertion + if (tv->base_for == TV_BASE_NUCL) { + if (tv->show_name) { + char *name = bam1_qname(p->b); + c = (p->qpos + j + 1 >= p->b->core.l_qname)? ' ' : name[p->qpos + j]; + } else { + c = bam_nt16_rev_table[bam1_seqi(bam1_seq(p->b), p->qpos + j)]; + if (j == 0 && tv->is_dot && toupper(c) == toupper(rb)) c = bam1_strand(p->b)? ',' : '.'; + } + } else { + c = bam_aux_getCSi(p->b, p->qpos + j); + if (tv->is_dot && '-' == bam_aux_getCEi(p->b, p->qpos + j)) c = bam1_strand(p->b)? ',' : '.'; + } + } + } + if (row > TV_MIN_ALNROW && row < tv->mrow) { + int x; + attr = 0; + if (((p->b->core.flag&BAM_FPAIRED) && !(p->b->core.flag&BAM_FPROPER_PAIR)) + || (p->b->core.flag & BAM_FSECONDARY)) attr |= A_UNDERLINE; + if (tv->color_for == TV_COLOR_BASEQ) { + x = bam1_qual(p->b)[p->qpos]/10 + 1; + if (x > 4) x = 4; + attr |= COLOR_PAIR(x); + } else if (tv->color_for == TV_COLOR_MAPQ) { + x = p->b->core.qual/10 + 1; + if (x > 4) x = 4; + attr |= COLOR_PAIR(x); + } else if (tv->color_for == TV_COLOR_NUCL) { + x = bam_nt16_nt4_table[bam1_seqi(bam1_seq(p->b), p->qpos)] + 5; + attr |= COLOR_PAIR(x); + } else if(tv->color_for == TV_COLOR_COL) { + x = 0; + switch(bam_aux_getCSi(p->b, p->qpos)) { + case '0': x = 0; break; + case '1': x = 1; break; + case '2': x = 2; break; + case '3': x = 3; break; + case '4': x = 4; break; + default: x = bam_nt16_nt4_table[bam1_seqi(bam1_seq(p->b), p->qpos)]; break; + } + x+=5; + attr |= COLOR_PAIR(x); + } else if(tv->color_for == TV_COLOR_COLQ) { + x = bam_aux_getCQi(p->b, p->qpos); + if(0 == x) x = bam1_qual(p->b)[p->qpos]; + x = x/10 + 1; + if (x > 4) x = 4; + attr |= COLOR_PAIR(x); + } + attron(attr); + mvaddch(row, tv->ccol, bam1_strand(p->b)? tolower(c) : toupper(c)); + attroff(attr); + } + } + c = j? '*' : rb; + if (c == '*') { + attr = COLOR_PAIR(8); + attron(attr); + mvaddch(1, tv->ccol++, c); + attroff(attr); + } else mvaddch(1, tv->ccol++, c); + } + tv->last_pos = pos; + return 0; +} + +tview_t *tv_init(const char *fn, const char *fn_fa) +{ + tview_t *tv = (tview_t*)calloc(1, sizeof(tview_t)); + tv->is_dot = 1; + tv->idx = bam_index_load(fn); + if (tv->idx == 0) exit(1); + tv->fp = bam_open(fn, "r"); + bgzf_set_cache_size(tv->fp, 8 * 1024 *1024); + assert(tv->fp); + tv->header = bam_header_read(tv->fp); + tv->lplbuf = bam_lplbuf_init(tv_pl_func, tv); + if (fn_fa) tv->fai = fai_load(fn_fa); + tv->bmc = bam_maqcns_init(); + tv->ins = 1; + bam_maqcns_prepare(tv->bmc); + + initscr(); + keypad(stdscr, TRUE); + clear(); + noecho(); + cbreak(); + tv->mrow = 24; tv->mcol = 80; + getmaxyx(stdscr, tv->mrow, tv->mcol); + tv->wgoto = newwin(3, TV_MAX_GOTO + 10, 10, 5); + tv->whelp = newwin(29, 40, 5, 5); + tv->color_for = TV_COLOR_MAPQ; + start_color(); + init_pair(1, COLOR_BLUE, COLOR_BLACK); + init_pair(2, COLOR_GREEN, COLOR_BLACK); + init_pair(3, COLOR_YELLOW, COLOR_BLACK); + init_pair(4, COLOR_WHITE, COLOR_BLACK); + init_pair(5, COLOR_GREEN, COLOR_BLACK); + init_pair(6, COLOR_CYAN, COLOR_BLACK); + init_pair(7, COLOR_YELLOW, COLOR_BLACK); + init_pair(8, COLOR_RED, COLOR_BLACK); + init_pair(9, COLOR_BLUE, COLOR_BLACK); + return tv; +} + +void tv_destroy(tview_t *tv) +{ + delwin(tv->wgoto); delwin(tv->whelp); + endwin(); + + bam_lplbuf_destroy(tv->lplbuf); + bam_maqcns_destroy(tv->bmc); + bam_index_destroy(tv->idx); + if (tv->fai) fai_destroy(tv->fai); + free(tv->ref); + bam_header_destroy(tv->header); + bam_close(tv->fp); + free(tv); +} + +int tv_fetch_func(const bam1_t *b, void *data) +{ + tview_t *tv = (tview_t*)data; + if (tv->no_skip) { + uint32_t *cigar = bam1_cigar(b); // this is cheating... + int i; + for (i = 0; i <b->core.n_cigar; ++i) { + if ((cigar[i]&0xf) == BAM_CREF_SKIP) + cigar[i] = cigar[i]>>4<<4 | BAM_CDEL; + } + } + bam_lplbuf_push(b, tv->lplbuf); + return 0; +} + +int tv_draw_aln(tview_t *tv, int tid, int pos) +{ + // reset + clear(); + tv->curr_tid = tid; tv->left_pos = pos; + tv->last_pos = tv->left_pos - 1; + tv->ccol = 0; + // print ref and consensus + if (tv->fai) { + char *str; + if (tv->ref) free(tv->ref); + str = (char*)calloc(strlen(tv->header->target_name[tv->curr_tid]) + 30, 1); + sprintf(str, "%s:%d-%d", tv->header->target_name[tv->curr_tid], tv->left_pos + 1, tv->left_pos + tv->mcol); + tv->ref = fai_fetch(tv->fai, str, &tv->l_ref); + free(str); + } + // draw aln + bam_lplbuf_reset(tv->lplbuf); + bam_fetch(tv->fp, tv->idx, tv->curr_tid, tv->left_pos, tv->left_pos + tv->mcol, tv, tv_fetch_func); + bam_lplbuf_push(0, tv->lplbuf); + + while (tv->ccol < tv->mcol) { + int pos = tv->last_pos + 1; + if (pos%10 == 0 && tv->mcol - tv->ccol >= 10) mvprintw(0, tv->ccol, "%-d", pos+1); + mvaddch(1, tv->ccol++, (tv->ref && pos < tv->l_ref)? tv->ref[pos - tv->left_pos] : 'N'); + ++tv->last_pos; + } + return 0; +} + +static void tv_win_goto(tview_t *tv, int *tid, int *pos) +{ + char str[256]; + int i, l = 0; + wborder(tv->wgoto, '|', '|', '-', '-', '+', '+', '+', '+'); + mvwprintw(tv->wgoto, 1, 2, "Goto: "); + for (;;) { + int c = wgetch(tv->wgoto); + wrefresh(tv->wgoto); + if (c == KEY_BACKSPACE || c == '\010' || c == '\177') { + --l; + } else if (c == KEY_ENTER || c == '\012' || c == '\015') { + int _tid = -1, _beg, _end; + bam_parse_region(tv->header, str, &_tid, &_beg, &_end); + if (_tid >= 0) { + *tid = _tid; *pos = _beg; + return; + } + } else if (isgraph(c)) { + if (l < TV_MAX_GOTO) str[l++] = c; + } else if (c == '\027') l = 0; + else if (c == '\033') return; + str[l] = '\0'; + for (i = 0; i < TV_MAX_GOTO; ++i) mvwaddch(tv->wgoto, 1, 8 + i, ' '); + mvwprintw(tv->wgoto, 1, 8, "%s", str); + } +} + +static void tv_win_help(tview_t *tv) { + int r = 1; + WINDOW *win = tv->whelp; + wborder(win, '|', '|', '-', '-', '+', '+', '+', '+'); + mvwprintw(win, r++, 2, " -=- Help -=- "); + r++; + mvwprintw(win, r++, 2, "? This window"); + mvwprintw(win, r++, 2, "Arrows Small scroll movement"); + mvwprintw(win, r++, 2, "h,j,k,l Small scroll movement"); + mvwprintw(win, r++, 2, "H,J,K,L Large scroll movement"); + mvwprintw(win, r++, 2, "ctrl-H Scroll 1k left"); + mvwprintw(win, r++, 2, "ctrl-L Scroll 1k right"); + mvwprintw(win, r++, 2, "space Scroll one screen"); + mvwprintw(win, r++, 2, "backspace Scroll back one screen"); + mvwprintw(win, r++, 2, "g Go to specific location"); + mvwprintw(win, r++, 2, "m Color for mapping qual"); + mvwprintw(win, r++, 2, "n Color for nucleotide"); + mvwprintw(win, r++, 2, "b Color for base quality"); + mvwprintw(win, r++, 2, "c Color for cs color"); + mvwprintw(win, r++, 2, "z Color for cs qual"); + mvwprintw(win, r++, 2, ". Toggle on/off dot view"); + mvwprintw(win, r++, 2, "s Toggle on/off ref skip"); + mvwprintw(win, r++, 2, "r Toggle on/off rd name"); + mvwprintw(win, r++, 2, "N Turn on nt view"); + mvwprintw(win, r++, 2, "C Turn on cs view"); + mvwprintw(win, r++, 2, "i Toggle on/off ins"); + mvwprintw(win, r++, 2, "q Exit"); + r++; + mvwprintw(win, r++, 2, "Underline: Secondary or orphan"); + mvwprintw(win, r++, 2, "Blue: 0-9 Green: 10-19"); + mvwprintw(win, r++, 2, "Yellow: 20-29 White: >=30"); + wrefresh(win); + wgetch(win); +} + +void tv_loop(tview_t *tv) +{ + int tid, pos; + tid = tv->curr_tid; pos = tv->left_pos; + while (1) { + int c = getch(); + switch (c) { + case '?': tv_win_help(tv); break; + case '\033': + case 'q': goto end_loop; + case 'g': tv_win_goto(tv, &tid, &pos); break; + case 'm': tv->color_for = TV_COLOR_MAPQ; break; + case 'b': tv->color_for = TV_COLOR_BASEQ; break; + case 'n': tv->color_for = TV_COLOR_NUCL; break; + case 'c': tv->color_for = TV_COLOR_COL; break; + case 'z': tv->color_for = TV_COLOR_COLQ; break; + case 's': tv->no_skip = !tv->no_skip; break; + case 'r': tv->show_name = !tv->show_name; break; + case KEY_LEFT: + case 'h': --pos; break; + case KEY_RIGHT: + case 'l': ++pos; break; + case KEY_SLEFT: + case 'H': pos -= 20; break; + case KEY_SRIGHT: + case 'L': pos += 20; break; + case '.': tv->is_dot = !tv->is_dot; break; + case 'N': tv->base_for = TV_BASE_NUCL; break; + case 'C': tv->base_for = TV_BASE_COLOR_SPACE; break; + case 'i': tv->ins = !tv->ins; break; + case '\010': pos -= 1000; break; + case '\014': pos += 1000; break; + case ' ': pos += tv->mcol; break; + case KEY_UP: + case 'j': --tv->row_shift; break; + case KEY_DOWN: + case 'k': ++tv->row_shift; break; + case KEY_BACKSPACE: + case '\177': pos -= tv->mcol; break; + case KEY_RESIZE: getmaxyx(stdscr, tv->mrow, tv->mcol); break; + default: continue; + } + if (pos < 0) pos = 0; + if (tv->row_shift < 0) tv->row_shift = 0; + tv_draw_aln(tv, tid, pos); + } +end_loop: + return; +} + +int bam_tview_main(int argc, char *argv[]) +{ + tview_t *tv; + if (argc == 1) { + fprintf(stderr, "Usage: bamtk tview <aln.bam> [ref.fasta]\n"); + return 1; + } + tv = tv_init(argv[1], (argc == 2)? 0 : argv[2]); + tv_draw_aln(tv, 0, 0); + tv_loop(tv); + tv_destroy(tv); + return 0; +} +#else // #ifdef _HAVE_CURSES +#include <stdio.h> +#warning "No curses library is available; tview is disabled." +int bam_tview_main(int argc, char *argv[]) +{ + fprintf(stderr, "[bam_tview_main] The ncurses library is unavailable; tview is not compiled.\n"); + return 1; +} +#endif // #ifdef _HAVE_CURSES
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/SNV/SNVMix2_source/SNVMix2-v0.12.1-rc1/samtools-0.1.6/bamtk.c Wed Oct 12 19:50:38 2011 -0400 @@ -0,0 +1,130 @@ +#include <stdio.h> +#include <unistd.h> +#include <assert.h> +#include <fcntl.h> +#include "bam.h" + +#ifdef _USE_KNETFILE +#include "knetfile.h" +#endif + +#ifndef PACKAGE_VERSION +#define PACKAGE_VERSION "0.1.6 (r453)" +#endif + +int bam_taf2baf(int argc, char *argv[]); +int bam_pileup(int argc, char *argv[]); +int bam_merge(int argc, char *argv[]); +int bam_index(int argc, char *argv[]); +int bam_sort(int argc, char *argv[]); +int bam_tview_main(int argc, char *argv[]); +int bam_mating(int argc, char *argv[]); +int bam_rmdup(int argc, char *argv[]); +int bam_rmdupse(int argc, char *argv[]); +int bam_flagstat(int argc, char *argv[]); +int bam_fillmd(int argc, char *argv[]); + +int main_samview(int argc, char *argv[]); +int main_import(int argc, char *argv[]); + +int faidx_main(int argc, char *argv[]); +int glf3_view_main(int argc, char *argv[]); + +int bam_tagview(int argc, char *argv[]) +{ + bamFile fp; + bam_header_t *header; + bam1_t *b; + char tag[2]; + int ret; + if (argc < 3) { + fprintf(stderr, "Usage: samtools tagview <in.bam> <tag>\n"); + return 1; + } + fp = strcmp(argv[1], "-")? bam_open(argv[1], "r") : bam_dopen(fileno(stdin), "r"); + assert(fp); + header = bam_header_read(fp); + if (header == 0) { + fprintf(stderr, "[bam_view] fail to read the BAM header. Abort!\n"); + return 1; + } + tag[0] = argv[2][0]; tag[1] = argv[2][1]; + b = (bam1_t*)calloc(1, sizeof(bam1_t)); + while ((ret = bam_read1(fp, b)) >= 0) { + uint8_t *d = bam_aux_get(b, tag); + if (d) { + printf("%s\t%d\t", bam1_qname(b), b->core.flag); + if (d[0] == 'Z' || d[0] == 'H') printf("%s\n", bam_aux2Z(d)); + else if (d[0] == 'f') printf("%f\n", bam_aux2f(d)); + else if (d[0] == 'd') printf("%lf\n", bam_aux2d(d)); + else if (d[0] == 'A') printf("%c\n", bam_aux2A(d)); + else if (d[0] == 'c' || d[0] == 's' || d[0] == 'i') printf("%d\n", bam_aux2i(d)); + else if (d[0] == 'C' || d[0] == 'S' || d[0] == 'I') printf("%u\n", bam_aux2i(d)); + else printf("\n"); + } + } + if (ret < -1) fprintf(stderr, "[bam_view] truncated file? Continue anyway. (%d)\n", ret); + free(b->data); free(b); + bam_header_destroy(header); + bam_close(fp); + return 0; +} + +static int usage() +{ + fprintf(stderr, "\n"); + fprintf(stderr, "Program: samtools (Tools for alignments in the SAM format)\n"); + fprintf(stderr, "Version: %s\n\n", PACKAGE_VERSION); + fprintf(stderr, "Usage: samtools <command> [options]\n\n"); + fprintf(stderr, "Command: view SAM<->BAM conversion\n"); + fprintf(stderr, " sort sort alignment file\n"); + fprintf(stderr, " pileup generate pileup output\n"); + fprintf(stderr, " faidx index/extract FASTA\n"); +#if _CURSES_LIB != 0 + fprintf(stderr, " tview text alignment viewer\n"); +#endif + fprintf(stderr, " index index alignment\n"); + fprintf(stderr, " fixmate fix mate information\n"); + fprintf(stderr, " glfview print GLFv3 file\n"); + fprintf(stderr, " flagstat simple stats\n"); + fprintf(stderr, " calmd recalculate MD/NM tags and '=' bases\n"); + fprintf(stderr, " merge merge sorted alignments (Picard recommended)\n"); + fprintf(stderr, " rmdup remove PCR duplicates (Picard recommended)\n"); + fprintf(stderr, "\n"); + return 1; +} + +int main(int argc, char *argv[]) +{ +#ifdef _WIN32 + setmode(fileno(stdout), O_BINARY); + setmode(fileno(stdin), O_BINARY); +#ifdef _USE_KNETFILE + knet_win32_init(); +#endif +#endif + if (argc < 2) return usage(); + if (strcmp(argv[1], "view") == 0) return main_samview(argc-1, argv+1); + else if (strcmp(argv[1], "import") == 0) return main_import(argc-1, argv+1); + else if (strcmp(argv[1], "pileup") == 0) return bam_pileup(argc-1, argv+1); + else if (strcmp(argv[1], "merge") == 0) return bam_merge(argc-1, argv+1); + else if (strcmp(argv[1], "sort") == 0) return bam_sort(argc-1, argv+1); + else if (strcmp(argv[1], "index") == 0) return bam_index(argc-1, argv+1); + else if (strcmp(argv[1], "faidx") == 0) return faidx_main(argc-1, argv+1); + else if (strcmp(argv[1], "fixmate") == 0) return bam_mating(argc-1, argv+1); + else if (strcmp(argv[1], "rmdup") == 0) return bam_rmdup(argc-1, argv+1); + else if (strcmp(argv[1], "rmdupse") == 0) return bam_rmdupse(argc-1, argv+1); + else if (strcmp(argv[1], "glfview") == 0) return glf3_view_main(argc-1, argv+1); + else if (strcmp(argv[1], "flagstat") == 0) return bam_flagstat(argc-1, argv+1); + else if (strcmp(argv[1], "tagview") == 0) return bam_tagview(argc-1, argv+1); + else if (strcmp(argv[1], "calmd") == 0) return bam_fillmd(argc-1, argv+1); + else if (strcmp(argv[1], "fillmd") == 0) return bam_fillmd(argc-1, argv+1); +#if _CURSES_LIB != 0 + else if (strcmp(argv[1], "tview") == 0) return bam_tview_main(argc-1, argv+1); +#endif + else { + fprintf(stderr, "[main] unrecognized command '%s'\n", argv[1]); + return 1; + } + return 0; +}
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/SNV/SNVMix2_source/SNVMix2-v0.12.1-rc1/samtools-0.1.6/bgzf.c Wed Oct 12 19:50:38 2011 -0400 @@ -0,0 +1,683 @@ +/* The MIT License + + Copyright (c) 2008 Broad Institute / Massachusetts Institute of Technology + + Permission is hereby granted, free of charge, to any person obtaining a copy + of this software and associated documentation files (the "Software"), to deal + in the Software without restriction, including without limitation the rights + to use, copy, modify, merge, publish, distribute, sublicense, and/or sell + copies of the Software, and to permit persons to whom the Software is + furnished to do so, subject to the following conditions: + + The above copyright notice and this permission notice shall be included in + all copies or substantial portions of the Software. + + THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR + IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, + FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE + AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER + LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, + OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN + THE SOFTWARE. +*/ + +/* + 2009-06-29 by lh3: cache recent uncompressed blocks. + 2009-06-25 by lh3: optionally use my knetfile library to access file on a FTP. + 2009-06-12 by lh3: support a mode string like "wu" where 'u' for uncompressed output */ + +#include <stdio.h> +#include <stdlib.h> +#include <string.h> +#include <unistd.h> +#include <fcntl.h> +#include <sys/types.h> +#include <sys/stat.h> +#include "bgzf.h" + +#include "khash.h" +typedef struct { + int size; + uint8_t *block; + int64_t end_offset; +} cache_t; +KHASH_MAP_INIT_INT64(cache, cache_t) + +#if defined(_WIN32) || defined(_MSC_VER) +#define ftello(fp) ftell(fp) +#define fseeko(fp, offset, whence) fseek(fp, offset, whence) +#else +extern off_t ftello(FILE *stream); +extern int fseeko(FILE *stream, off_t offset, int whence); +#endif + +typedef int8_t bgzf_byte_t; + +static const int DEFAULT_BLOCK_SIZE = 64 * 1024; +static const int MAX_BLOCK_SIZE = 64 * 1024; + +static const int BLOCK_HEADER_LENGTH = 18; +static const int BLOCK_FOOTER_LENGTH = 8; + +static const int GZIP_ID1 = 31; +static const int GZIP_ID2 = 139; +static const int CM_DEFLATE = 8; +static const int FLG_FEXTRA = 4; +static const int OS_UNKNOWN = 255; +static const int BGZF_ID1 = 66; // 'B' +static const int BGZF_ID2 = 67; // 'C' +static const int BGZF_LEN = 2; +static const int BGZF_XLEN = 6; // BGZF_LEN+4 + +static const int GZIP_WINDOW_BITS = -15; // no zlib header +static const int Z_DEFAULT_MEM_LEVEL = 8; + + +inline +void +packInt16(uint8_t* buffer, uint16_t value) +{ + buffer[0] = value; + buffer[1] = value >> 8; +} + +inline +int +unpackInt16(const uint8_t* buffer) +{ + return (buffer[0] | (buffer[1] << 8)); +} + +inline +void +packInt32(uint8_t* buffer, uint32_t value) +{ + buffer[0] = value; + buffer[1] = value >> 8; + buffer[2] = value >> 16; + buffer[3] = value >> 24; +} + +static inline +int +bgzf_min(int x, int y) +{ + return (x < y) ? x : y; +} + +static +void +report_error(BGZF* fp, const char* message) { + fp->error = message; +} + +static BGZF *bgzf_read_init() +{ + BGZF *fp; + fp = calloc(1, sizeof(BGZF)); + fp->uncompressed_block_size = MAX_BLOCK_SIZE; + fp->uncompressed_block = malloc(MAX_BLOCK_SIZE); + fp->compressed_block_size = MAX_BLOCK_SIZE; + fp->compressed_block = malloc(MAX_BLOCK_SIZE); + fp->cache_size = 0; + fp->cache = kh_init(cache); + return fp; +} + +static +BGZF* +open_read(int fd) +{ +#ifdef _USE_KNETFILE + knetFile *file = knet_dopen(fd, "r"); +#else + FILE* file = fdopen(fd, "r"); +#endif + BGZF* fp; + if (file == 0) return 0; + fp = bgzf_read_init(); + fp->file_descriptor = fd; + fp->open_mode = 'r'; +#ifdef _USE_KNETFILE + fp->x.fpr = file; +#else + fp->file = file; +#endif + return fp; +} + +static +BGZF* +open_write(int fd, bool is_uncompressed) +{ + FILE* file = fdopen(fd, "w"); + BGZF* fp; + if (file == 0) return 0; + fp = malloc(sizeof(BGZF)); + fp->file_descriptor = fd; + fp->open_mode = 'w'; + fp->owned_file = 0; fp->is_uncompressed = is_uncompressed; +#ifdef _USE_KNETFILE + fp->x.fpw = file; +#else + fp->file = file; +#endif + fp->uncompressed_block_size = DEFAULT_BLOCK_SIZE; + fp->uncompressed_block = NULL; + fp->compressed_block_size = MAX_BLOCK_SIZE; + fp->compressed_block = malloc(MAX_BLOCK_SIZE); + fp->block_address = 0; + fp->block_offset = 0; + fp->block_length = 0; + fp->error = NULL; + return fp; +} + +BGZF* +bgzf_open(const char* __restrict path, const char* __restrict mode) +{ + BGZF* fp = NULL; + if (mode[0] == 'r' || mode[0] == 'R') { /* The reading mode is preferred. */ +#ifdef _USE_KNETFILE + knetFile *file = knet_open(path, mode); + if (file == 0) return 0; + fp = bgzf_read_init(); + fp->file_descriptor = -1; + fp->open_mode = 'r'; + fp->x.fpr = file; +#else + int fd, oflag = O_RDONLY; +#ifdef _WIN32 + oflag |= O_BINARY; +#endif + fd = open(path, oflag); + if (fd == -1) return 0; + fp = open_read(fd); +#endif + } else if (mode[0] == 'w' || mode[0] == 'W') { + int fd, oflag = O_WRONLY | O_CREAT | O_TRUNC; +#ifdef _WIN32 + oflag |= O_BINARY; +#endif + fd = open(path, oflag, 0644); + if (fd == -1) return 0; + fp = open_write(fd, strstr(mode, "u")? 1 : 0); + } + if (fp != NULL) { + fp->owned_file = 1; + } + return fp; +} + +BGZF* +bgzf_fdopen(int fd, const char * __restrict mode) +{ + if (fd == -1) return 0; + if (mode[0] == 'r' || mode[0] == 'R') { + return open_read(fd); + } else if (mode[0] == 'w' || mode[0] == 'W') { + return open_write(fd, strstr(mode, "u")? 1 : 0); + } else { + return NULL; + } +} + +static +int +deflate_block(BGZF* fp, int block_length) +{ + // Deflate the block in fp->uncompressed_block into fp->compressed_block. + // Also adds an extra field that stores the compressed block length. + + bgzf_byte_t* buffer = fp->compressed_block; + int buffer_size = fp->compressed_block_size; + + // Init gzip header + buffer[0] = GZIP_ID1; + buffer[1] = GZIP_ID2; + buffer[2] = CM_DEFLATE; + buffer[3] = FLG_FEXTRA; + buffer[4] = 0; // mtime + buffer[5] = 0; + buffer[6] = 0; + buffer[7] = 0; + buffer[8] = 0; + buffer[9] = OS_UNKNOWN; + buffer[10] = BGZF_XLEN; + buffer[11] = 0; + buffer[12] = BGZF_ID1; + buffer[13] = BGZF_ID2; + buffer[14] = BGZF_LEN; + buffer[15] = 0; + buffer[16] = 0; // placeholder for block length + buffer[17] = 0; + + // loop to retry for blocks that do not compress enough + int input_length = block_length; + int compressed_length = 0; + while (1) { + int compress_level = fp->is_uncompressed? 0 : Z_DEFAULT_COMPRESSION; + z_stream zs; + zs.zalloc = NULL; + zs.zfree = NULL; + zs.next_in = fp->uncompressed_block; + zs.avail_in = input_length; + zs.next_out = (void*)&buffer[BLOCK_HEADER_LENGTH]; + zs.avail_out = buffer_size - BLOCK_HEADER_LENGTH - BLOCK_FOOTER_LENGTH; + + int status = deflateInit2(&zs, compress_level, Z_DEFLATED, + GZIP_WINDOW_BITS, Z_DEFAULT_MEM_LEVEL, Z_DEFAULT_STRATEGY); + if (status != Z_OK) { + report_error(fp, "deflate init failed"); + return -1; + } + status = deflate(&zs, Z_FINISH); + if (status != Z_STREAM_END) { + deflateEnd(&zs); + if (status == Z_OK) { + // Not enough space in buffer. + // Can happen in the rare case the input doesn't compress enough. + // Reduce the amount of input until it fits. + input_length -= 1024; + if (input_length <= 0) { + // should never happen + report_error(fp, "input reduction failed"); + return -1; + } + continue; + } + report_error(fp, "deflate failed"); + return -1; + } + status = deflateEnd(&zs); + if (status != Z_OK) { + report_error(fp, "deflate end failed"); + return -1; + } + compressed_length = zs.total_out; + compressed_length += BLOCK_HEADER_LENGTH + BLOCK_FOOTER_LENGTH; + if (compressed_length > MAX_BLOCK_SIZE) { + // should never happen + report_error(fp, "deflate overflow"); + return -1; + } + break; + } + + packInt16((uint8_t*)&buffer[16], compressed_length-1); + uint32_t crc = crc32(0L, NULL, 0L); + crc = crc32(crc, fp->uncompressed_block, input_length); + packInt32((uint8_t*)&buffer[compressed_length-8], crc); + packInt32((uint8_t*)&buffer[compressed_length-4], input_length); + + int remaining = block_length - input_length; + if (remaining > 0) { + if (remaining > input_length) { + // should never happen (check so we can use memcpy) + report_error(fp, "remainder too large"); + return -1; + } + memcpy(fp->uncompressed_block, + fp->uncompressed_block + input_length, + remaining); + } + fp->block_offset = remaining; + return compressed_length; +} + +static +int +inflate_block(BGZF* fp, int block_length) +{ + // Inflate the block in fp->compressed_block into fp->uncompressed_block + + z_stream zs; + zs.zalloc = NULL; + zs.zfree = NULL; + zs.next_in = fp->compressed_block + 18; + zs.avail_in = block_length - 16; + zs.next_out = fp->uncompressed_block; + zs.avail_out = fp->uncompressed_block_size; + + int status = inflateInit2(&zs, GZIP_WINDOW_BITS); + if (status != Z_OK) { + report_error(fp, "inflate init failed"); + return -1; + } + status = inflate(&zs, Z_FINISH); + if (status != Z_STREAM_END) { + inflateEnd(&zs); + report_error(fp, "inflate failed"); + return -1; + } + status = inflateEnd(&zs); + if (status != Z_OK) { + report_error(fp, "inflate failed"); + return -1; + } + return zs.total_out; +} + +static +int +check_header(const bgzf_byte_t* header) +{ + return (header[0] == GZIP_ID1 && + header[1] == (bgzf_byte_t) GZIP_ID2 && + header[2] == Z_DEFLATED && + (header[3] & FLG_FEXTRA) != 0 && + unpackInt16((uint8_t*)&header[10]) == BGZF_XLEN && + header[12] == BGZF_ID1 && + header[13] == BGZF_ID2 && + unpackInt16((uint8_t*)&header[14]) == BGZF_LEN); +} + +static void free_cache(BGZF *fp) +{ + khint_t k; + khash_t(cache) *h = (khash_t(cache)*)fp->cache; + if (fp->open_mode != 'r') return; + for (k = kh_begin(h); k < kh_end(h); ++k) + if (kh_exist(h, k)) free(kh_val(h, k).block); + kh_destroy(cache, h); +} + +static int load_block_from_cache(BGZF *fp, int64_t block_address) +{ + khint_t k; + cache_t *p; + khash_t(cache) *h = (khash_t(cache)*)fp->cache; + k = kh_get(cache, h, block_address); + if (k == kh_end(h)) return 0; + p = &kh_val(h, k); + if (fp->block_length != 0) fp->block_offset = 0; + fp->block_address = block_address; + fp->block_length = p->size; + memcpy(fp->uncompressed_block, p->block, MAX_BLOCK_SIZE); +#ifdef _USE_KNETFILE + knet_seek(fp->x.fpr, p->end_offset, SEEK_SET); +#else + fseeko(fp->file, p->end_offset, SEEK_SET); +#endif + return p->size; +} + +static void cache_block(BGZF *fp, int size) +{ + int ret; + khint_t k; + cache_t *p; + khash_t(cache) *h = (khash_t(cache)*)fp->cache; + if (MAX_BLOCK_SIZE >= fp->cache_size) return; + if ((kh_size(h) + 1) * MAX_BLOCK_SIZE > fp->cache_size) { + /* A better way would be to remove the oldest block in the + * cache, but here we remove a random one for simplicity. This + * should not have a big impact on performance. */ + for (k = kh_begin(h); k < kh_end(h); ++k) + if (kh_exist(h, k)) break; + if (k < kh_end(h)) { + free(kh_val(h, k).block); + kh_del(cache, h, k); + } + } + k = kh_put(cache, h, fp->block_address, &ret); + if (ret == 0) return; // if this happens, a bug! + p = &kh_val(h, k); + p->size = fp->block_length; + p->end_offset = fp->block_address + size; + p->block = malloc(MAX_BLOCK_SIZE); + memcpy(kh_val(h, k).block, fp->uncompressed_block, MAX_BLOCK_SIZE); +} + +static +int +read_block(BGZF* fp) +{ + bgzf_byte_t header[BLOCK_HEADER_LENGTH]; + int size = 0; +#ifdef _USE_KNETFILE + int64_t block_address = knet_tell(fp->x.fpr); + if (load_block_from_cache(fp, block_address)) return 0; + int count = knet_read(fp->x.fpr, header, sizeof(header)); +#else + int64_t block_address = ftello(fp->file); + if (load_block_from_cache(fp, block_address)) return 0; + int count = fread(header, 1, sizeof(header), fp->file); +#endif + if (count == 0) { + fp->block_length = 0; + return 0; + } + size = count; + if (count != sizeof(header)) { + report_error(fp, "read failed"); + return -1; + } + if (!check_header(header)) { + report_error(fp, "invalid block header"); + return -1; + } + int block_length = unpackInt16((uint8_t*)&header[16]) + 1; + bgzf_byte_t* compressed_block = (bgzf_byte_t*) fp->compressed_block; + memcpy(compressed_block, header, BLOCK_HEADER_LENGTH); + int remaining = block_length - BLOCK_HEADER_LENGTH; +#ifdef _USE_KNETFILE + count = knet_read(fp->x.fpr, &compressed_block[BLOCK_HEADER_LENGTH], remaining); +#else + count = fread(&compressed_block[BLOCK_HEADER_LENGTH], 1, remaining, fp->file); +#endif + if (count != remaining) { + report_error(fp, "read failed"); + return -1; + } + size += count; + count = inflate_block(fp, block_length); + if (count < 0) { + return -1; + } + if (fp->block_length != 0) { + // Do not reset offset if this read follows a seek. + fp->block_offset = 0; + } + fp->block_address = block_address; + fp->block_length = count; + cache_block(fp, size); + return 0; +} + +int +bgzf_read(BGZF* fp, void* data, int length) +{ + if (length <= 0) { + return 0; + } + if (fp->open_mode != 'r') { + report_error(fp, "file not open for reading"); + return -1; + } + + int bytes_read = 0; + bgzf_byte_t* output = data; + while (bytes_read < length) { + int available = fp->block_length - fp->block_offset; + if (available <= 0) { + if (read_block(fp) != 0) { + return -1; + } + available = fp->block_length - fp->block_offset; + if (available <= 0) { + break; + } + } + int copy_length = bgzf_min(length-bytes_read, available); + bgzf_byte_t* buffer = fp->uncompressed_block; + memcpy(output, buffer + fp->block_offset, copy_length); + fp->block_offset += copy_length; + output += copy_length; + bytes_read += copy_length; + } + if (fp->block_offset == fp->block_length) { +#ifdef _USE_KNETFILE + fp->block_address = knet_tell(fp->x.fpr); +#else + fp->block_address = ftello(fp->file); +#endif + fp->block_offset = 0; + fp->block_length = 0; + } + return bytes_read; +} + +static +int +flush_block(BGZF* fp) +{ + while (fp->block_offset > 0) { + int block_length = deflate_block(fp, fp->block_offset); + if (block_length < 0) { + return -1; + } +#ifdef _USE_KNETFILE + int count = fwrite(fp->compressed_block, 1, block_length, fp->x.fpw); +#else + int count = fwrite(fp->compressed_block, 1, block_length, fp->file); +#endif + if (count != block_length) { + report_error(fp, "write failed"); + return -1; + } + fp->block_address += block_length; + } + return 0; +} + +int +bgzf_write(BGZF* fp, const void* data, int length) +{ + if (fp->open_mode != 'w') { + report_error(fp, "file not open for writing"); + return -1; + } + + if (fp->uncompressed_block == NULL) { + fp->uncompressed_block = malloc(fp->uncompressed_block_size); + } + + const bgzf_byte_t* input = data; + int block_length = fp->uncompressed_block_size; + int bytes_written = 0; + while (bytes_written < length) { + int copy_length = bgzf_min(block_length - fp->block_offset, length - bytes_written); + bgzf_byte_t* buffer = fp->uncompressed_block; + memcpy(buffer + fp->block_offset, input, copy_length); + fp->block_offset += copy_length; + input += copy_length; + bytes_written += copy_length; + if (fp->block_offset == block_length) { + if (flush_block(fp) != 0) { + break; + } + } + } + return bytes_written; +} + +int +bgzf_close(BGZF* fp) +{ + if (fp->open_mode == 'w') { + if (flush_block(fp) != 0) { + return -1; + } + { // add an empty block + int count, block_length = deflate_block(fp, 0); +#ifdef _USE_KNETFILE + count = fwrite(fp->compressed_block, 1, block_length, fp->x.fpw); +#else + count = fwrite(fp->compressed_block, 1, block_length, fp->file); +#endif + } +#ifdef _USE_KNETFILE + if (fflush(fp->x.fpw) != 0) { +#else + if (fflush(fp->file) != 0) { +#endif + report_error(fp, "flush failed"); + return -1; + } + } + if (fp->owned_file) { +#ifdef _USE_KNETFILE + int ret; + if (fp->open_mode == 'w') ret = fclose(fp->x.fpw); + else ret = knet_close(fp->x.fpr); + if (ret != 0) return -1; +#else + if (fclose(fp->file) != 0) { + return -1; + } +#endif + } + free(fp->uncompressed_block); + free(fp->compressed_block); + free_cache(fp); + free(fp); + return 0; +} + +int64_t +bgzf_tell(BGZF* fp) +{ + return ((fp->block_address << 16) | (fp->block_offset & 0xFFFF)); +} + +void bgzf_set_cache_size(BGZF *fp, int cache_size) +{ + if (fp) fp->cache_size = cache_size; +} + +int bgzf_check_EOF(BGZF *fp) +{ + static uint8_t magic[28] = "\037\213\010\4\0\0\0\0\0\377\6\0\102\103\2\0\033\0\3\0\0\0\0\0\0\0\0\0"; + uint8_t buf[28]; + off_t offset; +#ifdef _USE_KNETFILE + offset = knet_tell(fp->x.fpr); + if (knet_seek(fp->x.fpr, -28, SEEK_END) != 0) return -1; + knet_read(fp->x.fpr, buf, 28); + knet_seek(fp->x.fpr, offset, SEEK_SET); +#else + offset = ftello(fp->file); + if (fseeko(fp->file, -28, SEEK_END) != 0) return -1; + fread(buf, 1, 28, fp->file); + fseeko(fp->file, offset, SEEK_SET); +#endif + return (memcmp(magic, buf, 28) == 0)? 1 : 0; +} + +int64_t +bgzf_seek(BGZF* fp, int64_t pos, int where) +{ + if (fp->open_mode != 'r') { + report_error(fp, "file not open for read"); + return -1; + } + if (where != SEEK_SET) { + report_error(fp, "unimplemented seek option"); + return -1; + } + int block_offset = pos & 0xFFFF; + int64_t block_address = (pos >> 16) & 0xFFFFFFFFFFFFLL; +#ifdef _USE_KNETFILE + if (knet_seek(fp->x.fpr, block_address, SEEK_SET) != 0) { +#else + if (fseeko(fp->file, block_address, SEEK_SET) != 0) { +#endif + report_error(fp, "seek failed"); + return -1; + } + fp->block_length = 0; // indicates current block is not loaded + fp->block_address = block_address; + fp->block_offset = block_offset; + return 0; +}
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/SNV/SNVMix2_source/SNVMix2-v0.12.1-rc1/samtools-0.1.6/bgzf.h Wed Oct 12 19:50:38 2011 -0400 @@ -0,0 +1,134 @@ +/* The MIT License + + Copyright (c) 2008 Broad Institute / Massachusetts Institute of Technology + + Permission is hereby granted, free of charge, to any person obtaining a copy + of this software and associated documentation files (the "Software"), to deal + in the Software without restriction, including without limitation the rights + to use, copy, modify, merge, publish, distribute, sublicense, and/or sell + copies of the Software, and to permit persons to whom the Software is + furnished to do so, subject to the following conditions: + + The above copyright notice and this permission notice shall be included in + all copies or substantial portions of the Software. + + THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR + IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, + FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE + AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER + LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, + OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN + THE SOFTWARE. +*/ + +#ifndef __BGZF_H +#define __BGZF_H + +#include <stdint.h> +#include <stdio.h> +#include <stdbool.h> +#include <zlib.h> +#ifdef _USE_KNETFILE +#include "knetfile.h" +#endif + +//typedef int8_t bool; + +typedef struct { + int file_descriptor; + char open_mode; // 'r' or 'w' + bool owned_file, is_uncompressed; +#ifdef _USE_KNETFILE + union { + knetFile *fpr; + FILE *fpw; + } x; +#else + FILE* file; +#endif + int uncompressed_block_size; + int compressed_block_size; + void* uncompressed_block; + void* compressed_block; + int64_t block_address; + int block_length; + int block_offset; + int cache_size; + const char* error; + void *cache; // a pointer to a hash table +} BGZF; + +#ifdef __cplusplus +extern "C" { +#endif + +/* + * Open an existing file descriptor for reading or writing. + * Mode must be either "r" or "w". + * A subsequent bgzf_close will not close the file descriptor. + * Returns null on error. + */ +BGZF* bgzf_fdopen(int fd, const char* __restrict mode); + +/* + * Open the specified file for reading or writing. + * Mode must be either "r" or "w". + * Returns null on error. + */ +BGZF* bgzf_open(const char* path, const char* __restrict mode); + +/* + * Close the BGZ file and free all associated resources. + * Does not close the underlying file descriptor if created with bgzf_fdopen. + * Returns zero on success, -1 on error. + */ +int bgzf_close(BGZF* fp); + +/* + * Read up to length bytes from the file storing into data. + * Returns the number of bytes actually read. + * Returns zero on end of file. + * Returns -1 on error. + */ +int bgzf_read(BGZF* fp, void* data, int length); + +/* + * Write length bytes from data to the file. + * Returns the number of bytes written. + * Returns -1 on error. + */ +int bgzf_write(BGZF* fp, const void* data, int length); + +/* + * Return a virtual file pointer to the current location in the file. + * No interpetation of the value should be made, other than a subsequent + * call to bgzf_seek can be used to position the file at the same point. + * Return value is non-negative on success. + * Returns -1 on error. + */ +int64_t bgzf_tell(BGZF* fp); + +/* + * Set the file to read from the location specified by pos, which must + * be a value previously returned by bgzf_tell for this file (but not + * necessarily one returned by this file handle). + * The where argument must be SEEK_SET. + * Seeking on a file opened for write is not supported. + * Returns zero on success, -1 on error. + */ +int64_t bgzf_seek(BGZF* fp, int64_t pos, int where); + +/* + * Set the cache size. Zero to disable. By default, caching is + * disabled. The recommended cache size for frequent random access is + * about 8M bytes. + */ +void bgzf_set_cache_size(BGZF *fp, int cache_size); + +int bgzf_check_EOF(BGZF *fp); + +#ifdef __cplusplus +} +#endif + +#endif
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/SNV/SNVMix2_source/SNVMix2-v0.12.1-rc1/samtools-0.1.6/bgzip.c Wed Oct 12 19:50:38 2011 -0400 @@ -0,0 +1,179 @@ +/* The MIT License + + Copyright (c) 2008 Broad Institute / Massachusetts Institute of Technology + + Permission is hereby granted, free of charge, to any person obtaining a copy + of this software and associated documentation files (the "Software"), to deal + in the Software without restriction, including without limitation the rights + to use, copy, modify, merge, publish, distribute, sublicense, and/or sell + copies of the Software, and to permit persons to whom the Software is + furnished to do so, subject to the following conditions: + + The above copyright notice and this permission notice shall be included in + all copies or substantial portions of the Software. + + THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR + IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, + FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE + AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER + LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, + OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN + THE SOFTWARE. +*/ + +#include <stdlib.h> +#include <string.h> +#include <stdio.h> +#include <fcntl.h> +#include <unistd.h> +#include <errno.h> +#include "bgzf.h" + +static const int WINDOW_SIZE = 64 * 1024; + +static int bgzip_main_usage() +{ + printf("\n"); + printf("Usage: bgzip [options] [file] ...\n\n"); + printf("Options: -c write on standard output, keep original files unchanged\n"); + printf(" -d decompress\n"); + // printf(" -l list compressed file contents\n"); + printf(" -b INT decompress at virtual file pointer INT\n"); + printf(" -s INT decompress INT bytes in the uncompressed file\n"); + printf(" -h give this help\n"); + printf("\n"); + return 0; +} + +static int write_open(const char *fn, int is_forced) +{ + int fd = -1; + char c; + if (!is_forced) { + if ((fd = open(fn, O_WRONLY | O_CREAT | O_TRUNC | O_EXCL, 0644)) < 0 && errno == EEXIST) { + printf("bgzip: %s already exists; do you wish to overwrite (y or n)? ", fn); + scanf("%c", &c); + if (c != 'Y' && c != 'y') { + printf("bgzip: not overwritten\n"); + exit(1); + } + } + } + if (fd < 0) { + if ((fd = open(fn, O_WRONLY | O_CREAT | O_TRUNC, 0644)) < 0) { + fprintf(stderr, "bgzip: %s: Fail to write\n", fn); + exit(1); + } + } + return fd; +} + +static +void +fail(BGZF* fp) +{ + printf("Error: %s\n", fp->error); + exit(1); +} + +int main(int argc, char **argv) +{ + int c, compress, pstdout, is_forced; + BGZF *rz; + void *buffer; + long start, end, size; + + compress = 1; pstdout = 0; start = 0; size = -1; end = -1; is_forced = 0; + while((c = getopt(argc, argv, "cdlhfb:s:")) >= 0){ + switch(c){ + case 'h': return bgzip_main_usage(); + case 'd': compress = 0; break; + case 'c': pstdout = 1; break; + // case 'l': compress = 2; break; + case 'b': start = atol(optarg); break; + case 's': size = atol(optarg); break; + case 'f': is_forced = 1; break; + } + } + if (size >= 0) end = start + size; + if(end >= 0 && end < start){ + fprintf(stderr, " -- Illegal region: [%ld, %ld] --\n", start, end); + return 1; + } + if(compress == 1){ + int f_src, f_dst = -1; + if(argc > optind){ + if((f_src = open(argv[optind], O_RDONLY)) < 0){ + fprintf(stderr, " -- Cannot open file: %s --\n", argv[optind]); + return 1; + } + if(pstdout){ + f_dst = fileno(stdout); + } else { + char *name = malloc(sizeof(strlen(argv[optind]) + 5)); + strcpy(name, argv[optind]); + strcat(name, ".gz"); + f_dst = write_open(name, is_forced); + if (f_dst < 0) return 1; + free(name); + } + } else if(pstdout){ + f_src = fileno(stdin); + f_dst = fileno(stdout); + } else return bgzip_main_usage(); + rz = bgzf_fdopen(f_dst, "w"); + buffer = malloc(WINDOW_SIZE); + while((c = read(f_src, buffer, WINDOW_SIZE)) > 0) { + if (bgzf_write(rz, buffer, c) < 0) { + fail(rz); + } + } + // f_dst will be closed here + if (bgzf_close(rz) < 0) { + fail(rz); + } + if (argc > optind) unlink(argv[optind]); + free(buffer); + close(f_src); + return 0; + } else { + if(argc <= optind) return bgzip_main_usage(); + int f_dst; + if (argc > optind && !pstdout) { + char *name; + if (strstr(argv[optind], ".gz") - argv[optind] != strlen(argv[optind]) - 3) { + printf("bgzip: %s: unknown suffix -- ignored\n", argv[optind]); + return 1; + } + name = strdup(argv[optind]); + name[strlen(name) - 3] = '\0'; + f_dst = write_open(name, is_forced); + free(name); + } else f_dst = fileno(stdout); + rz = bgzf_open(argv[optind], "r"); + if (rz == NULL) { + printf("Could not open file: %s\n", argv[optind]); + return 1; + } + buffer = malloc(WINDOW_SIZE); + if (bgzf_seek(rz, start, SEEK_SET) < 0) { + fail(rz); + } + while(1){ + if(end < 0) c = bgzf_read(rz, buffer, WINDOW_SIZE); + else c = bgzf_read(rz, buffer, (end - start > WINDOW_SIZE)? WINDOW_SIZE:(end - start)); + if(c == 0) break; + if (c < 0) fail(rz); + start += c; + write(f_dst, buffer, c); + if(end >= 0 && start >= end) break; + } + free(buffer); + if (bgzf_close(rz) < 0) { + fail(rz); + } + if (!pstdout) unlink(argv[optind]); + return 0; + } +} +
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/SNV/SNVMix2_source/SNVMix2-v0.12.1-rc1/samtools-0.1.6/examples/00README.txt Wed Oct 12 19:50:38 2011 -0400 @@ -0,0 +1,23 @@ +File ex1.fa contains two sequences cut from the human genome +build36. They were exatracted with command: + + samtools faidx human_b36.fa 2:2043966-2045540 20:67967-69550 + +Sequence names were changed manually for simplicity. File ex1.sam.gz +contains MAQ alignments exatracted with: + + (samtools view NA18507_maq.bam 2:2044001-2045500; + samtools view NA18507_maq.bam 20:68001-69500) + +and processed with `samtools fixmate' to make it self-consistent as a +standalone alignment. + +To try samtools, you may run the following commands: + + samtools faidx ex1.fa # index the reference FASTA + samtools import ex1.fa.fai ex1.sam.gz ex1.bam # SAM->BAM + samtools index ex1.bam # index BAM + samtools tview ex1.bam ex1.fa # view alignment + samtools pileup -cf ex1.fa ex1.bam # pileup and consensus + samtools pileup -cf ex1.fa -t ex1.fa.fai ex1.sam.gz +
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/SNV/SNVMix2_source/SNVMix2-v0.12.1-rc1/samtools-0.1.6/examples/Makefile Wed Oct 12 19:50:38 2011 -0400 @@ -0,0 +1,27 @@ +all:../libbam.a ../samtools ex1.glf ex1.pileup.gz ex1.bam.bai ex1.glfview.gz calDepth + @echo; echo \# You can now launch the viewer with: \'samtools tview ex1.bam ex1.fa\'; echo; + +ex1.fa.fai:ex1.fa + ../samtools faidx ex1.fa +ex1.bam:ex1.sam.gz ex1.fa.fai + ../samtools import ex1.fa.fai ex1.sam.gz ex1.bam +ex1.bam.bai:ex1.bam + ../samtools index ex1.bam +ex1.pileup.gz:ex1.bam ex1.fa + ../samtools pileup -cf ex1.fa ex1.bam | gzip > ex1.pileup.gz +ex1.glf:ex1.bam ex1.fa + ../samtools pileup -gf ex1.fa ex1.bam > ex1.glf +ex1.glfview.gz:ex1.glf + ../samtools glfview ex1.glf | gzip > ex1.glfview.gz + +../samtools: + (cd ..; make samtools) + +../libbam.a: + (cd ..; make libbam.a) + +calDepth:../libbam.a calDepth.c + gcc -g -Wall -O2 -I.. calDepth.c -o $@ -lm -lz -L.. -lbam + +clean: + rm -fr *.bam *.bai *.glf* *.fai *.pileup* *~ calDepth *.dSYM \ No newline at end of file
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/SNV/SNVMix2_source/SNVMix2-v0.12.1-rc1/samtools-0.1.6/examples/calDepth.c Wed Oct 12 19:50:38 2011 -0400 @@ -0,0 +1,62 @@ +#include <stdio.h> +#include "sam.h" + +typedef struct { + int beg, end; + samfile_t *in; +} tmpstruct_t; + +// callback for bam_fetch() +static int fetch_func(const bam1_t *b, void *data) +{ + bam_plbuf_t *buf = (bam_plbuf_t*)data; + bam_plbuf_push(b, buf); + return 0; +} +// callback for bam_plbuf_init() +static int pileup_func(uint32_t tid, uint32_t pos, int n, const bam_pileup1_t *pl, void *data) +{ + tmpstruct_t *tmp = (tmpstruct_t*)data; + if ((int)pos >= tmp->beg && (int)pos < tmp->end) + printf("%s\t%d\t%d\n", tmp->in->header->target_name[tid], pos + 1, n); + return 0; +} + +int main(int argc, char *argv[]) +{ + tmpstruct_t tmp; + if (argc == 1) { + fprintf(stderr, "Usage: calDepth <in.bam> [region]\n"); + return 1; + } + tmp.beg = 0; tmp.end = 0x7fffffff; + tmp.in = samopen(argv[1], "rb", 0); + if (tmp.in == 0) { + fprintf(stderr, "Fail to open BAM file %s\n", argv[1]); + return 1; + } + if (argc == 2) { // if a region is not specified + sampileup(tmp.in, -1, pileup_func, &tmp); + } else { + int ref; + bam_index_t *idx; + bam_plbuf_t *buf; + idx = bam_index_load(argv[1]); // load BAM index + if (idx == 0) { + fprintf(stderr, "BAM indexing file is not available.\n"); + return 1; + } + bam_parse_region(tmp.in->header, argv[2], &ref, &tmp.beg, &tmp.end); // parse the region + if (ref < 0) { + fprintf(stderr, "Invalid region %s\n", argv[2]); + return 1; + } + buf = bam_plbuf_init(pileup_func, &tmp); // initialize pileup + bam_fetch(tmp.in->x.bam, idx, ref, tmp.beg, tmp.end, buf, fetch_func); + bam_plbuf_push(0, buf); // finalize pileup + bam_index_destroy(idx); + bam_plbuf_destroy(buf); + } + samclose(tmp.in); + return 0; +}
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/SNV/SNVMix2_source/SNVMix2-v0.12.1-rc1/samtools-0.1.6/examples/ex1.fa Wed Oct 12 19:50:38 2011 -0400 @@ -0,0 +1,56 @@ +>seq1 +CACTAGTGGCTCATTGTAAATGTGTGGTTTAACTCGTCCATGGCCCAGCATTAGGGAGCT +GTGGACCCTGCAGCCTGGCTGTGGGGGCCGCAGTGGCTGAGGGGTGCAGAGCCGAGTCAC +GGGGTTGCCAGCACAGGGGCTTAACCTCTGGTGACTGCCAGAGCTGCTGGCAAGCTAGAG +TCCCATTTGGAGCCCCTCTAAGCCGTTCTATTTGTAATGAAAACTATATTTATGCTATTC +AGTTCTAAATATAGAAATTGAAACAGCTGTGTTTAGTGCCTTTGTTCAACCCCCTTGCAA +CAACCTTGAGAACCCCAGGGAATTTGTCAATGTCAGGGAAGGAGCATTTTGTCAGTTACC +AAATGTGTTTATTACCAGAGGGATGGAGGGAAGAGGGACGCTGAAGAACTTTGATGCCCT +CTTCTTCCAAAGATGAAACGCGTAACTGCGCTCTCATTCACTCCAGCTCCCTGTCACCCA +ATGGACCTGTGATATCTGGATTCTGGGAAATTCTTCATCCTGGACCCTGAGAGATTCTGC +AGCCCAGCTCCAGATTGCTTGTGGTCTGACAGGCTGCAACTGTGAGCCATCACAATGAAC +AACAGGAAGAAAAGGTCTTTCAAAAGGTGATGTGTGTTCTCATCAACCTCATACACACAC +ATGGTTTAGGGGTATAATACCTCTACATGGCTGATTATGAAAACAATGTTCCCCAGATAC +CATCCCTGTCTTACTTCCAGCTCCCCAGAGGGAAAGCTTTCAACGCTTCTAGCCATTTCT +TTTGGCATTTGCCTTCAGACCCTACACGAATGCGTCTCTACCACAGGGGGCTGCGCGGTT +TCCCATCATGAAGCACTGAACTTCCACGTCTCATCTAGGGGAACAGGGAGGTGCACTAAT +GCGCTCCACGCCCAAGCCCTTCTCACAGTTTCTGCCCCCAGCATGGTTGTACTGGGCAAT +ACATGAGATTATTAGGAAATGCTTTACTGTCATAACTATGAAGAGACTATTGCCAGATGA +ACCACACATTAATACTATGTTTCTTATCTGCACATTACTACCCTGCAATTAATATAATTG +TGTCCATGTACACACGCTGTCCTATGTACTTATCATGACTCTATCCCAAATTCCCAATTA +CGTCCTATCTTCTTCTTAGGGAAGAACAGCTTAGGTATCAATTTGGTGTTCTGTGTAAAG +TCTCAGGGAGCCGTCCGTGTCCTCCCATCTGGCCTCGTCCACACTGGTTCTCTTGAAAGC +TTGGGCTGTAATGATGCCCCTTGGCCATCACCCAGTCCCTGCCCCATCTCTTGTAATCTC +TCTCCTTTTTGCTGCATCCCTGTCTTCCTCTGTCTTGATTTACTTGTTGTTGGTTTTCTG +TTTCTTTGTTTGATTTGGTGGAAGACATAATCCCACGCTTCCTATGGAAAGGTTGTTGGG +AGATTTTTAATGATTCCTCAATGTTAAAATGTCTATTTTTGTCTTGACACCCAACTAATA +TTTGTCTGAGCAAAACAGTCTAGATGAGAGAGAACTTCCCTGGAGGTCTGATGGCGTTTC +TCCCTCGTCTTCTTA +>seq2 +TTCAAATGAACTTCTGTAATTGAAAAATTCATTTAAGAAATTACAAAATATAGTTGAAAG +CTCTAACAATAGACTAAACCAAGCAGAAGAAAGAGGTTCAGAACTTGAAGACAAGTCTCT +TATGAATTAACCCAGTCAGACAAAAATAAAGAAAAAAATTTTAAAAATGAACAGAGCTTT +CAAGAAGTATGAGATTATGTAAAGTAACTGAACCTATGAGTCACAGGTATTCCTGAGGAA +AAAGAAAAAGTGAGAAGTTTGGAAAAACTATTTGAGGAAGTAATTGGGGAAAACCTCTTT +AGTCTTGCTAGAGATTTAGACATCTAAATGAAAGAGGCTCAAAGAATGCCAGGAAGATAC +ATTGCAAGACAGACTTCATCAAGATATGTAGTCATCAGACTATCTAAAGTCAACATGAAG +GAAAAAAATTCTAAAATCAGCAAGAGAAAAGCATACAGTCATCTATAAAGGAAATCCCAT +CAGAATAACAATGGGCTTCTCAGCAGAAACCTTACAAGCCAGAAGAGATTGGATCTAATT +TTTGGACTTCTTAAAGAAAAAAAAACCTGTCAAACACGAATGTTATGCCCTGCTAAACTA +AGCATCATAAATGAAGGGGAAATAAAGTCAAGTCTTTCCTGACAAGCAAATGCTAAGATA +ATTCATCATCACTAAACCAGTCCTATAAGAAATGCTCAAAAGAATTGTAAAAGTCAAAAT +TAAAGTTCAATACTCACCATCATAAATACACACAAAAGTACAAAACTCACAGGTTTTATA +AAACAATTGAGACTACAGAGCAACTAGGTAAAAAATTAACATTACAACAGGAACAAAACC +TCATATATCAATATTAACTTTGAATAAAAAGGGATTAAATTCCCCCACTTAAGAGATATA +GATTGGCAGAACAGATTTAAAAACATGAACTAACTATATGCTGTTTACAAGAAACTCATT +AATAAAGACATGAGTTCAGGTAAAGGGGTGGAAAAAGATGTTCTACGCAAACAGAAACCA +AATGAGAGAAGGAGTAGCTATACTTATATCAGATAAAGCACACTTTAAATCAACAACAGT +AAAATAAAACAAAGGAGGTCATCATACAATGATAAAAAGATCAATTCAGCAAGAAGATAT +AACCATCCTACTAAATACATATGCACCTAACACAAGACTACCCAGATTCATAAAACAAAT +ACTACTAGACCTAAGAGGGATGAGAAATTACCTAATTGGTACAATGTACAATATTCTGAT +GATGGTTACACTAAAAGCCCATACTTTACTGCTACTCAATATATCCATGTAACAAATCTG +CGCTTGTACTTCTAAATCTATAAAAAAATTAAAATTTAACAAAAGTAAATAAAACACATA +GCTAAAACTAAAAAAGCAAAAACAAAAACTATGCTAAGTATTGGTAAAGATGTGGGGAAA +AAAGTAAACTCTCAAATATTGCTAGTGGGAGTATAAATTGTTTTCCACTTTGGAAAACAA +TTTGGTAATTTCGTTTTTTTTTTTTTCTTTTCTCTTTTTTTTTTTTTTTTTTTTGCATGC +CAGAAAAAAATATTTACAGTAACT
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/SNV/SNVMix2_source/SNVMix2-v0.12.1-rc1/samtools-0.1.6/faidx.c Wed Oct 12 19:50:38 2011 -0400 @@ -0,0 +1,328 @@ +#include <ctype.h> +#include <string.h> +#include <stdlib.h> +#include <stdio.h> +#include "faidx.h" +#include "khash.h" + +typedef struct { + uint64_t len:32, line_len:16, line_blen:16; + uint64_t offset; +} faidx1_t; +KHASH_MAP_INIT_STR(s, faidx1_t) + +#ifndef _NO_RAZF +#include "razf.h" +#else +#ifdef _WIN32 +#define ftello(fp) ftell(fp) +#define fseeko(fp, offset, whence) fseek(fp, offset, whence) +#else +extern off_t ftello(FILE *stream); +extern int fseeko(FILE *stream, off_t offset, int whence); +#endif +#define RAZF FILE +#define razf_read(fp, buf, size) fread(buf, 1, size, fp) +#define razf_open(fn, mode) fopen(fn, mode) +#define razf_close(fp) fclose(fp) +#define razf_seek(fp, offset, whence) fseeko(fp, offset, whence) +#define razf_tell(fp) ftello(fp) +#endif + +struct __faidx_t { + RAZF *rz; + int n, m; + char **name; + khash_t(s) *hash; +}; + +#ifndef kroundup32 +#define kroundup32(x) (--(x), (x)|=(x)>>1, (x)|=(x)>>2, (x)|=(x)>>4, (x)|=(x)>>8, (x)|=(x)>>16, ++(x)) +#endif + +static inline void fai_insert_index(faidx_t *idx, const char *name, int len, int line_len, int line_blen, uint64_t offset) +{ + khint_t k; + int ret; + faidx1_t t; + if (idx->n == idx->m) { + idx->m = idx->m? idx->m<<1 : 16; + idx->name = (char**)realloc(idx->name, sizeof(void*) * idx->m); + } + idx->name[idx->n] = strdup(name); + k = kh_put(s, idx->hash, idx->name[idx->n], &ret); + t.len = len; t.line_len = line_len; t.line_blen = line_blen; t.offset = offset; + kh_value(idx->hash, k) = t; + ++idx->n; +} + +faidx_t *fai_build_core(RAZF *rz) +{ + char c, *name; + int l_name, m_name, ret; + int len, line_len, line_blen, state; + int l1, l2; + faidx_t *idx; + uint64_t offset; + + idx = (faidx_t*)calloc(1, sizeof(faidx_t)); + idx->hash = kh_init(s); + name = 0; l_name = m_name = 0; + len = line_len = line_blen = -1; state = 0; l1 = l2 = -1; offset = 0; + while (razf_read(rz, &c, 1)) { + if (c == '\n') { // an empty line + if (state == 1) { + offset = razf_tell(rz); + continue; + } else if ((state == 0 && len < 0) || state == 2) continue; + } + if (c == '>') { // fasta header + if (len >= 0) + fai_insert_index(idx, name, len, line_len, line_blen, offset); + l_name = 0; + while ((ret = razf_read(rz, &c, 1)) != 0 && !isspace(c)) { + if (m_name < l_name + 2) { + m_name = l_name + 2; + kroundup32(m_name); + name = (char*)realloc(name, m_name); + } + name[l_name++] = c; + } + name[l_name] = '\0'; + if (ret == 0) { + fprintf(stderr, "[fai_build_core] the last entry has no sequence\n"); + free(name); fai_destroy(idx); + return 0; + } + if (c != '\n') while (razf_read(rz, &c, 1) && c != '\n'); + state = 1; len = 0; + offset = razf_tell(rz); + } else { + if (state == 3) { + fprintf(stderr, "[fai_build_core] inlined empty line is not allowed in sequence '%s'.\n", name); + free(name); fai_destroy(idx); + return 0; + } + if (state == 2) state = 3; + l1 = l2 = 0; + do { + ++l1; + if (isgraph(c)) ++l2; + } while ((ret = razf_read(rz, &c, 1)) && c != '\n'); + if (state == 3 && l2) { + fprintf(stderr, "[fai_build_core] different line length in sequence '%s'.\n", name); + free(name); fai_destroy(idx); + return 0; + } + ++l1; len += l2; + if (l2 >= 0x10000) { + fprintf(stderr, "[fai_build_core] line length exceeds 65535 in sequence '%s'.\n", name); + free(name); fai_destroy(idx); + return 0; + } + if (state == 1) line_len = l1, line_blen = l2, state = 0; + else if (state == 0) { + if (l1 != line_len || l2 != line_blen) state = 2; + } + } + } + fai_insert_index(idx, name, len, line_len, line_blen, offset); + free(name); + return idx; +} + +void fai_save(const faidx_t *fai, FILE *fp) +{ + khint_t k; + int i; + for (i = 0; i < fai->n; ++i) { + faidx1_t x; + k = kh_get(s, fai->hash, fai->name[i]); + x = kh_value(fai->hash, k); +#ifdef _WIN32 + fprintf(fp, "%s\t%d\t%ld\t%d\t%d\n", fai->name[i], (int)x.len, (long)x.offset, (int)x.line_blen, (int)x.line_len); +#else + fprintf(fp, "%s\t%d\t%lld\t%d\t%d\n", fai->name[i], (int)x.len, (long long)x.offset, (int)x.line_blen, (int)x.line_len); +#endif + } +} + +faidx_t *fai_read(FILE *fp) +{ + faidx_t *fai; + char *buf, *p; + int len, line_len, line_blen; +#ifdef _WIN32 + long offset; +#else + long long offset; +#endif + fai = (faidx_t*)calloc(1, sizeof(faidx_t)); + fai->hash = kh_init(s); + buf = (char*)calloc(0x10000, 1); + while (!feof(fp) && fgets(buf, 0x10000, fp)) { + for (p = buf; *p && isgraph(*p); ++p); + *p = 0; ++p; +#ifdef _WIN32 + sscanf(p, "%d%ld%d%d", &len, &offset, &line_blen, &line_len); +#else + sscanf(p, "%d%lld%d%d", &len, &offset, &line_blen, &line_len); +#endif + fai_insert_index(fai, buf, len, line_len, line_blen, offset); + } + free(buf); + return fai; +} + +void fai_destroy(faidx_t *fai) +{ + int i; + for (i = 0; i < fai->n; ++i) free(fai->name[i]); + free(fai->name); + kh_destroy(s, fai->hash); + if (fai->rz) razf_close(fai->rz); + free(fai); +} + +int fai_build(const char *fn) +{ + char *str; + RAZF *rz; + FILE *fp; + faidx_t *fai; + str = (char*)calloc(strlen(fn) + 5, 1); + sprintf(str, "%s.fai", fn); + rz = razf_open(fn, "r"); + if (rz == 0) { + fprintf(stderr, "[fai_build] fail to open the FASTA file.\n"); + free(str); + return -1; + } + fai = fai_build_core(rz); + razf_close(rz); + fp = fopen(str, "wb"); + if (fp == 0) { + fprintf(stderr, "[fai_build] fail to write FASTA index.\n"); + fai_destroy(fai); free(str); + return -1; + } + fai_save(fai, fp); + fclose(fp); + free(str); + fai_destroy(fai); + return 0; +} + +faidx_t *fai_load(const char *fn) +{ + char *str; + FILE *fp; + faidx_t *fai; + str = (char*)calloc(strlen(fn) + 5, 1); + sprintf(str, "%s.fai", fn); + fp = fopen(str, "rb"); + if (fp == 0) { + fprintf(stderr, "[fai_load] build FASTA index.\n"); + fai_build(fn); + fp = fopen(str, "r"); + if (fp == 0) { + fprintf(stderr, "[fai_load] fail to open FASTA index.\n"); + free(str); + return 0; + } + } + fai = fai_read(fp); + fclose(fp); + fai->rz = razf_open(fn, "rb"); + free(str); + if (fai->rz == 0) { + fprintf(stderr, "[fai_load] fail to open FASTA file.\n"); + return 0; + } + return fai; +} + +char *fai_fetch(const faidx_t *fai, const char *str, int *len) +{ + char *s, *p, c; + int i, l, k; + khiter_t iter; + faidx1_t val; + khash_t(s) *h; + int beg, end; + + beg = end = -1; + h = fai->hash; + l = strlen(str); + p = s = (char*)malloc(l+1); + /* squeeze out "," */ + for (i = k = 0; i != l; ++i) + if (str[i] != ',' && !isspace(str[i])) s[k++] = str[i]; + s[k] = 0; + for (i = 0; i != k; ++i) if (s[i] == ':') break; + s[i] = 0; + iter = kh_get(s, h, s); /* get the ref_id */ + if (iter == kh_end(h)) { + *len = 0; + free(s); return 0; + } + val = kh_value(h, iter); + if (i == k) { /* dump the whole sequence */ + beg = 0; end = val.len; + } else { + for (p = s + i + 1; i != k; ++i) if (s[i] == '-') break; + beg = atoi(p); + if (i < k) { + p = s + i + 1; + end = atoi(p); + } else end = val.len; + } + if (beg > 0) --beg; + if (beg >= val.len) beg = val.len; + if (end >= val.len) end = val.len; + if (beg > end) beg = end; + free(s); + + // now retrieve the sequence + l = 0; + s = (char*)malloc(end - beg + 2); + razf_seek(fai->rz, val.offset + beg / val.line_blen * val.line_len + beg % val.line_blen, SEEK_SET); + while (razf_read(fai->rz, &c, 1) == 1 && l < end - beg) + if (isgraph(c)) s[l++] = c; + s[l] = '\0'; + *len = l; + return s; +} + +int faidx_main(int argc, char *argv[]) +{ + if (argc == 1) { + fprintf(stderr, "Usage: faidx <in.fasta> [<reg> [...]]\n"); + return 1; + } else { + if (argc == 2) fai_build(argv[1]); + else { + int i, j, k, l; + char *s; + faidx_t *fai; + fai = fai_load(argv[1]); + if (fai == 0) return 1; + for (i = 2; i != argc; ++i) { + printf(">%s\n", argv[i]); + s = fai_fetch(fai, argv[i], &l); + for (j = 0; j < l; j += 60) { + for (k = 0; k < 60 && k < l - j; ++k) + putchar(s[j + k]); + putchar('\n'); + } + free(s); + } + fai_destroy(fai); + } + } + return 0; +} + +#ifdef FAIDX_MAIN +int main(int argc, char *argv[]) { return faidx_main(argc, argv); } +#endif
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/SNV/SNVMix2_source/SNVMix2-v0.12.1-rc1/samtools-0.1.6/faidx.h Wed Oct 12 19:50:38 2011 -0400 @@ -0,0 +1,82 @@ +/* The MIT License + + Copyright (c) 2008 Genome Research Ltd (GRL). + + Permission is hereby granted, free of charge, to any person obtaining + a copy of this software and associated documentation files (the + "Software"), to deal in the Software without restriction, including + without limitation the rights to use, copy, modify, merge, publish, + distribute, sublicense, and/or sell copies of the Software, and to + permit persons to whom the Software is furnished to do so, subject to + the following conditions: + + The above copyright notice and this permission notice shall be + included in all copies or substantial portions of the Software. + + THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, + EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF + MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND + NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS + BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN + ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN + CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE + SOFTWARE. +*/ + +/* Contact: Heng Li <lh3@sanger.ac.uk> */ + +#ifndef FAIDX_H +#define FAIDX_H + +/*! + @header + + Index FASTA files and extract subsequence. + + @copyright The Wellcome Trust Sanger Institute. + */ + +struct __faidx_t; +typedef struct __faidx_t faidx_t; + +#ifdef __cplusplus +extern "C" { +#endif + + /*! + @abstract Build index for a FASTA or razip compressed FASTA file. + @param fn FASTA file name + @return 0 on success; or -1 on failure + @discussion File "fn.fai" will be generated. + */ + int fai_build(const char *fn); + + /*! + @abstract Distroy a faidx_t struct. + @param fai Pointer to the struct to be destroyed + */ + void fai_destroy(faidx_t *fai); + + /*! + @abstract Load index from "fn.fai". + @param fn File name of the FASTA file + */ + faidx_t *fai_load(const char *fn); + + /*! + @abstract Fetch the sequence in a region. + @param fai Pointer to the faidx_t struct + @param reg Region in the format "chr2:20,000-30,000" + @param len Length of the region + @return Pointer to the sequence; null on failure + + @discussion The returned sequence is allocated by malloc family + and should be destroyed by end users by calling free() on it. + */ + char *fai_fetch(const faidx_t *fai, const char *reg, int *len); + +#ifdef __cplusplus +} +#endif + +#endif
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/SNV/SNVMix2_source/SNVMix2-v0.12.1-rc1/samtools-0.1.6/glf.c Wed Oct 12 19:50:38 2011 -0400 @@ -0,0 +1,236 @@ +#include <string.h> +#include <stdlib.h> +#include "glf.h" + +#ifdef _NO_BGZF +// then alias bgzf_*() functions +#endif + +static int glf3_is_BE = 0; + +static inline uint32_t bam_swap_endian_4(uint32_t v) +{ + v = ((v & 0x0000FFFFU) << 16) | (v >> 16); + return ((v & 0x00FF00FFU) << 8) | ((v & 0xFF00FF00U) >> 8); +} + +static inline uint16_t bam_swap_endian_2(uint16_t v) +{ + return (uint16_t)(((v & 0x00FF00FFU) << 8) | ((v & 0xFF00FF00U) >> 8)); +} + +static inline int bam_is_big_endian() +{ + long one= 1; + return !(*((char *)(&one))); +} + +glf3_header_t *glf3_header_init() +{ + glf3_is_BE = bam_is_big_endian(); + return (glf3_header_t*)calloc(1, sizeof(glf3_header_t)); +} + +glf3_header_t *glf3_header_read(glfFile fp) +{ + glf3_header_t *h; + char magic[4]; + h = glf3_header_init(); + bgzf_read(fp, magic, 4); + if (strncmp(magic, "GLF\3", 4)) { + fprintf(stderr, "[glf3_header_read] invalid magic.\n"); + glf3_header_destroy(h); + return 0; + } + bgzf_read(fp, &h->l_text, 4); + if (glf3_is_BE) h->l_text = bam_swap_endian_4(h->l_text); + if (h->l_text) { + h->text = (uint8_t*)calloc(h->l_text + 1, 1); + bgzf_read(fp, h->text, h->l_text); + } + return h; +} + +void glf3_header_write(glfFile fp, const glf3_header_t *h) +{ + int32_t x; + bgzf_write(fp, "GLF\3", 4); + x = glf3_is_BE? bam_swap_endian_4(h->l_text) : h->l_text; + bgzf_write(fp, &x, 4); + if (h->l_text) bgzf_write(fp, h->text, h->l_text); +} + +void glf3_header_destroy(glf3_header_t *h) +{ + free(h->text); + free(h); +} + +char *glf3_ref_read(glfFile fp, int *len) +{ + int32_t n, x; + char *str; + *len = 0; + if (bgzf_read(fp, &n, 4) != 4) return 0; + if (glf3_is_BE) n = bam_swap_endian_4(n); + if (n < 0) { + fprintf(stderr, "[glf3_ref_read] invalid reference name length: %d.\n", n); + return 0; + } + str = (char*)calloc(n + 1, 1); // not necesarily n+1 in fact + x = bgzf_read(fp, str, n); + x += bgzf_read(fp, len, 4); + if (x != n + 4) { + free(str); *len = -1; return 0; // truncated + } + if (glf3_is_BE) *len = bam_swap_endian_4(*len); + return str; +} + +void glf3_ref_write(glfFile fp, const char *str, int len) +{ + int32_t m, n = strlen(str) + 1; + m = glf3_is_BE? bam_swap_endian_4(n) : n; + bgzf_write(fp, &m, 4); + bgzf_write(fp, str, n); + if (glf3_is_BE) len = bam_swap_endian_4(len); + bgzf_write(fp, &len, 4); +} + +void glf3_view1(const char *ref_name, const glf3_t *g3, int pos) +{ + int j; + if (g3->rtype == GLF3_RTYPE_END) return; + printf("%s\t%d\t%c\t%d\t%d\t%d", ref_name, pos + 1, + g3->rtype == GLF3_RTYPE_INDEL? '*' : "XACMGRSVTWYHKDBN"[g3->ref_base], + g3->depth, g3->rms_mapQ, g3->min_lk); + if (g3->rtype == GLF3_RTYPE_SUB) + for (j = 0; j != 10; ++j) printf("\t%d", g3->lk[j]); + else { + printf("\t%d\t%d\t%d\t%d\t%d\t%s\t%s\t", g3->lk[0], g3->lk[1], g3->lk[2], g3->indel_len[0], g3->indel_len[1], + g3->indel_len[0]? g3->indel_seq[0] : "*", g3->indel_len[1]? g3->indel_seq[1] : "*"); + } + printf("\n"); +} + +int glf3_write1(glfFile fp, const glf3_t *g3) +{ + int r; + uint8_t c; + uint32_t y[2]; + c = g3->rtype<<4 | g3->ref_base; + r = bgzf_write(fp, &c, 1); + if (g3->rtype == GLF3_RTYPE_END) return r; + y[0] = g3->offset; + y[1] = g3->min_lk<<24 | g3->depth; + if (glf3_is_BE) { + y[0] = bam_swap_endian_4(y[0]); + y[1] = bam_swap_endian_4(y[1]); + } + r += bgzf_write(fp, y, 8); + r += bgzf_write(fp, &g3->rms_mapQ, 1); + if (g3->rtype == GLF3_RTYPE_SUB) r += bgzf_write(fp, g3->lk, 10); + else { + int16_t x[2]; + r += bgzf_write(fp, g3->lk, 3); + x[0] = glf3_is_BE? bam_swap_endian_2(g3->indel_len[0]) : g3->indel_len[0]; + x[1] = glf3_is_BE? bam_swap_endian_2(g3->indel_len[1]) : g3->indel_len[1]; + r += bgzf_write(fp, x, 4); + if (g3->indel_len[0]) r += bgzf_write(fp, g3->indel_seq[0], abs(g3->indel_len[0])); + if (g3->indel_len[1]) r += bgzf_write(fp, g3->indel_seq[1], abs(g3->indel_len[1])); + } + return r; +} + +#ifndef kv_roundup32 +#define kv_roundup32(x) (--(x), (x)|=(x)>>1, (x)|=(x)>>2, (x)|=(x)>>4, (x)|=(x)>>8, (x)|=(x)>>16, ++(x)) +#endif + +int glf3_read1(glfFile fp, glf3_t *g3) +{ + int r; + uint8_t c; + uint32_t y[2]; + r = bgzf_read(fp, &c, 1); + if (r == 0) return 0; + g3->ref_base = c & 0xf; + g3->rtype = c>>4; + if (g3->rtype == GLF3_RTYPE_END) return r; + r += bgzf_read(fp, y, 8); + if (glf3_is_BE) { + y[0] = bam_swap_endian_4(y[0]); + y[1] = bam_swap_endian_4(y[1]); + } + g3->offset = y[0]; + g3->min_lk = y[1]>>24; + g3->depth = y[1]<<8>>8; + r += bgzf_read(fp, &g3->rms_mapQ, 1); + if (g3->rtype == GLF3_RTYPE_SUB) r += bgzf_read(fp, g3->lk, 10); + else { + int16_t x[2], max; + r += bgzf_read(fp, g3->lk, 3); + r += bgzf_read(fp, x, 4); + if (glf3_is_BE) { + x[0] = bam_swap_endian_2(x[0]); + x[1] = bam_swap_endian_2(x[1]); + } + g3->indel_len[0] = x[0]; + g3->indel_len[1] = x[1]; + x[0] = abs(x[0]); x[1] = abs(x[1]); + max = (x[0] > x[1]? x[0] : x[1]) + 1; + if (g3->max_len < max) { + g3->max_len = max; + kv_roundup32(g3->max_len); + g3->indel_seq[0] = (char*)realloc(g3->indel_seq[0], g3->max_len); + g3->indel_seq[1] = (char*)realloc(g3->indel_seq[1], g3->max_len); + } + r += bgzf_read(fp, g3->indel_seq[0], x[0]); + r += bgzf_read(fp, g3->indel_seq[1], x[1]); + g3->indel_seq[0][x[0]] = g3->indel_seq[1][x[1]] = 0; + } + return r; +} + +void glf3_view(glfFile fp) +{ + glf3_header_t *h; + char *name; + glf3_t *g3; + int len; + h = glf3_header_read(fp); + g3 = glf3_init1(); + while ((name = glf3_ref_read(fp, &len)) != 0) { + int pos = 0; + while (glf3_read1(fp, g3) && g3->rtype != GLF3_RTYPE_END) { + pos += g3->offset; + glf3_view1(name, g3, pos); + } + free(name); + } + glf3_header_destroy(h); + glf3_destroy1(g3); +} + +int glf3_view_main(int argc, char *argv[]) +{ + glfFile fp; + if (argc == 1) { + fprintf(stderr, "Usage: glfview <in.glf>\n"); + return 1; + } + fp = (strcmp(argv[1], "-") == 0)? bgzf_fdopen(fileno(stdin), "r") : bgzf_open(argv[1], "r"); + if (fp == 0) { + fprintf(stderr, "Fail to open file '%s'\n", argv[1]); + return 1; + } + glf3_view(fp); + bgzf_close(fp); + return 0; +} + +#ifdef GLFVIEW_MAIN +int main(int argc, char *argv[]) +{ + return glf3_view_main(argc, argv); +} +#endif
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/SNV/SNVMix2_source/SNVMix2-v0.12.1-rc1/samtools-0.1.6/glf.h Wed Oct 12 19:50:38 2011 -0400 @@ -0,0 +1,56 @@ +#ifndef GLF_H_ +#define GLF_H_ + +typedef struct { + unsigned char ref_base:4, dummy:4; /** "XACMGRSVTWYHKDBN"[ref_base] gives the reference base */ + unsigned char max_mapQ; /** maximum mapping quality */ + unsigned char lk[10]; /** log likelihood ratio, capped at 255 */ + unsigned min_lk:8, depth:24; /** minimum lk capped at 255, and the number of mapped reads */ +} glf1_t; + +#include <stdint.h> +#include "bgzf.h" +typedef BGZF *glfFile; + +#define GLF3_RTYPE_END 0 +#define GLF3_RTYPE_SUB 1 +#define GLF3_RTYPE_INDEL 2 + +typedef struct { + uint8_t ref_base:4, rtype:4; /** "XACMGRSVTWYHKDBN"[ref_base] gives the reference base */ + uint8_t rms_mapQ; /** RMS mapping quality */ + uint8_t lk[10]; /** log likelihood ratio, capped at 255 */ + uint32_t min_lk:8, depth:24; /** minimum lk capped at 255, and the number of mapped reads */ + int32_t offset; /** the first base in a chromosome has offset zero. */ + // for indel (lkHom1, lkHom2 and lkHet are the first three elements in lk[10]) + int16_t indel_len[2]; + int32_t max_len; // maximum indel len; will be modified by glf3_read1() + char *indel_seq[2]; +} glf3_t; + +typedef struct { + int32_t l_text; + uint8_t *text; +} glf3_header_t; + +#ifdef __cplusplus +extern "C" { +#endif + +#define glf3_init1() ((glf3_t*)calloc(1, sizeof(glf3_t))) +#define glf3_destroy1(g3) do { free((g3)->indel_seq[0]); free((g3)->indel_seq[1]); free(g3); } while (0) + + glf3_header_t *glf3_header_init(); + glf3_header_t *glf3_header_read(glfFile fp); + void glf3_header_write(glfFile fp, const glf3_header_t *h); + void glf3_header_destroy(glf3_header_t *h); + char *glf3_ref_read(glfFile fp, int *len); + void glf3_ref_write(glfFile fp, const char *name, int len); + int glf3_write1(glfFile fp, const glf3_t *g3); + int glf3_read1(glfFile fp, glf3_t *g3); + +#ifdef __cplusplus +} +#endif + +#endif
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/SNV/SNVMix2_source/SNVMix2-v0.12.1-rc1/samtools-0.1.6/khash.h Wed Oct 12 19:50:38 2011 -0400 @@ -0,0 +1,486 @@ +/* The MIT License + + Copyright (c) 2008 Genome Research Ltd (GRL). + + Permission is hereby granted, free of charge, to any person obtaining + a copy of this software and associated documentation files (the + "Software"), to deal in the Software without restriction, including + without limitation the rights to use, copy, modify, merge, publish, + distribute, sublicense, and/or sell copies of the Software, and to + permit persons to whom the Software is furnished to do so, subject to + the following conditions: + + The above copyright notice and this permission notice shall be + included in all copies or substantial portions of the Software. + + THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, + EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF + MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND + NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS + BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN + ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN + CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE + SOFTWARE. +*/ + +/* Contact: Heng Li <lh3@sanger.ac.uk> */ + +/* + An example: + +#include "khash.h" +KHASH_MAP_INIT_INT(32, char) +int main() { + int ret, is_missing; + khiter_t k; + khash_t(32) *h = kh_init(32); + k = kh_put(32, h, 5, &ret); + if (!ret) kh_del(32, h, k); + kh_value(h, k) = 10; + k = kh_get(32, h, 10); + is_missing = (k == kh_end(h)); + k = kh_get(32, h, 5); + kh_del(32, h, k); + for (k = kh_begin(h); k != kh_end(h); ++k) + if (kh_exist(h, k)) kh_value(h, k) = 1; + kh_destroy(32, h); + return 0; +} +*/ + +/* + 2008-09-19 (0.2.3): + + * Corrected the example + * Improved interfaces + + 2008-09-11 (0.2.2): + + * Improved speed a little in kh_put() + + 2008-09-10 (0.2.1): + + * Added kh_clear() + * Fixed a compiling error + + 2008-09-02 (0.2.0): + + * Changed to token concatenation which increases flexibility. + + 2008-08-31 (0.1.2): + + * Fixed a bug in kh_get(), which has not been tested previously. + + 2008-08-31 (0.1.1): + + * Added destructor +*/ + + +#ifndef __AC_KHASH_H +#define __AC_KHASH_H + +/*! + @header + + Generic hash table library. + + @copyright Heng Li + */ + +#define AC_VERSION_KHASH_H "0.2.2" + +#include <stdint.h> +#include <stdlib.h> +#include <string.h> + +typedef uint32_t khint_t; +typedef khint_t khiter_t; + +#define __ac_HASH_PRIME_SIZE 32 +static const uint32_t __ac_prime_list[__ac_HASH_PRIME_SIZE] = +{ + 0ul, 3ul, 11ul, 23ul, 53ul, + 97ul, 193ul, 389ul, 769ul, 1543ul, + 3079ul, 6151ul, 12289ul, 24593ul, 49157ul, + 98317ul, 196613ul, 393241ul, 786433ul, 1572869ul, + 3145739ul, 6291469ul, 12582917ul, 25165843ul, 50331653ul, + 100663319ul, 201326611ul, 402653189ul, 805306457ul, 1610612741ul, + 3221225473ul, 4294967291ul +}; + +#define __ac_isempty(flag, i) ((flag[i>>4]>>((i&0xfU)<<1))&2) +#define __ac_isdel(flag, i) ((flag[i>>4]>>((i&0xfU)<<1))&1) +#define __ac_iseither(flag, i) ((flag[i>>4]>>((i&0xfU)<<1))&3) +#define __ac_set_isdel_false(flag, i) (flag[i>>4]&=~(1ul<<((i&0xfU)<<1))) +#define __ac_set_isempty_false(flag, i) (flag[i>>4]&=~(2ul<<((i&0xfU)<<1))) +#define __ac_set_isboth_false(flag, i) (flag[i>>4]&=~(3ul<<((i&0xfU)<<1))) +#define __ac_set_isdel_true(flag, i) (flag[i>>4]|=1ul<<((i&0xfU)<<1)) + +static const double __ac_HASH_UPPER = 0.77; + +#define KHASH_INIT(name, khkey_t, khval_t, kh_is_map, __hash_func, __hash_equal) \ + typedef struct { \ + khint_t n_buckets, size, n_occupied, upper_bound; \ + uint32_t *flags; \ + khkey_t *keys; \ + khval_t *vals; \ + } kh_##name##_t; \ + static inline kh_##name##_t *kh_init_##name() { \ + return (kh_##name##_t*)calloc(1, sizeof(kh_##name##_t)); \ + } \ + static inline void kh_destroy_##name(kh_##name##_t *h) \ + { \ + if (h) { \ + free(h->keys); free(h->flags); \ + free(h->vals); \ + free(h); \ + } \ + } \ + static inline void kh_clear_##name(kh_##name##_t *h) \ + { \ + if (h && h->flags) { \ + memset(h->flags, 0xaa, ((h->n_buckets>>4) + 1) * sizeof(uint32_t)); \ + h->size = h->n_occupied = 0; \ + } \ + } \ + static inline khint_t kh_get_##name(const kh_##name##_t *h, khkey_t key) \ + { \ + if (h->n_buckets) { \ + khint_t inc, k, i, last; \ + k = __hash_func(key); i = k % h->n_buckets; \ + inc = 1 + k % (h->n_buckets - 1); last = i; \ + while (!__ac_isempty(h->flags, i) && (__ac_isdel(h->flags, i) || !__hash_equal(h->keys[i], key))) { \ + if (i + inc >= h->n_buckets) i = i + inc - h->n_buckets; \ + else i += inc; \ + if (i == last) return h->n_buckets; \ + } \ + return __ac_iseither(h->flags, i)? h->n_buckets : i; \ + } else return 0; \ + } \ + static inline void kh_resize_##name(kh_##name##_t *h, khint_t new_n_buckets) \ + { \ + uint32_t *new_flags = 0; \ + khint_t j = 1; \ + { \ + khint_t t = __ac_HASH_PRIME_SIZE - 1; \ + while (__ac_prime_list[t] > new_n_buckets) --t; \ + new_n_buckets = __ac_prime_list[t+1]; \ + if (h->size >= (khint_t)(new_n_buckets * __ac_HASH_UPPER + 0.5)) j = 0; \ + else { \ + new_flags = (uint32_t*)malloc(((new_n_buckets>>4) + 1) * sizeof(uint32_t)); \ + memset(new_flags, 0xaa, ((new_n_buckets>>4) + 1) * sizeof(uint32_t)); \ + if (h->n_buckets < new_n_buckets) { \ + h->keys = (khkey_t*)realloc(h->keys, new_n_buckets * sizeof(khkey_t)); \ + if (kh_is_map) \ + h->vals = (khval_t*)realloc(h->vals, new_n_buckets * sizeof(khval_t)); \ + } \ + } \ + } \ + if (j) { \ + for (j = 0; j != h->n_buckets; ++j) { \ + if (__ac_iseither(h->flags, j) == 0) { \ + khkey_t key = h->keys[j]; \ + khval_t val; \ + if (kh_is_map) val = h->vals[j]; \ + __ac_set_isdel_true(h->flags, j); \ + while (1) { \ + khint_t inc, k, i; \ + k = __hash_func(key); \ + i = k % new_n_buckets; \ + inc = 1 + k % (new_n_buckets - 1); \ + while (!__ac_isempty(new_flags, i)) { \ + if (i + inc >= new_n_buckets) i = i + inc - new_n_buckets; \ + else i += inc; \ + } \ + __ac_set_isempty_false(new_flags, i); \ + if (i < h->n_buckets && __ac_iseither(h->flags, i) == 0) { \ + { khkey_t tmp = h->keys[i]; h->keys[i] = key; key = tmp; } \ + if (kh_is_map) { khval_t tmp = h->vals[i]; h->vals[i] = val; val = tmp; } \ + __ac_set_isdel_true(h->flags, i); \ + } else { \ + h->keys[i] = key; \ + if (kh_is_map) h->vals[i] = val; \ + break; \ + } \ + } \ + } \ + } \ + if (h->n_buckets > new_n_buckets) { \ + h->keys = (khkey_t*)realloc(h->keys, new_n_buckets * sizeof(khkey_t)); \ + if (kh_is_map) \ + h->vals = (khval_t*)realloc(h->vals, new_n_buckets * sizeof(khval_t)); \ + } \ + free(h->flags); \ + h->flags = new_flags; \ + h->n_buckets = new_n_buckets; \ + h->n_occupied = h->size; \ + h->upper_bound = (khint_t)(h->n_buckets * __ac_HASH_UPPER + 0.5); \ + } \ + } \ + static inline khint_t kh_put_##name(kh_##name##_t *h, khkey_t key, int *ret) \ + { \ + khint_t x; \ + if (h->n_occupied >= h->upper_bound) { \ + if (h->n_buckets > (h->size<<1)) kh_resize_##name(h, h->n_buckets - 1); \ + else kh_resize_##name(h, h->n_buckets + 1); \ + } \ + { \ + khint_t inc, k, i, site, last; \ + x = site = h->n_buckets; k = __hash_func(key); i = k % h->n_buckets; \ + if (__ac_isempty(h->flags, i)) x = i; \ + else { \ + inc = 1 + k % (h->n_buckets - 1); last = i; \ + while (!__ac_isempty(h->flags, i) && (__ac_isdel(h->flags, i) || !__hash_equal(h->keys[i], key))) { \ + if (__ac_isdel(h->flags, i)) site = i; \ + if (i + inc >= h->n_buckets) i = i + inc - h->n_buckets; \ + else i += inc; \ + if (i == last) { x = site; break; } \ + } \ + if (x == h->n_buckets) { \ + if (__ac_isempty(h->flags, i) && site != h->n_buckets) x = site; \ + else x = i; \ + } \ + } \ + } \ + if (__ac_isempty(h->flags, x)) { \ + h->keys[x] = key; \ + __ac_set_isboth_false(h->flags, x); \ + ++h->size; ++h->n_occupied; \ + *ret = 1; \ + } else if (__ac_isdel(h->flags, x)) { \ + h->keys[x] = key; \ + __ac_set_isboth_false(h->flags, x); \ + ++h->size; \ + *ret = 2; \ + } else *ret = 0; \ + return x; \ + } \ + static inline void kh_del_##name(kh_##name##_t *h, khint_t x) \ + { \ + if (x != h->n_buckets && !__ac_iseither(h->flags, x)) { \ + __ac_set_isdel_true(h->flags, x); \ + --h->size; \ + } \ + } + +/* --- BEGIN OF HASH FUNCTIONS --- */ + +/*! @function + @abstract Integer hash function + @param key The integer [uint32_t] + @return The hash value [khint_t] + */ +#define kh_int_hash_func(key) (uint32_t)(key) +/*! @function + @abstract Integer comparison function + */ +#define kh_int_hash_equal(a, b) ((a) == (b)) +/*! @function + @abstract 64-bit integer hash function + @param key The integer [uint64_t] + @return The hash value [khint_t] + */ +#define kh_int64_hash_func(key) (uint32_t)((key)>>33^(key)^(key)<<11) +/*! @function + @abstract 64-bit integer comparison function + */ +#define kh_int64_hash_equal(a, b) ((a) == (b)) +/*! @function + @abstract const char* hash function + @param s Pointer to a null terminated string + @return The hash value + */ +static inline khint_t __ac_X31_hash_string(const char *s) +{ + khint_t h = *s; + if (h) for (++s ; *s; ++s) h = (h << 5) - h + *s; + return h; +} +/*! @function + @abstract Another interface to const char* hash function + @param key Pointer to a null terminated string [const char*] + @return The hash value [khint_t] + */ +#define kh_str_hash_func(key) __ac_X31_hash_string(key) +/*! @function + @abstract Const char* comparison function + */ +#define kh_str_hash_equal(a, b) (strcmp(a, b) == 0) + +/* --- END OF HASH FUNCTIONS --- */ + +/* Other necessary macros... */ + +/*! + @abstract Type of the hash table. + @param name Name of the hash table [symbol] + */ +#define khash_t(name) kh_##name##_t + +/*! @function + @abstract Initiate a hash table. + @param name Name of the hash table [symbol] + @return Pointer to the hash table [khash_t(name)*] + */ +#define kh_init(name) kh_init_##name() + +/*! @function + @abstract Destroy a hash table. + @param name Name of the hash table [symbol] + @param h Pointer to the hash table [khash_t(name)*] + */ +#define kh_destroy(name, h) kh_destroy_##name(h) + +/*! @function + @abstract Reset a hash table without deallocating memory. + @param name Name of the hash table [symbol] + @param h Pointer to the hash table [khash_t(name)*] + */ +#define kh_clear(name, h) kh_clear_##name(h) + +/*! @function + @abstract Resize a hash table. + @param name Name of the hash table [symbol] + @param h Pointer to the hash table [khash_t(name)*] + @param s New size [khint_t] + */ +#define kh_resize(name, h, s) kh_resize_##name(h, s) + +/*! @function + @abstract Insert a key to the hash table. + @param name Name of the hash table [symbol] + @param h Pointer to the hash table [khash_t(name)*] + @param k Key [type of keys] + @param r Extra return code: 0 if the key is present in the hash table; + 1 if the bucket is empty (never used); 2 if the element in + the bucket has been deleted [int*] + @return Iterator to the inserted element [khint_t] + */ +#define kh_put(name, h, k, r) kh_put_##name(h, k, r) + +/*! @function + @abstract Retrieve a key from the hash table. + @param name Name of the hash table [symbol] + @param h Pointer to the hash table [khash_t(name)*] + @param k Key [type of keys] + @return Iterator to the found element, or kh_end(h) is the element is absent [khint_t] + */ +#define kh_get(name, h, k) kh_get_##name(h, k) + +/*! @function + @abstract Remove a key from the hash table. + @param name Name of the hash table [symbol] + @param h Pointer to the hash table [khash_t(name)*] + @param k Iterator to the element to be deleted [khint_t] + */ +#define kh_del(name, h, k) kh_del_##name(h, k) + + +/*! @function + @abstract Test whether a bucket contains data. + @param h Pointer to the hash table [khash_t(name)*] + @param x Iterator to the bucket [khint_t] + @return 1 if containing data; 0 otherwise [int] + */ +#define kh_exist(h, x) (!__ac_iseither((h)->flags, (x))) + +/*! @function + @abstract Get key given an iterator + @param h Pointer to the hash table [khash_t(name)*] + @param x Iterator to the bucket [khint_t] + @return Key [type of keys] + */ +#define kh_key(h, x) ((h)->keys[x]) + +/*! @function + @abstract Get value given an iterator + @param h Pointer to the hash table [khash_t(name)*] + @param x Iterator to the bucket [khint_t] + @return Value [type of values] + @discussion For hash sets, calling this results in segfault. + */ +#define kh_val(h, x) ((h)->vals[x]) + +/*! @function + @abstract Alias of kh_val() + */ +#define kh_value(h, x) ((h)->vals[x]) + +/*! @function + @abstract Get the start iterator + @param h Pointer to the hash table [khash_t(name)*] + @return The start iterator [khint_t] + */ +#define kh_begin(h) (khint_t)(0) + +/*! @function + @abstract Get the end iterator + @param h Pointer to the hash table [khash_t(name)*] + @return The end iterator [khint_t] + */ +#define kh_end(h) ((h)->n_buckets) + +/*! @function + @abstract Get the number of elements in the hash table + @param h Pointer to the hash table [khash_t(name)*] + @return Number of elements in the hash table [khint_t] + */ +#define kh_size(h) ((h)->size) + +/*! @function + @abstract Get the number of buckets in the hash table + @param h Pointer to the hash table [khash_t(name)*] + @return Number of buckets in the hash table [khint_t] + */ +#define kh_n_buckets(h) ((h)->n_buckets) + +/* More conenient interfaces */ + +/*! @function + @abstract Instantiate a hash set containing integer keys + @param name Name of the hash table [symbol] + */ +#define KHASH_SET_INIT_INT(name) \ + KHASH_INIT(name, uint32_t, char, 0, kh_int_hash_func, kh_int_hash_equal) + +/*! @function + @abstract Instantiate a hash map containing integer keys + @param name Name of the hash table [symbol] + @param khval_t Type of values [type] + */ +#define KHASH_MAP_INIT_INT(name, khval_t) \ + KHASH_INIT(name, uint32_t, khval_t, 1, kh_int_hash_func, kh_int_hash_equal) + +/*! @function + @abstract Instantiate a hash map containing 64-bit integer keys + @param name Name of the hash table [symbol] + */ +#define KHASH_SET_INIT_INT64(name) \ + KHASH_INIT(name, uint64_t, char, 0, kh_int64_hash_func, kh_int64_hash_equal) + +/*! @function + @abstract Instantiate a hash map containing 64-bit integer keys + @param name Name of the hash table [symbol] + @param khval_t Type of values [type] + */ +#define KHASH_MAP_INIT_INT64(name, khval_t) \ + KHASH_INIT(name, uint64_t, khval_t, 1, kh_int64_hash_func, kh_int64_hash_equal) + +typedef const char *kh_cstr_t; +/*! @function + @abstract Instantiate a hash map containing const char* keys + @param name Name of the hash table [symbol] + */ +#define KHASH_SET_INIT_STR(name) \ + KHASH_INIT(name, kh_cstr_t, char, 0, kh_str_hash_func, kh_str_hash_equal) + +/*! @function + @abstract Instantiate a hash map containing const char* keys + @param name Name of the hash table [symbol] + @param khval_t Type of values [type] + */ +#define KHASH_MAP_INIT_STR(name, khval_t) \ + KHASH_INIT(name, kh_cstr_t, khval_t, 1, kh_str_hash_func, kh_str_hash_equal) + +#endif /* __AC_KHASH_H */
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/SNV/SNVMix2_source/SNVMix2-v0.12.1-rc1/samtools-0.1.6/knetfile.c Wed Oct 12 19:50:38 2011 -0400 @@ -0,0 +1,566 @@ +/* The MIT License + + Copyright (c) 2008 Genome Research Ltd (GRL). + + Permission is hereby granted, free of charge, to any person obtaining + a copy of this software and associated documentation files (the + "Software"), to deal in the Software without restriction, including + without limitation the rights to use, copy, modify, merge, publish, + distribute, sublicense, and/or sell copies of the Software, and to + permit persons to whom the Software is furnished to do so, subject to + the following conditions: + + The above copyright notice and this permission notice shall be + included in all copies or substantial portions of the Software. + + THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, + EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF + MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND + NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS + BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN + ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN + CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE + SOFTWARE. +*/ + +/* Contact: Heng Li <lh3@sanger.ac.uk> */ + +/* Probably I will not do socket programming in the next few years and + therefore I decide to heavily annotate this file, for Linux and + Windows as well. -lh3 */ + +#include <time.h> +#include <stdio.h> +#include <ctype.h> +#include <stdlib.h> +#include <string.h> +#include <unistd.h> +#include <sys/types.h> + +#ifdef _WIN32 +#include <winsock.h> +#else +#include <netdb.h> +#include <arpa/inet.h> +#include <sys/socket.h> +#endif + +#include "knetfile.h" + +/* In winsock.h, the type of a socket is SOCKET, which is: "typedef + * u_int SOCKET". An invalid SOCKET is: "(SOCKET)(~0)", or signed + * integer -1. In knetfile.c, I use "int" for socket type + * throughout. This should be improved to avoid confusion. + * + * In Linux/Mac, recv() and read() do almost the same thing. You can see + * in the header file that netread() is simply an alias of read(). In + * Windows, however, they are different and using recv() is mandatory. + */ + +/* This function tests if the file handler is ready for reading (or + * writing if is_read==0). */ +static int socket_wait(int fd, int is_read) +{ + fd_set fds, *fdr = 0, *fdw = 0; + struct timeval tv; + int ret; + tv.tv_sec = 5; tv.tv_usec = 0; // 5 seconds time out + FD_ZERO(&fds); + FD_SET(fd, &fds); + if (is_read) fdr = &fds; + else fdw = &fds; + ret = select(fd+1, fdr, fdw, 0, &tv); + if (ret == -1) perror("select"); + return ret; +} + +#ifndef _WIN32 +/* This function does not work with Windows due to the lack of + * getaddrinfo() in winsock. It is addapted from an example in "Beej's + * Guide to Network Programming" (http://beej.us/guide/bgnet/). */ +static int socket_connect(const char *host, const char *port) +{ +#define __err_connect(func) do { perror(func); freeaddrinfo(res); return -1; } while (0) + + int on = 1, fd; + struct linger lng = { 0, 0 }; + struct addrinfo hints, *res; + memset(&hints, 0, sizeof(struct addrinfo)); + hints.ai_family = AF_UNSPEC; + hints.ai_socktype = SOCK_STREAM; + /* In Unix/Mac, getaddrinfo() is the most convenient way to get + * server information. */ + if (getaddrinfo(host, port, &hints, &res) != 0) __err_connect("getaddrinfo"); + if ((fd = socket(res->ai_family, res->ai_socktype, res->ai_protocol)) == -1) __err_connect("socket"); + /* The following two setsockopt() are used by ftplib + * (http://nbpfaus.net/~pfau/ftplib/). I am not sure if they + * necessary. */ + if (setsockopt(fd, SOL_SOCKET, SO_REUSEADDR, &on, sizeof(on)) == -1) __err_connect("setsockopt"); + if (setsockopt(fd, SOL_SOCKET, SO_LINGER, &lng, sizeof(lng)) == -1) __err_connect("setsockopt"); + if (connect(fd, res->ai_addr, res->ai_addrlen) != 0) __err_connect("connect"); + freeaddrinfo(res); + return fd; +} +#else +/* MinGW's printf has problem with "%lld" */ +char *uint64tostr(char *buf, uint64_t x) +{ + int i, cnt; + for (i = 0; x; x /= 10) buf[i++] = '0' + x%10; + buf[i] = 0; + for (cnt = i, i = 0; i < cnt/2; ++i) { + int c = buf[i]; buf[i] = buf[cnt-i-1]; buf[cnt-i-1] = c; + } + return buf; +} +/* In windows, the first thing is to establish the TCP connection. */ +int knet_win32_init() +{ + WSADATA wsaData; + return WSAStartup(MAKEWORD(2, 2), &wsaData); +} +void knet_win32_destroy() +{ + WSACleanup(); +} +/* A slightly modfied version of the following function also works on + * Mac (and presummably Linux). However, this function is not stable on + * my Mac. It sometimes works fine but sometimes does not. Therefore for + * non-Windows OS, I do not use this one. */ +static SOCKET socket_connect(const char *host, const char *port) +{ +#define __err_connect(func) do { perror(func); return -1; } while (0) + + int on = 1; + SOCKET fd; + struct linger lng = { 0, 0 }; + struct sockaddr_in server; + struct hostent *hp = 0; + // open socket + if ((fd = socket(AF_INET, SOCK_STREAM, IPPROTO_TCP)) == INVALID_SOCKET) __err_connect("socket"); + if (setsockopt(fd, SOL_SOCKET, SO_REUSEADDR, (char*)&on, sizeof(on)) == -1) __err_connect("setsockopt"); + if (setsockopt(fd, SOL_SOCKET, SO_LINGER, (char*)&lng, sizeof(lng)) == -1) __err_connect("setsockopt"); + // get host info + if (isalpha(host[0])) hp = gethostbyname(host); + else { + struct in_addr addr; + addr.s_addr = inet_addr(host); + hp = gethostbyaddr((char*)&addr, 4, AF_INET); + } + if (hp == 0) __err_connect("gethost"); + // connect + server.sin_addr.s_addr = *((unsigned long*)hp->h_addr); + server.sin_family= AF_INET; + server.sin_port = htons(atoi(port)); + if (connect(fd, (struct sockaddr*)&server, sizeof(server)) != 0) __err_connect("connect"); + // freehostent(hp); // strangely in MSDN, hp is NOT freed (memory leak?!) + return fd; +} +#endif + +static off_t my_netread(int fd, void *buf, off_t len) +{ + off_t rest = len, curr, l = 0; + /* recv() and read() may not read the required length of data with + * one call. They have to be called repeatedly. */ + while (rest) { + if (socket_wait(fd, 1) <= 0) break; // socket is not ready for reading + curr = netread(fd, buf + l, rest); + /* According to the glibc manual, section 13.2, a zero returned + * value indicates end-of-file (EOF), which should mean that + * read() will not return zero if EOF has not been met but data + * are not immediately available. */ + if (curr == 0) break; + l += curr; rest -= curr; + } + return l; +} + +/************************* + * FTP specific routines * + *************************/ + +static int kftp_get_response(knetFile *ftp) +{ + unsigned char c; + int n = 0; + char *p; + if (socket_wait(ftp->ctrl_fd, 1) <= 0) return 0; + while (netread(ftp->ctrl_fd, &c, 1)) { // FIXME: this is *VERY BAD* for unbuffered I/O + //fputc(c, stderr); + if (n >= ftp->max_response) { + ftp->max_response = ftp->max_response? ftp->max_response<<1 : 256; + ftp->response = realloc(ftp->response, ftp->max_response); + } + ftp->response[n++] = c; + if (c == '\n') { + if (n >= 4 && isdigit(ftp->response[0]) && isdigit(ftp->response[1]) && isdigit(ftp->response[2]) + && ftp->response[3] != '-') break; + n = 0; + continue; + } + } + if (n < 2) return -1; + ftp->response[n-2] = 0; + return strtol(ftp->response, &p, 0); +} + +static int kftp_send_cmd(knetFile *ftp, const char *cmd, int is_get) +{ + if (socket_wait(ftp->ctrl_fd, 0) <= 0) return -1; // socket is not ready for writing + netwrite(ftp->ctrl_fd, cmd, strlen(cmd)); + return is_get? kftp_get_response(ftp) : 0; +} + +static int kftp_pasv_prep(knetFile *ftp) +{ + char *p; + int v[6]; + kftp_send_cmd(ftp, "PASV\r\n", 1); + for (p = ftp->response; *p && *p != '('; ++p); + if (*p != '(') return -1; + ++p; + sscanf(p, "%d,%d,%d,%d,%d,%d", &v[0], &v[1], &v[2], &v[3], &v[4], &v[5]); + memcpy(ftp->pasv_ip, v, 4 * sizeof(int)); + ftp->pasv_port = (v[4]<<8&0xff00) + v[5]; + return 0; +} + + +static int kftp_pasv_connect(knetFile *ftp) +{ + char host[80], port[10]; + if (ftp->pasv_port == 0) { + fprintf(stderr, "[kftp_pasv_connect] kftp_pasv_prep() is not called before hand.\n"); + return -1; + } + sprintf(host, "%d.%d.%d.%d", ftp->pasv_ip[0], ftp->pasv_ip[1], ftp->pasv_ip[2], ftp->pasv_ip[3]); + sprintf(port, "%d", ftp->pasv_port); + ftp->fd = socket_connect(host, port); + if (ftp->fd == -1) return -1; + return 0; +} + +int kftp_connect(knetFile *ftp) +{ + ftp->ctrl_fd = socket_connect(ftp->host, ftp->port); + if (ftp->ctrl_fd == -1) return -1; + kftp_get_response(ftp); + kftp_send_cmd(ftp, "USER anonymous\r\n", 1); + kftp_send_cmd(ftp, "PASS kftp@\r\n", 1); + kftp_send_cmd(ftp, "TYPE I\r\n", 1); + return 0; +} + +int kftp_reconnect(knetFile *ftp) +{ + if (ftp->ctrl_fd != -1) { + netclose(ftp->ctrl_fd); + ftp->ctrl_fd = -1; + } + netclose(ftp->fd); + return kftp_connect(ftp); +} + +// initialize ->type, ->host and ->retr +knetFile *kftp_parse_url(const char *fn, const char *mode) +{ + knetFile *fp; + char *p; + int l; + if (strstr(fn, "ftp://") != fn) return 0; + for (p = (char*)fn + 6; *p && *p != '/'; ++p); + if (*p != '/') return 0; + l = p - fn - 6; + fp = calloc(1, sizeof(knetFile)); + fp->type = KNF_TYPE_FTP; + fp->fd = -1; + /* the Linux/Mac version of socket_connect() also recognizes a port + * like "ftp", but the Windows version does not. */ + fp->port = strdup("21"); + fp->host = calloc(l + 1, 1); + if (strchr(mode, 'c')) fp->no_reconnect = 1; + strncpy(fp->host, fn + 6, l); + fp->retr = calloc(strlen(p) + 8, 1); + sprintf(fp->retr, "RETR %s\r\n", p); + fp->seek_offset = -1; + return fp; +} +// place ->fd at offset off +int kftp_connect_file(knetFile *fp) +{ + int ret; + if (fp->fd != -1) { + netclose(fp->fd); + if (fp->no_reconnect) kftp_get_response(fp); + } + kftp_pasv_prep(fp); + if (fp->offset) { + char tmp[32]; +#ifndef _WIN32 + sprintf(tmp, "REST %lld\r\n", (long long)fp->offset); +#else + strcpy(tmp, "REST "); + uint64tostr(tmp + 5, fp->offset); + strcat(tmp, "\r\n"); +#endif + kftp_send_cmd(fp, tmp, 1); + } + kftp_send_cmd(fp, fp->retr, 0); + kftp_pasv_connect(fp); + ret = kftp_get_response(fp); + if (ret != 150) { + fprintf(stderr, "[kftp_connect_file] %s\n", fp->response); + netclose(fp->fd); + fp->fd = -1; + return -1; + } + fp->is_ready = 1; + return 0; +} + +/************************** + * HTTP specific routines * + **************************/ + +knetFile *khttp_parse_url(const char *fn, const char *mode) +{ + knetFile *fp; + char *p, *proxy, *q; + int l; + if (strstr(fn, "http://") != fn) return 0; + // set ->http_host + for (p = (char*)fn + 7; *p && *p != '/'; ++p); + l = p - fn - 7; + fp = calloc(1, sizeof(knetFile)); + fp->http_host = calloc(l + 1, 1); + strncpy(fp->http_host, fn + 7, l); + fp->http_host[l] = 0; + for (q = fp->http_host; *q && *q != ':'; ++q); + if (*q == ':') *q++ = 0; + // get http_proxy + proxy = getenv("http_proxy"); + // set ->host, ->port and ->path + if (proxy == 0) { + fp->host = strdup(fp->http_host); // when there is no proxy, server name is identical to http_host name. + fp->port = strdup(*q? q : "80"); + fp->path = strdup(*p? p : "/"); + } else { + fp->host = (strstr(proxy, "http://") == proxy)? strdup(proxy + 7) : strdup(proxy); + for (q = fp->host; *q && *q != ':'; ++q); + if (*q == ':') *q++ = 0; + fp->port = strdup(*q? q : "80"); + fp->path = strdup(fn); + } + fp->type = KNF_TYPE_HTTP; + fp->ctrl_fd = fp->fd = -1; + fp->seek_offset = -1; + return fp; +} + +int khttp_connect_file(knetFile *fp) +{ + int ret, l = 0; + char *buf, *p; + if (fp->fd != -1) netclose(fp->fd); + fp->fd = socket_connect(fp->host, fp->port); + buf = calloc(0x10000, 1); // FIXME: I am lazy... But in principle, 64KB should be large enough. + l += sprintf(buf + l, "GET %s HTTP/1.0\r\nHost: %s\r\n", fp->path, fp->http_host); + if (fp->offset) + l += sprintf(buf + l, "Range: bytes=%lld-\r\n", (long long)fp->offset); + l += sprintf(buf + l, "\r\n"); + netwrite(fp->fd, buf, l); + l = 0; + while (netread(fp->fd, buf + l, 1)) { // read HTTP header; FIXME: bad efficiency + if (buf[l] == '\n' && l >= 3) + if (strncmp(buf + l - 3, "\r\n\r\n", 4) == 0) break; + ++l; + } + buf[l] = 0; + if (l < 14) { // prematured header + netclose(fp->fd); + fp->fd = -1; + return -1; + } + ret = strtol(buf + 8, &p, 0); // HTTP return code + if (ret == 200 && fp->offset) { // 200 (complete result); then skip beginning of the file + off_t rest = fp->offset; + while (rest) { + off_t l = rest < 0x10000? rest : 0x10000; + rest -= my_netread(fp->fd, buf, l); + } + } else if (ret != 206 && ret != 200) { + free(buf); + fprintf(stderr, "[khttp_connect_file] fail to open file (HTTP code: %d).\n", ret); + netclose(fp->fd); + fp->fd = -1; + return -1; + } + free(buf); + fp->is_ready = 1; + return 0; +} + +/******************** + * Generic routines * + ********************/ + +knetFile *knet_open(const char *fn, const char *mode) +{ + knetFile *fp = 0; + if (mode[0] != 'r') { + fprintf(stderr, "[kftp_open] only mode \"r\" is supported.\n"); + return 0; + } + if (strstr(fn, "ftp://") == fn) { + fp = kftp_parse_url(fn, mode); + if (fp == 0) return 0; + if (kftp_connect(fp) == -1) { + knet_close(fp); + return 0; + } + kftp_connect_file(fp); + } else if (strstr(fn, "http://") == fn) { + fp = khttp_parse_url(fn, mode); + if (fp == 0) return 0; + khttp_connect_file(fp); + } else { // local file +#ifdef _WIN32 + /* In windows, O_BINARY is necessary. In Linux/Mac, O_BINARY may + * be undefined on some systems, although it is defined on my + * Mac and the Linux I have tested on. */ + int fd = open(fn, O_RDONLY | O_BINARY); +#else + int fd = open(fn, O_RDONLY); +#endif + if (fd == -1) { + perror("open"); + return 0; + } + fp = (knetFile*)calloc(1, sizeof(knetFile)); + fp->type = KNF_TYPE_LOCAL; + fp->fd = fd; + fp->ctrl_fd = -1; + } + if (fp && fp->fd == -1) { + knet_close(fp); + return 0; + } + return fp; +} + +knetFile *knet_dopen(int fd, const char *mode) +{ + knetFile *fp = (knetFile*)calloc(1, sizeof(knetFile)); + fp->type = KNF_TYPE_LOCAL; + fp->fd = fd; + return fp; +} + +off_t knet_read(knetFile *fp, void *buf, off_t len) +{ + off_t l = 0; + if (fp->fd == -1) return 0; + if (fp->type == KNF_TYPE_FTP) { + if (fp->is_ready == 0) { + if (!fp->no_reconnect) kftp_reconnect(fp); + kftp_connect_file(fp); + } + } else if (fp->type == KNF_TYPE_HTTP) { + if (fp->is_ready == 0) + khttp_connect_file(fp); + } + if (fp->type == KNF_TYPE_LOCAL) { // on Windows, the following block is necessary; not on UNIX + off_t rest = len, curr; + while (rest) { + curr = read(fp->fd, buf + l, rest); + if (curr == 0) break; + l += curr; rest -= curr; + } + } else l = my_netread(fp->fd, buf, len); + fp->offset += l; + return l; +} + +int knet_seek(knetFile *fp, off_t off, int whence) +{ + if (whence == SEEK_SET && off == fp->offset) return 0; + if (fp->type == KNF_TYPE_LOCAL) { + /* Be aware that lseek() returns the offset after seeking, + * while fseek() returns zero on success. */ + off_t offset = lseek(fp->fd, off, whence); + if (offset == -1) { + perror("lseek"); + return -1; + } + fp->offset = offset; + return 0; + } else if (fp->type == KNF_TYPE_FTP || fp->type == KNF_TYPE_HTTP) { + if (whence != SEEK_SET) { // FIXME: we can surely allow SEEK_CUR and SEEK_END in future + fprintf(stderr, "[knet_seek] only SEEK_SET is supported for FTP/HTTP. Offset is unchanged.\n"); + return -1; + } + fp->offset = off; + fp->is_ready = 0; + return 0; + } + return -1; +} + +int knet_close(knetFile *fp) +{ + if (fp == 0) return 0; + if (fp->ctrl_fd != -1) netclose(fp->ctrl_fd); // FTP specific + if (fp->fd != -1) { + /* On Linux/Mac, netclose() is an alias of close(), but on + * Windows, it is an alias of closesocket(). */ + if (fp->type == KNF_TYPE_LOCAL) close(fp->fd); + else netclose(fp->fd); + } + free(fp->host); free(fp->port); + free(fp->response); free(fp->retr); // FTP specific + free(fp->path); free(fp->http_host); // HTTP specific + free(fp); + return 0; +} + +#ifdef KNETFILE_MAIN +int main(void) +{ + char *buf; + knetFile *fp; + int type = 4, l; +#ifdef _WIN32 + knet_win32_init(); +#endif + buf = calloc(0x100000, 1); + if (type == 0) { + fp = knet_open("knetfile.c", "r"); + knet_seek(fp, 1000, SEEK_SET); + } else if (type == 1) { // NCBI FTP, large file + fp = knet_open("ftp://ftp.ncbi.nih.gov/1000genomes/ftp/data/NA12878/alignment/NA12878.chrom6.SLX.SRP000032.2009_06.bam", "r"); + knet_seek(fp, 2500000000ll, SEEK_SET); + l = knet_read(fp, buf, 255); + } else if (type == 2) { + fp = knet_open("ftp://ftp.sanger.ac.uk/pub4/treefam/tmp/index.shtml", "r"); + knet_seek(fp, 1000, SEEK_SET); + } else if (type == 3) { + fp = knet_open("http://www.sanger.ac.uk/Users/lh3/index.shtml", "r"); + knet_seek(fp, 1000, SEEK_SET); + } else if (type == 4) { + fp = knet_open("http://www.sanger.ac.uk/Users/lh3/ex1.bam", "r"); + knet_read(fp, buf, 10000); + knet_seek(fp, 20000, SEEK_SET); + knet_seek(fp, 10000, SEEK_SET); + l = knet_read(fp, buf+10000, 10000000) + 10000; + } + if (type != 4 && type != 1) { + knet_read(fp, buf, 255); + buf[255] = 0; + printf("%s\n", buf); + } else write(fileno(stdout), buf, l); + knet_close(fp); + free(buf); + return 0; +} +#endif
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/SNV/SNVMix2_source/SNVMix2-v0.12.1-rc1/samtools-0.1.6/knetfile.h Wed Oct 12 19:50:38 2011 -0400 @@ -0,0 +1,74 @@ +#ifndef KNETFILE_H +#define KNETFILE_H + +#include <stdint.h> +#include <fcntl.h> + +#ifndef _WIN32 +#define netread(fd, ptr, len) read(fd, ptr, len) +#define netwrite(fd, ptr, len) write(fd, ptr, len) +#define netclose(fd) close(fd) +#else +#include <winsock.h> +#define netread(fd, ptr, len) recv(fd, ptr, len, 0) +#define netwrite(fd, ptr, len) send(fd, ptr, len, 0) +#define netclose(fd) closesocket(fd) +#endif + +// FIXME: currently I/O is unbuffered + +#define KNF_TYPE_LOCAL 1 +#define KNF_TYPE_FTP 2 +#define KNF_TYPE_HTTP 3 + +typedef struct knetFile_s { + int type, fd; + int64_t offset; + char *host, *port; + + // the following are for FTP only + int ctrl_fd, pasv_ip[4], pasv_port, max_response, no_reconnect, is_ready; + char *response, *retr; + int64_t seek_offset; // for lazy seek + + // the following are for HTTP only + char *path, *http_host; +} knetFile; + +#define knet_tell(fp) ((fp)->offset) +#define knet_fileno(fp) ((fp)->fd) + +#ifdef __cplusplus +extern "C" { +#endif + +#ifdef _WIN32 + int knet_win32_init(); + void knet_win32_destroy(); +#endif + + knetFile *knet_open(const char *fn, const char *mode); + + /* + This only works with local files. + */ + knetFile *knet_dopen(int fd, const char *mode); + + /* + If ->is_ready==0, this routine updates ->fd; otherwise, it simply + reads from ->fd. + */ + off_t knet_read(knetFile *fp, void *buf, off_t len); + + /* + This routine only sets ->offset and ->is_ready=0. It does not + communicate with the FTP server. + */ + int knet_seek(knetFile *fp, off_t off, int whence); + int knet_close(knetFile *fp); + +#ifdef __cplusplus +} +#endif + +#endif
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/SNV/SNVMix2_source/SNVMix2-v0.12.1-rc1/samtools-0.1.6/kseq.h Wed Oct 12 19:50:38 2011 -0400 @@ -0,0 +1,227 @@ +/* The MIT License + + Copyright (c) 2008 Genome Research Ltd (GRL). + + Permission is hereby granted, free of charge, to any person obtaining + a copy of this software and associated documentation files (the + "Software"), to deal in the Software without restriction, including + without limitation the rights to use, copy, modify, merge, publish, + distribute, sublicense, and/or sell copies of the Software, and to + permit persons to whom the Software is furnished to do so, subject to + the following conditions: + + The above copyright notice and this permission notice shall be + included in all copies or substantial portions of the Software. + + THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, + EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF + MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND + NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS + BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN + ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN + CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE + SOFTWARE. +*/ + +/* Contact: Heng Li <lh3@sanger.ac.uk> */ + +/* + 2009-07-16 (lh3): in kstream_t, change "char*" to "unsigned char*" + */ + +/* Last Modified: 12APR2009 */ + +#ifndef AC_KSEQ_H +#define AC_KSEQ_H + +#include <ctype.h> +#include <string.h> +#include <stdlib.h> + +#define KS_SEP_SPACE 0 // isspace(): \t, \n, \v, \f, \r +#define KS_SEP_TAB 1 // isspace() && !' ' +#define KS_SEP_MAX 1 + +#define __KS_TYPE(type_t) \ + typedef struct __kstream_t { \ + unsigned char *buf; \ + int begin, end, is_eof; \ + type_t f; \ + } kstream_t; + +#define ks_eof(ks) ((ks)->is_eof && (ks)->begin >= (ks)->end) +#define ks_rewind(ks) ((ks)->is_eof = (ks)->begin = (ks)->end = 0) + +#define __KS_BASIC(type_t, __bufsize) \ + static inline kstream_t *ks_init(type_t f) \ + { \ + kstream_t *ks = (kstream_t*)calloc(1, sizeof(kstream_t)); \ + ks->f = f; \ + ks->buf = malloc(__bufsize); \ + return ks; \ + } \ + static inline void ks_destroy(kstream_t *ks) \ + { \ + if (ks) { \ + free(ks->buf); \ + free(ks); \ + } \ + } + +#define __KS_GETC(__read, __bufsize) \ + static inline int ks_getc(kstream_t *ks) \ + { \ + if (ks->is_eof && ks->begin >= ks->end) return -1; \ + if (ks->begin >= ks->end) { \ + ks->begin = 0; \ + ks->end = __read(ks->f, ks->buf, __bufsize); \ + if (ks->end < __bufsize) ks->is_eof = 1; \ + if (ks->end == 0) return -1; \ + } \ + return (int)ks->buf[ks->begin++]; \ + } + +#ifndef KSTRING_T +#define KSTRING_T kstring_t +typedef struct __kstring_t { + size_t l, m; + char *s; +} kstring_t; +#endif + +#ifndef kroundup32 +#define kroundup32(x) (--(x), (x)|=(x)>>1, (x)|=(x)>>2, (x)|=(x)>>4, (x)|=(x)>>8, (x)|=(x)>>16, ++(x)) +#endif + +#define __KS_GETUNTIL(__read, __bufsize) \ + static int ks_getuntil(kstream_t *ks, int delimiter, kstring_t *str, int *dret) \ + { \ + if (dret) *dret = 0; \ + str->l = 0; \ + if (ks->begin >= ks->end && ks->is_eof) return -1; \ + for (;;) { \ + int i; \ + if (ks->begin >= ks->end) { \ + if (!ks->is_eof) { \ + ks->begin = 0; \ + ks->end = __read(ks->f, ks->buf, __bufsize); \ + if (ks->end < __bufsize) ks->is_eof = 1; \ + if (ks->end == 0) break; \ + } else break; \ + } \ + if (delimiter > KS_SEP_MAX) { \ + for (i = ks->begin; i < ks->end; ++i) \ + if (ks->buf[i] == delimiter) break; \ + } else if (delimiter == KS_SEP_SPACE) { \ + for (i = ks->begin; i < ks->end; ++i) \ + if (isspace(ks->buf[i])) break; \ + } else if (delimiter == KS_SEP_TAB) { \ + for (i = ks->begin; i < ks->end; ++i) \ + if (isspace(ks->buf[i]) && ks->buf[i] != ' ') break; \ + } else i = 0; /* never come to here! */ \ + if (str->m - str->l < i - ks->begin + 1) { \ + str->m = str->l + (i - ks->begin) + 1; \ + kroundup32(str->m); \ + str->s = (char*)realloc(str->s, str->m); \ + } \ + memcpy(str->s + str->l, ks->buf + ks->begin, i - ks->begin); \ + str->l = str->l + (i - ks->begin); \ + ks->begin = i + 1; \ + if (i < ks->end) { \ + if (dret) *dret = ks->buf[i]; \ + break; \ + } \ + } \ + if (str->l == 0) { \ + str->m = 1; \ + str->s = (char*)calloc(1, 1); \ + } \ + str->s[str->l] = '\0'; \ + return str->l; \ + } + +#define KSTREAM_INIT(type_t, __read, __bufsize) \ + __KS_TYPE(type_t) \ + __KS_BASIC(type_t, __bufsize) \ + __KS_GETC(__read, __bufsize) \ + __KS_GETUNTIL(__read, __bufsize) + +#define __KSEQ_BASIC(type_t) \ + static inline kseq_t *kseq_init(type_t fd) \ + { \ + kseq_t *s = (kseq_t*)calloc(1, sizeof(kseq_t)); \ + s->f = ks_init(fd); \ + return s; \ + } \ + static inline void kseq_rewind(kseq_t *ks) \ + { \ + ks->last_char = 0; \ + ks->f->is_eof = ks->f->begin = ks->f->end = 0; \ + } \ + static inline void kseq_destroy(kseq_t *ks) \ + { \ + if (!ks) return; \ + free(ks->name.s); free(ks->comment.s); free(ks->seq.s); free(ks->qual.s); \ + ks_destroy(ks->f); \ + free(ks); \ + } + +/* Return value: + >=0 length of the sequence (normal) + -1 end-of-file + -2 truncated quality string + */ +#define __KSEQ_READ \ + static int kseq_read(kseq_t *seq) \ + { \ + int c; \ + kstream_t *ks = seq->f; \ + if (seq->last_char == 0) { /* then jump to the next header line */ \ + while ((c = ks_getc(ks)) != -1 && c != '>' && c != '@'); \ + if (c == -1) return -1; /* end of file */ \ + seq->last_char = c; \ + } /* the first header char has been read */ \ + seq->comment.l = seq->seq.l = seq->qual.l = 0; \ + if (ks_getuntil(ks, 0, &seq->name, &c) < 0) return -1; \ + if (c != '\n') ks_getuntil(ks, '\n', &seq->comment, 0); \ + while ((c = ks_getc(ks)) != -1 && c != '>' && c != '+' && c != '@') { \ + if (isgraph(c)) { /* printable non-space character */ \ + if (seq->seq.l + 1 >= seq->seq.m) { /* double the memory */ \ + seq->seq.m = seq->seq.l + 2; \ + kroundup32(seq->seq.m); /* rounded to next closest 2^k */ \ + seq->seq.s = (char*)realloc(seq->seq.s, seq->seq.m); \ + } \ + seq->seq.s[seq->seq.l++] = (char)c; \ + } \ + } \ + if (c == '>' || c == '@') seq->last_char = c; /* the first header char has been read */ \ + seq->seq.s[seq->seq.l] = 0; /* null terminated string */ \ + if (c != '+') return seq->seq.l; /* FASTA */ \ + if (seq->qual.m < seq->seq.m) { /* allocate enough memory */ \ + seq->qual.m = seq->seq.m; \ + seq->qual.s = (char*)realloc(seq->qual.s, seq->qual.m); \ + } \ + while ((c = ks_getc(ks)) != -1 && c != '\n'); /* skip the rest of '+' line */ \ + if (c == -1) return -2; /* we should not stop here */ \ + while ((c = ks_getc(ks)) != -1 && seq->qual.l < seq->seq.l) \ + if (c >= 33 && c <= 127) seq->qual.s[seq->qual.l++] = (unsigned char)c; \ + seq->qual.s[seq->qual.l] = 0; /* null terminated string */ \ + seq->last_char = 0; /* we have not come to the next header line */ \ + if (seq->seq.l != seq->qual.l) return -2; /* qual string is shorter than seq string */ \ + return seq->seq.l; \ + } + +#define __KSEQ_TYPE(type_t) \ + typedef struct { \ + kstring_t name, comment, seq, qual; \ + int last_char; \ + kstream_t *f; \ + } kseq_t; + +#define KSEQ_INIT(type_t, __read) \ + KSTREAM_INIT(type_t, __read, 4096) \ + __KSEQ_TYPE(type_t) \ + __KSEQ_BASIC(type_t) \ + __KSEQ_READ + +#endif
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/SNV/SNVMix2_source/SNVMix2-v0.12.1-rc1/samtools-0.1.6/ksort.h Wed Oct 12 19:50:38 2011 -0400 @@ -0,0 +1,271 @@ +/* The MIT License + + Copyright (c) 2008 Genome Research Ltd (GRL). + + Permission is hereby granted, free of charge, to any person obtaining + a copy of this software and associated documentation files (the + "Software"), to deal in the Software without restriction, including + without limitation the rights to use, copy, modify, merge, publish, + distribute, sublicense, and/or sell copies of the Software, and to + permit persons to whom the Software is furnished to do so, subject to + the following conditions: + + The above copyright notice and this permission notice shall be + included in all copies or substantial portions of the Software. + + THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, + EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF + MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND + NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS + BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN + ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN + CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE + SOFTWARE. +*/ + +/* Contact: Heng Li <lh3@sanger.ac.uk> */ + +/* + 2008-11-16 (0.1.4): + + * Fixed a bug in introsort() that happens in rare cases. + + 2008-11-05 (0.1.3): + + * Fixed a bug in introsort() for complex comparisons. + + * Fixed a bug in mergesort(). The previous version is not stable. + + 2008-09-15 (0.1.2): + + * Accelerated introsort. On my Mac (not on another Linux machine), + my implementation is as fast as std::sort on random input. + + * Added combsort and in introsort, switch to combsort if the + recursion is too deep. + + 2008-09-13 (0.1.1): + + * Added k-small algorithm + + 2008-09-05 (0.1.0): + + * Initial version + +*/ + +#ifndef AC_KSORT_H +#define AC_KSORT_H + +#include <stdlib.h> +#include <string.h> + +typedef struct { + void *left, *right; + int depth; +} ks_isort_stack_t; + +#define KSORT_SWAP(type_t, a, b) { register type_t t=(a); (a)=(b); (b)=t; } + +#define KSORT_INIT(name, type_t, __sort_lt) \ + void ks_mergesort_##name(size_t n, type_t array[], type_t temp[]) \ + { \ + type_t *a2[2], *a, *b; \ + int curr, shift; \ + \ + a2[0] = array; \ + a2[1] = temp? temp : (type_t*)malloc(sizeof(type_t) * n); \ + for (curr = 0, shift = 0; (1ul<<shift) < n; ++shift) { \ + a = a2[curr]; b = a2[1-curr]; \ + if (shift == 0) { \ + type_t *p = b, *i, *eb = a + n; \ + for (i = a; i < eb; i += 2) { \ + if (i == eb - 1) *p++ = *i; \ + else { \ + if (__sort_lt(*(i+1), *i)) { \ + *p++ = *(i+1); *p++ = *i; \ + } else { \ + *p++ = *i; *p++ = *(i+1); \ + } \ + } \ + } \ + } else { \ + size_t i, step = 1ul<<shift; \ + for (i = 0; i < n; i += step<<1) { \ + type_t *p, *j, *k, *ea, *eb; \ + if (n < i + step) { \ + ea = a + n; eb = a; \ + } else { \ + ea = a + i + step; \ + eb = a + (n < i + (step<<1)? n : i + (step<<1)); \ + } \ + j = a + i; k = a + i + step; p = b + i; \ + while (j < ea && k < eb) { \ + if (__sort_lt(*k, *j)) *p++ = *k++; \ + else *p++ = *j++; \ + } \ + while (j < ea) *p++ = *j++; \ + while (k < eb) *p++ = *k++; \ + } \ + } \ + curr = 1 - curr; \ + } \ + if (curr == 1) { \ + type_t *p = a2[0], *i = a2[1], *eb = array + n; \ + for (; p < eb; ++i) *p++ = *i; \ + } \ + if (temp == 0) free(a2[1]); \ + } \ + void ks_heapadjust_##name(size_t i, size_t n, type_t l[]) \ + { \ + size_t k = i; \ + type_t tmp = l[i]; \ + while ((k = (k << 1) + 1) < n) { \ + if (k != n - 1 && __sort_lt(l[k], l[k+1])) ++k; \ + if (__sort_lt(l[k], tmp)) break; \ + l[i] = l[k]; i = k; \ + } \ + l[i] = tmp; \ + } \ + void ks_heapmake_##name(size_t lsize, type_t l[]) \ + { \ + size_t i; \ + for (i = (lsize >> 1) - 1; i != (size_t)(-1); --i) \ + ks_heapadjust_##name(i, lsize, l); \ + } \ + void ks_heapsort_##name(size_t lsize, type_t l[]) \ + { \ + size_t i; \ + for (i = lsize - 1; i > 0; --i) { \ + type_t tmp; \ + tmp = *l; *l = l[i]; l[i] = tmp; ks_heapadjust_##name(0, i, l); \ + } \ + } \ + inline void __ks_insertsort_##name(type_t *s, type_t *t) \ + { \ + type_t *i, *j, swap_tmp; \ + for (i = s + 1; i < t; ++i) \ + for (j = i; j > s && __sort_lt(*j, *(j-1)); --j) { \ + swap_tmp = *j; *j = *(j-1); *(j-1) = swap_tmp; \ + } \ + } \ + void ks_combsort_##name(size_t n, type_t a[]) \ + { \ + const double shrink_factor = 1.2473309501039786540366528676643; \ + int do_swap; \ + size_t gap = n; \ + type_t tmp, *i, *j; \ + do { \ + if (gap > 2) { \ + gap = (size_t)(gap / shrink_factor); \ + if (gap == 9 || gap == 10) gap = 11; \ + } \ + do_swap = 0; \ + for (i = a; i < a + n - gap; ++i) { \ + j = i + gap; \ + if (__sort_lt(*j, *i)) { \ + tmp = *i; *i = *j; *j = tmp; \ + do_swap = 1; \ + } \ + } \ + } while (do_swap || gap > 2); \ + if (gap != 1) __ks_insertsort_##name(a, a + n); \ + } \ + void ks_introsort_##name(size_t n, type_t a[]) \ + { \ + int d; \ + ks_isort_stack_t *top, *stack; \ + type_t rp, swap_tmp; \ + type_t *s, *t, *i, *j, *k; \ + \ + if (n < 1) return; \ + else if (n == 2) { \ + if (__sort_lt(a[1], a[0])) { swap_tmp = a[0]; a[0] = a[1]; a[1] = swap_tmp; } \ + return; \ + } \ + for (d = 2; 1ul<<d < n; ++d); \ + stack = (ks_isort_stack_t*)malloc(sizeof(ks_isort_stack_t) * ((sizeof(size_t)*d)+2)); \ + top = stack; s = a; t = a + (n-1); d <<= 1; \ + while (1) { \ + if (s < t) { \ + if (--d == 0) { \ + ks_combsort_##name(t - s + 1, s); \ + t = s; \ + continue; \ + } \ + i = s; j = t; k = i + ((j-i)>>1) + 1; \ + if (__sort_lt(*k, *i)) { \ + if (__sort_lt(*k, *j)) k = j; \ + } else k = __sort_lt(*j, *i)? i : j; \ + rp = *k; \ + if (k != t) { swap_tmp = *k; *k = *t; *t = swap_tmp; } \ + for (;;) { \ + do ++i; while (__sort_lt(*i, rp)); \ + do --j; while (i <= j && __sort_lt(rp, *j)); \ + if (j <= i) break; \ + swap_tmp = *i; *i = *j; *j = swap_tmp; \ + } \ + swap_tmp = *i; *i = *t; *t = swap_tmp; \ + if (i-s > t-i) { \ + if (i-s > 16) { top->left = s; top->right = i-1; top->depth = d; ++top; } \ + s = t-i > 16? i+1 : t; \ + } else { \ + if (t-i > 16) { top->left = i+1; top->right = t; top->depth = d; ++top; } \ + t = i-s > 16? i-1 : s; \ + } \ + } else { \ + if (top == stack) { \ + free(stack); \ + __ks_insertsort_##name(a, a+n); \ + return; \ + } else { --top; s = (type_t*)top->left; t = (type_t*)top->right; d = top->depth; } \ + } \ + } \ + } \ + /* This function is adapted from: http://ndevilla.free.fr/median/ */ \ + /* 0 <= kk < n */ \ + type_t ks_ksmall_##name(size_t n, type_t arr[], size_t kk) \ + { \ + type_t *low, *high, *k, *ll, *hh, *mid; \ + low = arr; high = arr + n - 1; k = arr + kk; \ + for (;;) { \ + if (high <= low) return *k; \ + if (high == low + 1) { \ + if (__sort_lt(*high, *low)) KSORT_SWAP(type_t, *low, *high); \ + return *k; \ + } \ + mid = low + (high - low) / 2; \ + if (__sort_lt(*high, *mid)) KSORT_SWAP(type_t, *mid, *high); \ + if (__sort_lt(*high, *low)) KSORT_SWAP(type_t, *low, *high); \ + if (__sort_lt(*low, *mid)) KSORT_SWAP(type_t, *mid, *low); \ + KSORT_SWAP(type_t, *mid, *(low+1)); \ + ll = low + 1; hh = high; \ + for (;;) { \ + do ++ll; while (__sort_lt(*ll, *low)); \ + do --hh; while (__sort_lt(*low, *hh)); \ + if (hh < ll) break; \ + KSORT_SWAP(type_t, *ll, *hh); \ + } \ + KSORT_SWAP(type_t, *low, *hh); \ + if (hh <= k) low = ll; \ + if (hh >= k) high = hh - 1; \ + } \ + } + +#define ks_mergesort(name, n, a, t) ks_mergesort_##name(n, a, t) +#define ks_introsort(name, n, a) ks_introsort_##name(n, a) +#define ks_combsort(name, n, a) ks_combsort_##name(n, a) +#define ks_heapsort(name, n, a) ks_heapsort_##name(n, a) +#define ks_heapmake(name, n, a) ks_heapmake_##name(n, a) +#define ks_heapadjust(name, i, n, a) ks_heapadjust_##name(i, n, a) +#define ks_ksmall(name, n, a, k) ks_ksmall_##name(n, a, k) + +#define ks_lt_generic(a, b) ((a) < (b)) +#define ks_lt_str(a, b) (strcmp((a), (b)) < 0) + +typedef const char *ksstr_t; + +#define KSORT_INIT_GENERIC(type_t) KSORT_INIT(type_t, type_t, ks_lt_generic) +#define KSORT_INIT_STR KSORT_INIT(str, ksstr_t, ks_lt_str) + +#endif
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/SNV/SNVMix2_source/SNVMix2-v0.12.1-rc1/samtools-0.1.6/kstring.c Wed Oct 12 19:50:38 2011 -0400 @@ -0,0 +1,165 @@ +#include <stdarg.h> +#include <stdio.h> +#include <ctype.h> +#include <string.h> +#include <stdint.h> +#include "kstring.h" + +int ksprintf(kstring_t *s, const char *fmt, ...) +{ + va_list ap; + int l; + va_start(ap, fmt); + l = vsnprintf(s->s + s->l, s->m - s->l, fmt, ap); // This line does not work with glibc 2.0. See `man snprintf'. + va_end(ap); + if (l + 1 > s->m - s->l) { + s->m = s->l + l + 2; + kroundup32(s->m); + s->s = (char*)realloc(s->s, s->m); + va_start(ap, fmt); + l = vsnprintf(s->s + s->l, s->m - s->l, fmt, ap); + } + va_end(ap); + s->l += l; + return l; +} + +// s MUST BE a null terminated string; l = strlen(s) +int ksplit_core(char *s, int delimiter, int *_max, int **_offsets) +{ + int i, n, max, last_char, last_start, *offsets, l; + n = 0; max = *_max; offsets = *_offsets; + l = strlen(s); + +#define __ksplit_aux do { \ + if (_offsets) { \ + s[i] = 0; \ + if (n == max) { \ + max = max? max<<1 : 2; \ + offsets = (int*)realloc(offsets, sizeof(int) * max); \ + } \ + offsets[n++] = last_start; \ + } else ++n; \ + } while (0) + + for (i = 0, last_char = last_start = 0; i <= l; ++i) { + if (delimiter == 0) { + if (isspace(s[i]) || s[i] == 0) { + if (isgraph(last_char)) __ksplit_aux; // the end of a field + } else { + if (isspace(last_char) || last_char == 0) last_start = i; + } + } else { + if (s[i] == delimiter || s[i] == 0) { + if (last_char != 0 && last_char != delimiter) __ksplit_aux; // the end of a field + } else { + if (last_char == delimiter || last_char == 0) last_start = i; + } + } + last_char = s[i]; + } + *_max = max; *_offsets = offsets; + return n; +} + +/********************** + * Boyer-Moore search * + **********************/ + +// reference: http://www-igm.univ-mlv.fr/~lecroq/string/node14.html +int *ksBM_prep(const uint8_t *pat, int m) +{ + int i, *suff, *prep, *bmGs, *bmBc; + prep = calloc(m + 256, 1); + bmGs = prep; bmBc = prep + m; + { // preBmBc() + for (i = 0; i < 256; ++i) bmBc[i] = m; + for (i = 0; i < m - 1; ++i) bmBc[pat[i]] = m - i - 1; + } + suff = calloc(m, sizeof(int)); + { // suffixes() + int f = 0, g; + suff[m - 1] = m; + g = m - 1; + for (i = m - 2; i >= 0; --i) { + if (i > g && suff[i + m - 1 - f] < i - g) + suff[i] = suff[i + m - 1 - f]; + else { + if (i < g) g = i; + f = i; + while (g >= 0 && pat[g] == pat[g + m - 1 - f]) --g; + suff[i] = f - g; + } + } + } + { // preBmGs() + int j = 0; + for (i = 0; i < m; ++i) bmGs[i] = m; + for (i = m - 1; i >= 0; --i) + if (suff[i] == i + 1) + for (; j < m - 1 - i; ++j) + if (bmGs[j] == m) + bmGs[j] = m - 1 - i; + for (i = 0; i <= m - 2; ++i) + bmGs[m - 1 - suff[i]] = m - 1 - i; + } + free(suff); + return prep; +} + +int *ksBM_search(const uint8_t *str, int n, const uint8_t *pat, int m, int *_prep, int *n_matches) +{ + int i, j, *prep, *bmGs, *bmBc; + int *matches = 0, mm = 0, nm = 0; + prep = _prep? _prep : ksBM_prep(pat, m); + bmGs = prep; bmBc = prep + m; + j = 0; + while (j <= n - m) { + for (i = m - 1; i >= 0 && pat[i] == str[i+j]; --i); + if (i < 0) { + if (nm == mm) { + mm = mm? mm<<1 : 1; + matches = realloc(matches, mm * sizeof(int)); + } + matches[nm++] = j; + j += bmGs[0]; + } else { + int max = bmBc[str[i+j]] - m + 1 + i; + if (max < bmGs[i]) max = bmGs[i]; + j += max; + } + } + *n_matches = nm; + if (_prep == 0) free(prep); + return matches; +} + +#ifdef KSTRING_MAIN +#include <stdio.h> +int main() +{ + kstring_t *s; + int *fields, n, i; + s = (kstring_t*)calloc(1, sizeof(kstring_t)); + // test ksprintf() + ksprintf(s, " abcdefg: %d ", 100); + printf("'%s'\n", s->s); + // test ksplit() + fields = ksplit(s, 0, &n); + for (i = 0; i < n; ++i) + printf("field[%d] = '%s'\n", i, s->s + fields[i]); + free(s); + + { + static char *str = "abcdefgcdg"; + static char *pat = "cd"; + int n, *matches; + matches = ksBM_search(str, strlen(str), pat, strlen(pat), 0, &n); + printf("%d: \n", n); + for (i = 0; i < n; ++i) + printf("- %d\n", matches[i]); + free(matches); + } + return 0; +} +#endif
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/SNV/SNVMix2_source/SNVMix2-v0.12.1-rc1/samtools-0.1.6/kstring.h Wed Oct 12 19:50:38 2011 -0400 @@ -0,0 +1,68 @@ +#ifndef KSTRING_H +#define KSTRING_H + +#include <stdlib.h> +#include <string.h> +#include <stdint.h> + +#ifndef kroundup32 +#define kroundup32(x) (--(x), (x)|=(x)>>1, (x)|=(x)>>2, (x)|=(x)>>4, (x)|=(x)>>8, (x)|=(x)>>16, ++(x)) +#endif + +#ifndef KSTRING_T +#define KSTRING_T kstring_t +typedef struct __kstring_t { + size_t l, m; + char *s; +} kstring_t; +#endif + +int ksprintf(kstring_t *s, const char *fmt, ...); +int ksplit_core(char *s, int delimiter, int *_max, int **_offsets); + +// calculate the auxiliary array, allocated by calloc() +int *ksBM_prep(const uint8_t *pat, int m); + +/* Search pat in str and returned the list of matches. The size of the + * list is returned as n_matches. _prep is the array returned by + * ksBM_prep(). If it is a NULL pointer, ksBM_prep() will be called. */ +int *ksBM_search(const uint8_t *str, int n, const uint8_t *pat, int m, int *_prep, int *n_matches); + +static inline int kputsn(const char *p, int l, kstring_t *s) +{ + if (s->l + l + 1 >= s->m) { + s->m = s->l + l + 2; + kroundup32(s->m); + s->s = (char*)realloc(s->s, s->m); + } + strncpy(s->s + s->l, p, l); + s->l += l; + s->s[s->l] = 0; + return l; +} + +static inline int kputs(const char *p, kstring_t *s) +{ + return kputsn(p, strlen(p), s); +} + +static inline int kputc(int c, kstring_t *s) +{ + if (s->l + 1 >= s->m) { + s->m = s->l + 2; + kroundup32(s->m); + s->s = (char*)realloc(s->s, s->m); + } + s->s[s->l++] = c; + s->s[s->l] = 0; + return c; +} + +static inline int *ksplit(kstring_t *s, int delimiter, int *n) +{ + int max = 0, *offsets = 0; + *n = ksplit_core(s->s, delimiter, &max, &offsets); + return offsets; +} + +#endif
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/SNV/SNVMix2_source/SNVMix2-v0.12.1-rc1/samtools-0.1.6/misc/Makefile Wed Oct 12 19:50:38 2011 -0400 @@ -0,0 +1,54 @@ +CC= gcc +CXX= g++ +CFLAGS= -g -Wall -O2 -m64 #-arch ppc +CXXFLAGS= $(CFLAGS) +DFLAGS= -D_FILE_OFFSET_BITS=64 +OBJS= +PROG= md5sum-lite md5fa maq2sam-short maq2sam-long wgsim +INCLUDES= -I.. +SUBDIRS= . + +.SUFFIXES:.c .o + +.c.o: + $(CC) -c $(CFLAGS) $(DFLAGS) $(INCLUDES) $< -o $@ + +all:$(PROG) + +lib-recur all-recur clean-recur cleanlocal-recur install-recur: + @target=`echo $@ | sed s/-recur//`; \ + wdir=`pwd`; \ + list='$(SUBDIRS)'; for subdir in $$list; do \ + cd $$subdir; \ + $(MAKE) CC="$(CC)" DFLAGS="$(DFLAGS)" CFLAGS="$(CFLAGS)" \ + INCLUDES="$(INCLUDES)" $$target || exit 1; \ + cd $$wdir; \ + done; + +lib: + +wgsim:wgsim.o + $(CC) $(CFLAGS) -o $@ wgsim.o -lm + +md5fa:md5.o md5fa.o md5.h ../kseq.h + $(CC) $(CFLAGS) -o $@ md5.o md5fa.o -lz + +md5sum-lite:md5sum-lite.o + $(CC) $(CFLAGS) -o $@ md5sum-lite.o + +md5sum-lite.o:md5.c md5.h + $(CC) -c $(CFLAGS) -DMD5SUM_MAIN -o $@ md5.c + +maq2sam-short:maq2sam.c + $(CC) $(CFLAGS) -o $@ maq2sam.c -lz + +maq2sam-long:maq2sam.c + $(CC) $(CFLAGS) -DMAQ_LONGREADS -o $@ maq2sam.c -lz + +md5fa.o:md5.h md5fa.c + $(CC) $(CFLAGS) -c -I.. -o $@ md5fa.c + +cleanlocal: + rm -fr gmon.out *.o a.out *.dSYM $(PROG) *~ *.a + +clean:cleanlocal-recur
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/SNV/SNVMix2_source/SNVMix2-v0.12.1-rc1/samtools-0.1.6/misc/blast2sam.pl Wed Oct 12 19:50:38 2011 -0400 @@ -0,0 +1,92 @@ +#!/usr/bin/perl -w + +use strict; +use warnings; +use Getopt::Std; + +&blast2sam; + +sub blast2sam { + my %opts = (); + getopts('s', \%opts); + die("Usage: blast2sam.pl <in.blastn>\n") if (-t STDIN && @ARGV == 0); + my ($qlen, $slen, $q, $s, $qbeg, $qend, @sam, @cigar, @cmaux, $show_seq); + $show_seq = defined($opts{s}); + @sam = (); @sam[0,4,6..8,10] = ('', 255, '*', 0, 0, '*'); + while (<>) { + if (@cigar && (/^Query=/ || /Score =.*bits.*Expect/)) { # print + &blast_print_sam(\@sam, \@cigar, \@cmaux, $qlen - $qend); + @cigar = (); + } + if (/^Query= (\S+)/) { + $sam[0] = $1; + } elsif (/\((\S+)\s+letters\)/) { + $qlen = $1; $qlen =~ s/,//g; + } elsif (/^>(\S+)/) { + $sam[2] = $1; + } elsif (/Length = (\d+)/) { + $slen = $1; + } elsif (/Score =\s+(\S+) bits.+Expect(\(\d+\))? = (\S+)/) { # the start of an alignment block + my ($as, $ev) = (int($1 + .499), $3); + $ev = "1$ev" if ($ev =~ /^e/); + @sam[1,3,9,11,12] = (0, 0, '', "AS:i:$as", "EV:Z:$ev"); + @cigar = (); $qbeg = 0; + @cmaux = (0, 0, 0, ''); + } elsif (/Strand = (\S+) \/ (\S+)/) { + $sam[1] |= 0x10 if ($2 eq 'Minus'); + } elsif (/Query\:\s(\d+)\s*(\S+)\s(\d+)/) { + $q = $2; + unless ($qbeg) { + $qbeg = $1; + push(@cigar, ($1-1) . "H") if ($1 > 1); + } + $qend = $3; + if ($show_seq) { + my $x = $q; + $x =~ s/-//g; $sam[9] .= $x; + } + } elsif (/Sbjct\:\s(\d+)\s*(\S+)\s(\d+)/) { + $s = $2; + if ($sam[1] & 0x10) { + $sam[3] = $3; + } else { + $sam[3] = $1 unless ($sam[3]); + } + &aln2cm(\@cigar, \$q, \$s, \@cmaux); + } + } + &blast_print_sam(\@sam, \@cigar, \@cmaux, $qlen - $qend); +} + +sub blast_print_sam { + my ($sam, $cigar, $cmaux, $qrest) = @_; + push(@$cigar, $cmaux->[1] . substr("MDI", $cmaux->[0], 1)); + push(@$cigar, $qrest . 'H') if ($qrest); + if ($sam->[1] & 0x10) { + @$cigar = reverse(@$cigar); + $sam->[9] = reverse($sam->[9]); + $sam->[9] =~ tr/atgcrymkswATGCRYMKSW/tacgyrkmswTACGYRKMSW/; + } + $sam->[9] = '*' if (!$sam->[9]); + $sam->[5] = join('', @$cigar); + print join("\t", @$sam), "\n"; +} + +sub aln2cm { + my ($cigar, $q, $s, $cmaux) = @_; + my $l = length($$q); + for (my $i = 0; $i < $l; ++$i) { + my $op; + # set $op + if (substr($$q, $i, 1) eq '-') { $op = 2; } + elsif (substr($$s, $i, 1) eq '-') { $op = 1; } + else { $op = 0; } + # for CIGAR + if ($cmaux->[0] == $op) { + ++$cmaux->[1]; + } else { + push(@$cigar, $cmaux->[1] . substr("MDI", $cmaux->[0], 1)); + $cmaux->[0] = $op; $cmaux->[1] = 1; + } + } +}
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/SNV/SNVMix2_source/SNVMix2-v0.12.1-rc1/samtools-0.1.6/misc/bowtie2sam.pl Wed Oct 12 19:50:38 2011 -0400 @@ -0,0 +1,92 @@ +#!/usr/bin/perl -w + +# Contact: lh3 +# Version: 0.1.1 + +use strict; +use warnings; +use Getopt::Std; + +&bowtie2sam; +exit; + +sub bowtie2sam { + my %opts = (); + die("Usage: bowtie2sam.pl <aln.bowtie>\n") if (@ARGV == 0 && -t STDIN); + # core loop + my (@s, $last, @staging, $k, $best_s, $subbest_s, $best_k); + $last = ''; + while (<>) { + my ($name, $nm) = &bowtie2sam_aux($_, \@s); # read_name, number of mismatches + if ($name eq $last) { + # I do not know whether the multiple hits are ordered on the + # number of mismatches. I assume they are not and so I have to + # keep all these multiple hits in memory. + @{$staging[$k]} = @s; + if ($best_s > $nm) { + $subbest_s = $best_s; + $best_s = $nm; + $best_k = $k; + } elsif ($subbest_s > $nm) { + $subbest_s = $nm; + } + ++$k; + } else { + if ($last) { + if ($best_s == $subbest_s) { + $staging[$best_k][4] = 0; + } elsif ($subbest_s - $best_s == 1) { + $staging[$best_k][4] = 15 if ($staging[$best_k][4] > 15); + } + print join("\t", @{$staging[$best_k]}), "\n"; + } + $k = 1; $best_s = $nm; $subbest_s = 1000; $best_k = 0; + @{$staging[0]} = @s; + $last = $name; + } + } + print join("\t", @{$staging[$best_k]}), "\n" if ($best_k >= 0); +} + +sub bowtie2sam_aux { + my ($line, $s) = @_; + chomp($line); + my @t = split("\t", $line); + my $ret; + @$s = (); + # read name + $s->[0] = $ret = $t[0]; + $s->[0] =~ s/\/[12]$//g; + # initial flag (will be updated later) + $s->[1] = 0; + # read & quality + $s->[9] = $t[4]; $s->[10] = $t[5]; + # cigar + $s->[5] = length($s->[9]) . "M"; + # coor + $s->[2] = $t[2]; $s->[3] = $t[3] + 1; + $s->[1] |= 0x10 if ($t[1] eq '-'); + # mapQ + $s->[4] = $t[6] == 0? 25 : 0; + # mate coordinate + $s->[6] = '*'; $s->[7] = $s->[8] = 0; + # aux + my $nm = @t - 7; + push(@$s, "NM:i:" . (@t-7)); + push(@$s, "X$nm:i:" . ($t[6]+1)); + my $md = ''; + if ($t[7]) { + $_ = $t[7]; + my $a = 0; + while (/(\d+):[ACGTN]>([ACGTN])/gi) { + my ($y, $z) = ($1, $2); + $md .= (int($y)-$a) . $z; + $a += $y - $a + 1; + } + $md .= length($s->[9]) - $a; + } else { + $md = length($s->[9]); + } + push(@$s, "MD:Z:$md"); + return ($ret, $nm); +}
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/SNV/SNVMix2_source/SNVMix2-v0.12.1-rc1/samtools-0.1.6/misc/export2sam.pl Wed Oct 12 19:50:38 2011 -0400 @@ -0,0 +1,107 @@ +#!/usr/bin/perl -w + +# Contact: lh3 +# Version: 0.1.2 (03JAN2009) + +use strict; +use warnings; +use Getopt::Std; + +&export2sam; +exit; + +sub export2sam { + my ($fh1, $fh2, $is_paired); + $is_paired = (@ARGV >= 2); + die("export2sam.pl <read1.export> [<read2.export>]\n") if (@ARGV == 0); + open($fh1, $ARGV[0]) || die; + if ($is_paired) { + open($fh2, $ARGV[1]) || die; + } + # conversion table + my @conv_table; + for (-64..64) { + $conv_table[$_+64] = chr(int(33 + 10*log(1+10**($_/10.0))/log(10)+.499)); + } + # core loop + while (<$fh1>) { + my (@s1, @s2); + &export2sam_aux($_, \@s1, \@conv_table, $is_paired); + if ($is_paired) { + $_ = <$fh2>; + &export2sam_aux($_, \@s2, \@conv_table, $is_paired); + if (@s1 && @s2) { # then set mate coordinate + my $isize = 0; + if ($s1[2] ne '*' && $s1[2] eq $s2[2]) { # then calculate $isize + my $x1 = ($s1[1] & 0x10)? $s1[3] + length($s1[9]) : $s1[3]; + my $x2 = ($s2[1] & 0x10)? $s2[3] + length($s2[9]) : $s2[3]; + $isize = $x2 - $x1; + } + # update mate coordinate + if ($s2[2] ne '*') { + @s1[6..8] = (($s2[2] eq $s1[2])? "=" : $s2[2], $s2[3], $isize); + $s1[1] |= 0x20 if ($s2[1] & 0x10); + } else { + $s1[1] |= 0x8; + } + if ($s1[2] ne '*') { + @s2[6..8] = (($s1[2] eq $s2[2])? "=" : $s1[2], $s1[3], -$isize); + $s2[1] |= 0x20 if ($s1[1] & 0x10); + } else { + $s2[1] |= 0x8; + } + } + } + print join("\t", @s1), "\n" if (@s1); + print join("\t", @s2), "\n" if (@s2 && $is_paired); + } + close($fh1); + close($fh2) if ($is_paired); +} + +sub export2sam_aux { + my ($line, $s, $ct, $is_paired) = @_; + chomp($line); + my @t = split("\t", $line); + @$s = (); + return if ($t[21] ne 'Y'); + # read name + $s->[0] = $t[1]? "$t[0]_$t[1]:$t[2]:$t[3]:$t[4]:$t[5]" : "$t[0]:$t[2]:$t[3]:$t[4]:$t[5]"; + # initial flag (will be updated later) + $s->[1] = 0; + $s->[1] |= 1 | 1<<(5 + $t[7]) if ($is_paired); + # read & quality + $s->[9] = $t[8]; $s->[10] = $t[9]; + if ($t[13] eq 'R') { # then reverse the sequence and quality + $s->[9] = reverse($t[8]); + $s->[9] =~ tr/ACGTacgt/TGCAtgca/; + $s->[10] = reverse($t[9]); + } + $s->[10] =~ s/(.)/$ct->[ord($1)]/eg; # change coding + # cigar + $s->[5] = length($s->[9]) . "M"; + # coor + my $has_coor = 0; + $s->[2] = "*"; + if ($t[10] eq 'NM' || $t[10] eq 'QC') { + $s->[1] |= 0x4; # unmapped + } elsif ($t[10] =~ /(\d+):(\d+):(\d+)/) { + $s->[1] |= 0x4; # TODO: should I set BAM_FUNMAP in this case? + push(@$s, "H0:i:$1", "H1:i:$2", "H2:i:$3") + } else { + $s->[2] = $t[10]; + $has_coor = 1; + } + $s->[3] = $has_coor? $t[12] : 0; + $s->[1] |= 0x10 if ($has_coor && $t[13] eq 'R'); + # mapQ (TODO: should I choose the larger between $t[15] and $t[16]?) + $s->[4] = 0; + $s->[4] = $t[15] if ($t[15] ne ''); + $s->[4] = $t[16] if ($t[16] ne '' && $s->[4] < $t[16]); + # mate coordinate + $s->[6] = '*'; $s->[7] = $s->[8] = 0; + # aux + push(@$s, "BC:Z:$t[6]") if ($t[6]); + push(@$s, "MD:Z:$t[14]") if ($has_coor); + push(@$s, "SM:i:$t[15]") if ($is_paired && $has_coor); +}
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/SNV/SNVMix2_source/SNVMix2-v0.12.1-rc1/samtools-0.1.6/misc/interpolate_sam.pl Wed Oct 12 19:50:38 2011 -0400 @@ -0,0 +1,125 @@ +#!/usr/bin/perl +use strict; + +###Builds interpolated pileup from SAM file +##@description counts bases between paired ends and piles up single end reads. +##@output, uses a #header for the RNAME and then the number of reads per base +##@author sm8@sanger.ac.uk, Stephen B. Montgomery + +##@caveats +##Requires RNAME to have format as per example +## chromosome:NCBI36:18:1:76117153:1 +## supercontig::NT_113883:1:137703:1 +## clone::AC138827.3:1:149397:1 +##Expects simple CIGAR characters, M, I and D +##Expects SAM file to be sorted. +##Expects 0x0010 to mark second read in PE file (as has been the observed case from MAQ output) (important for line 77) + +##Verify and read in SAM file +my $sam_file = $ARGV[0]; +if(!defined($sam_file)) { die("No sam file defined on arg 1"); } +unless(-f $sam_file) { die("Sam file does not exist: $sam_file"); } +open(SAM, $sam_file) || die("Cannot open sam file"); + +##Globals +my $current_location = ""; ##Current RNAME being processed +my $current_size = 0; ##Size of sequence region being processed +my $current_position = 1; ##Current base being processed +my $open = 0; ##Number of open reads (PE reads that have not been closed) +my %close = (); ##Hash of closing positions, when the current_position gets to this position it subtracts the + ##contained value from those open and deletes the indexed position from the hash + +while (my $line = <SAM>) { + my @tokens = split /\t/, $line; + + if ($current_location ne $tokens[2]) { ##Start a new sequence region + for (my $i = $current_position; $i <= $current_size; $i++) { ##Close the previous sequence region + if (defined($close{$i})) { + $open = $open - $close{$i}; + delete $close{$i}; + } + print $open . "\n"; + } + if ($current_location ne "") { + print "\n"; + } + + ##Initiate a new sequence region + my @location_tokens = split /:/, $tokens[2]; + $current_position = 1; + $current_location = $tokens[2]; + $current_size = $location_tokens[4]; + $open = 0; + %close = (); + print "#" . $tokens[2] . "\n"; + + ##Print pileup to just before the first read (will be 0) + for (my $current_position = 1; $current_position < $tokens[3]; $current_position++) { + print $open . "\n"; + } + $current_position = $tokens[3]; + + } else { ##Sequence region already open + if ($tokens[3] > $current_position) { ##If the new read's position is greater than the current position + ##cycle through to catch up to the current position + for (my $i = $current_position; $i < $tokens[3]; $i++) { + if (defined($close{$i})) { + $open = $open - $close{$i}; + delete $close{$i}; + } + print $open . "\n"; + } + $current_position = $tokens[3]; + } + } + $open++; ##Increment the number of open reads + + if (($tokens[1] & 0x0080 || $tokens[1] & 0x0040) && $tokens[1] & 0x0010 && $tokens[1] & 0x0002) { ##if second read of mate pair, add close condition + $open--; + my $parsed_cig = &parseCigar($tokens[5]); + my $seq_region_end = $tokens[3] + $parsed_cig->{'M'} + $parsed_cig->{'D'} - 1; + if (!defined($close{$seq_region_end + 1})) { $close{$seq_region_end + 1} = 0; } + $close{$seq_region_end + 1} = $close{$seq_region_end + 1} + 1; + } elsif (!($tokens[1] & 0x0001) || !($tokens[1] & 0x0002)) { ##if unpaired, add close condition + my $parsed_cig = &parseCigar($tokens[5]); + my $seq_region_end = $tokens[3] + $parsed_cig->{'M'} + $parsed_cig->{'D'} - 1; + if (!defined($close{$seq_region_end + 1})) { $close{$seq_region_end + 1} = 0; } + $close{$seq_region_end + 1} = $close{$seq_region_end + 1} + 1; + } else { + #do nothing + } +} +for (my $i = $current_position; $i <= $current_size; $i++) { ##Finish up the last sequence region + if (defined($close{$i})) { + $open = $open - $close{$i}; + delete $close{$i}; + } + print $open . "\n"; +} +print "\n"; +close(SAM); +exit(0); + +##reads and tokenizes simple cigarline +sub parseCigar() { + my $cigar_line = shift; + $cigar_line =~ s/([0-9]*[A-Z]{1})/$1\t/g; + my @cigar_tokens = split /\t/, $cigar_line; + my %parsed = ('M' => 0, + 'I' => 0, + 'D' => 0); + my @events = (); + for(my $i = 0; $i < scalar(@cigar_tokens); $i++) { + if ($cigar_tokens[$i] =~ /([0-9]+)([A-Z]{1})/g) { + if (!defined($parsed{$2})) { $parsed{$2} = 0; } + my $nt = $2; + if ($nt ne "M" && $nt ne "D" && $nt ne "I") { $nt = "M"; } + $parsed{$nt} += $1; + my %event_el = ("t" => $nt, + "n" => $1); + push @events, \%event_el; + } + } + $parsed{'events'} = \@events; + return \%parsed; +}
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/SNV/SNVMix2_source/SNVMix2-v0.12.1-rc1/samtools-0.1.6/misc/maq2sam.c Wed Oct 12 19:50:38 2011 -0400 @@ -0,0 +1,173 @@ +#include <string.h> +#include <zlib.h> +#include <stdio.h> +#include <inttypes.h> +#include <stdlib.h> +#include <assert.h> + +#define PACKAGE_VERSION "r439" + +//#define MAQ_LONGREADS + +#ifdef MAQ_LONGREADS +# define MAX_READLEN 128 +#else +# define MAX_READLEN 64 +#endif + +#define MAX_NAMELEN 36 +#define MAQMAP_FORMAT_OLD 0 +#define MAQMAP_FORMAT_NEW -1 + +#define PAIRFLAG_FF 0x01 +#define PAIRFLAG_FR 0x02 +#define PAIRFLAG_RF 0x04 +#define PAIRFLAG_RR 0x08 +#define PAIRFLAG_PAIRED 0x10 +#define PAIRFLAG_DIFFCHR 0x20 +#define PAIRFLAG_NOMATCH 0x40 +#define PAIRFLAG_SW 0x80 + +typedef struct +{ + uint8_t seq[MAX_READLEN]; /* the last base is the single-end mapping quality. */ + uint8_t size, map_qual, info1, info2, c[2], flag, alt_qual; + uint32_t seqid, pos; + int dist; + char name[MAX_NAMELEN]; +} maqmap1_t; + +typedef struct +{ + int format, n_ref; + char **ref_name; + uint64_t n_mapped_reads; + maqmap1_t *mapped_reads; +} maqmap_t; + +maqmap_t *maq_new_maqmap() +{ + maqmap_t *mm = (maqmap_t*)calloc(1, sizeof(maqmap_t)); + mm->format = MAQMAP_FORMAT_NEW; + return mm; +} +void maq_delete_maqmap(maqmap_t *mm) +{ + int i; + if (mm == 0) return; + for (i = 0; i < mm->n_ref; ++i) + free(mm->ref_name[i]); + free(mm->ref_name); + free(mm->mapped_reads); + free(mm); +} +maqmap_t *maqmap_read_header(gzFile fp) +{ + maqmap_t *mm; + int k, len; + mm = maq_new_maqmap(); + gzread(fp, &mm->format, sizeof(int)); + if (mm->format != MAQMAP_FORMAT_NEW) { + if (mm->format > 0) { + fprintf(stderr, "** Obsolete map format is detected. Please use 'mapass2maq' command to convert the format.\n"); + exit(3); + } + assert(mm->format == MAQMAP_FORMAT_NEW); + } + gzread(fp, &mm->n_ref, sizeof(int)); + mm->ref_name = (char**)calloc(mm->n_ref, sizeof(char*)); + for (k = 0; k != mm->n_ref; ++k) { + gzread(fp, &len, sizeof(int)); + mm->ref_name[k] = (char*)malloc(len * sizeof(char)); + gzread(fp, mm->ref_name[k], len); + } + /* read number of mapped reads */ + gzread(fp, &mm->n_mapped_reads, sizeof(uint64_t)); + return mm; +} + +void maq2tam_core(gzFile fp, const char *rg) +{ + maqmap_t *mm; + maqmap1_t mm1, *m1; + int ret; + m1 = &mm1; + mm = maqmap_read_header(fp); + while ((ret = gzread(fp, m1, sizeof(maqmap1_t))) == sizeof(maqmap1_t)) { + int j, flag = 0, se_mapq = m1->seq[MAX_READLEN-1]; + if (m1->flag) flag |= 1; + if ((m1->flag&PAIRFLAG_PAIRED) || ((m1->flag&PAIRFLAG_SW) && m1->flag != 192)) flag |= 2; + if (m1->flag == 192) flag |= 4; + if (m1->flag == 64) flag |= 8; + if (m1->pos&1) flag |= 0x10; + if ((flag&1) && m1->dist != 0) { + int c; + if (m1->dist > 0) { + if (m1->flag&(PAIRFLAG_FF|PAIRFLAG_RF)) c = 0; + else if (m1->flag&(PAIRFLAG_FR|PAIRFLAG_RR)) c = 1; + else c = m1->pos&1; + } else { + if (m1->flag&(PAIRFLAG_FF|PAIRFLAG_FR)) c = 0; + else if (m1->flag&(PAIRFLAG_RF|PAIRFLAG_RR)) c = 1; + else c = m1->pos&1; + } + if (c) flag |= 0x20; + } + if (m1->flag) { + int l = strlen(m1->name); + if (m1->name[l-2] == '/') { + flag |= (m1->name[l-1] == '1')? 0x40 : 0x80; + m1->name[l-2] = '\0'; + } + } + printf("%s\t%d\t", m1->name, flag); + printf("%s\t%d\t", mm->ref_name[m1->seqid], (m1->pos>>1)+1); + if (m1->flag == 130) { + int c = (int8_t)m1->seq[MAX_READLEN-1]; + printf("%d\t", m1->alt_qual); + if (c == 0) printf("%dM\t", m1->size); + else { + if (c > 0) printf("%dM%dI%dM\t", m1->map_qual, c, m1->size - m1->map_qual - c); + else printf("%dM%dD%dM\t", m1->map_qual, -c, m1->size - m1->map_qual); + } + se_mapq = 0; // zero SE mapQ for reads aligned by SW + } else { + if (flag&4) printf("0\t*\t"); + else printf("%d\t%dM\t", m1->map_qual, m1->size); + } + printf("*\t0\t%d\t", m1->dist); + for (j = 0; j != m1->size; ++j) { + if (m1->seq[j] == 0) putchar('N'); + else putchar("ACGT"[m1->seq[j]>>6&3]); + } + putchar('\t'); + for (j = 0; j != m1->size; ++j) + putchar((m1->seq[j]&0x3f) + 33); + putchar('\t'); + if (rg) printf("RG:Z:%s\t", rg); + if (flag&4) { // unmapped + printf("MF:i:%d\n", m1->flag); + } else { + printf("MF:i:%d\t", m1->flag); + if (m1->flag) printf("AM:i:%d\tSM:i:%d\t", m1->alt_qual, se_mapq); + printf("NM:i:%d\tUQ:i:%d\tH0:i:%d\tH1:i:%d\n", m1->info1&0xf, m1->info2, m1->c[0], m1->c[1]); + } + } + if (ret > 0) + fprintf(stderr, "Truncated! Continue anyway.\n"); + maq_delete_maqmap(mm); +} + +int main(int argc, char *argv[]) +{ + gzFile fp; + if (argc == 1) { + fprintf(stderr, "Version: %s\n", PACKAGE_VERSION); + fprintf(stderr, "Usage: maq2sam <in.map> [<readGroup>]\n"); + return 1; + } + fp = strcmp(argv[1], "-")? gzopen(argv[1], "r") : gzdopen(fileno(stdin), "r"); + maq2tam_core(fp, argc > 2? argv[2] : 0); + gzclose(fp); + return 0; +}
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/SNV/SNVMix2_source/SNVMix2-v0.12.1-rc1/samtools-0.1.6/misc/md5.c Wed Oct 12 19:50:38 2011 -0400 @@ -0,0 +1,296 @@ +/* + * This code implements the MD5 message-digest algorithm. + * The algorithm is due to Ron Rivest. This code was + * written by Colin Plumb in 1993, no copyright is claimed. + * This code is in the public domain; do with it what you wish. + * + * Equivalent code is available from RSA Data Security, Inc. + * This code has been tested against that, and is equivalent, + * except that you don't need to include two pages of legalese + * with every copy. + * + * To compute the message digest of a chunk of bytes, declare an + * MD5Context structure, pass it to MD5Init, call MD5Update as + * needed on buffers full of bytes, and then call MD5Final, which + * will fill a supplied 16-byte array with the digest. + */ + +/* Brutally hacked by John Walker back from ANSI C to K&R (no + prototypes) to maintain the tradition that Netfone will compile + with Sun's original "cc". */ + +#include <string.h> +#include "md5.h" + +#ifndef HIGHFIRST +#define byteReverse(buf, len) /* Nothing */ +#else +/* + * Note: this code is harmless on little-endian machines. + */ +void byteReverse(buf, longs) + unsigned char *buf; unsigned longs; +{ + uint32_t t; + do { + t = (uint32_t) ((unsigned) buf[3] << 8 | buf[2]) << 16 | + ((unsigned) buf[1] << 8 | buf[0]); + *(uint32_t *) buf = t; + buf += 4; + } while (--longs); +} +#endif + +void MD5Transform(uint32_t buf[4], uint32_t in[16]); + + +/* + * Start MD5 accumulation. Set bit count to 0 and buffer to mysterious + * initialization constants. + */ +void MD5Init(ctx) + struct MD5Context *ctx; +{ + ctx->buf[0] = 0x67452301; + ctx->buf[1] = 0xefcdab89; + ctx->buf[2] = 0x98badcfe; + ctx->buf[3] = 0x10325476; + + ctx->bits[0] = 0; + ctx->bits[1] = 0; +} + +/* + * Update context to reflect the concatenation of another buffer full + * of bytes. + */ +void MD5Update(ctx, buf, len) + struct MD5Context *ctx; unsigned char *buf; unsigned len; +{ + uint32_t t; + + /* Update bitcount */ + + t = ctx->bits[0]; + if ((ctx->bits[0] = t + ((uint32_t) len << 3)) < t) + ctx->bits[1]++; /* Carry from low to high */ + ctx->bits[1] += len >> 29; + + t = (t >> 3) & 0x3f; /* Bytes already in shsInfo->data */ + + /* Handle any leading odd-sized chunks */ + + if (t) { + unsigned char *p = (unsigned char *) ctx->in + t; + + t = 64 - t; + if (len < t) { + memcpy(p, buf, len); + return; + } + memcpy(p, buf, t); + byteReverse(ctx->in, 16); + MD5Transform(ctx->buf, (uint32_t *) ctx->in); + buf += t; + len -= t; + } + /* Process data in 64-byte chunks */ + + while (len >= 64) { + memcpy(ctx->in, buf, 64); + byteReverse(ctx->in, 16); + MD5Transform(ctx->buf, (uint32_t *) ctx->in); + buf += 64; + len -= 64; + } + + /* Handle any remaining bytes of data. */ + + memcpy(ctx->in, buf, len); +} + +/* + * Final wrapup - pad to 64-byte boundary with the bit pattern + * 1 0* (64-bit count of bits processed, MSB-first) + */ +void MD5Final(digest, ctx) + unsigned char digest[16]; struct MD5Context *ctx; +{ + unsigned count; + unsigned char *p; + + /* Compute number of bytes mod 64 */ + count = (ctx->bits[0] >> 3) & 0x3F; + + /* Set the first char of padding to 0x80. This is safe since there is + always at least one byte free */ + p = ctx->in + count; + *p++ = 0x80; + + /* Bytes of padding needed to make 64 bytes */ + count = 64 - 1 - count; + + /* Pad out to 56 mod 64 */ + if (count < 8) { + /* Two lots of padding: Pad the first block to 64 bytes */ + memset(p, 0, count); + byteReverse(ctx->in, 16); + MD5Transform(ctx->buf, (uint32_t *) ctx->in); + + /* Now fill the next block with 56 bytes */ + memset(ctx->in, 0, 56); + } else { + /* Pad block to 56 bytes */ + memset(p, 0, count - 8); + } + byteReverse(ctx->in, 14); + + /* Append length in bits and transform */ + ((uint32_t *) ctx->in)[14] = ctx->bits[0]; + ((uint32_t *) ctx->in)[15] = ctx->bits[1]; + + MD5Transform(ctx->buf, (uint32_t *) ctx->in); + byteReverse((unsigned char *) ctx->buf, 4); + memcpy(digest, ctx->buf, 16); + memset(ctx, 0, sizeof(ctx)); /* In case it's sensitive */ +} + + +/* The four core functions - F1 is optimized somewhat */ + +/* #define F1(x, y, z) (x & y | ~x & z) */ +#define F1(x, y, z) (z ^ (x & (y ^ z))) +#define F2(x, y, z) F1(z, x, y) +#define F3(x, y, z) (x ^ y ^ z) +#define F4(x, y, z) (y ^ (x | ~z)) + +/* This is the central step in the MD5 algorithm. */ +#define MD5STEP(f, w, x, y, z, data, s) \ + ( w += f(x, y, z) + data, w = w<<s | w>>(32-s), w += x ) + +/* + * The core of the MD5 algorithm, this alters an existing MD5 hash to + * reflect the addition of 16 longwords of new data. MD5Update blocks + * the data and converts bytes into longwords for this routine. + */ +void MD5Transform(buf, in) + uint32_t buf[4]; uint32_t in[16]; +{ + register uint32_t a, b, c, d; + + a = buf[0]; + b = buf[1]; + c = buf[2]; + d = buf[3]; + + MD5STEP(F1, a, b, c, d, in[0] + 0xd76aa478, 7); + MD5STEP(F1, d, a, b, c, in[1] + 0xe8c7b756, 12); + MD5STEP(F1, c, d, a, b, in[2] + 0x242070db, 17); + MD5STEP(F1, b, c, d, a, in[3] + 0xc1bdceee, 22); + MD5STEP(F1, a, b, c, d, in[4] + 0xf57c0faf, 7); + MD5STEP(F1, d, a, b, c, in[5] + 0x4787c62a, 12); + MD5STEP(F1, c, d, a, b, in[6] + 0xa8304613, 17); + MD5STEP(F1, b, c, d, a, in[7] + 0xfd469501, 22); + MD5STEP(F1, a, b, c, d, in[8] + 0x698098d8, 7); + MD5STEP(F1, d, a, b, c, in[9] + 0x8b44f7af, 12); + MD5STEP(F1, c, d, a, b, in[10] + 0xffff5bb1, 17); + MD5STEP(F1, b, c, d, a, in[11] + 0x895cd7be, 22); + MD5STEP(F1, a, b, c, d, in[12] + 0x6b901122, 7); + MD5STEP(F1, d, a, b, c, in[13] + 0xfd987193, 12); + MD5STEP(F1, c, d, a, b, in[14] + 0xa679438e, 17); + MD5STEP(F1, b, c, d, a, in[15] + 0x49b40821, 22); + + MD5STEP(F2, a, b, c, d, in[1] + 0xf61e2562, 5); + MD5STEP(F2, d, a, b, c, in[6] + 0xc040b340, 9); + MD5STEP(F2, c, d, a, b, in[11] + 0x265e5a51, 14); + MD5STEP(F2, b, c, d, a, in[0] + 0xe9b6c7aa, 20); + MD5STEP(F2, a, b, c, d, in[5] + 0xd62f105d, 5); + MD5STEP(F2, d, a, b, c, in[10] + 0x02441453, 9); + MD5STEP(F2, c, d, a, b, in[15] + 0xd8a1e681, 14); + MD5STEP(F2, b, c, d, a, in[4] + 0xe7d3fbc8, 20); + MD5STEP(F2, a, b, c, d, in[9] + 0x21e1cde6, 5); + MD5STEP(F2, d, a, b, c, in[14] + 0xc33707d6, 9); + MD5STEP(F2, c, d, a, b, in[3] + 0xf4d50d87, 14); + MD5STEP(F2, b, c, d, a, in[8] + 0x455a14ed, 20); + MD5STEP(F2, a, b, c, d, in[13] + 0xa9e3e905, 5); + MD5STEP(F2, d, a, b, c, in[2] + 0xfcefa3f8, 9); + MD5STEP(F2, c, d, a, b, in[7] + 0x676f02d9, 14); + MD5STEP(F2, b, c, d, a, in[12] + 0x8d2a4c8a, 20); + + MD5STEP(F3, a, b, c, d, in[5] + 0xfffa3942, 4); + MD5STEP(F3, d, a, b, c, in[8] + 0x8771f681, 11); + MD5STEP(F3, c, d, a, b, in[11] + 0x6d9d6122, 16); + MD5STEP(F3, b, c, d, a, in[14] + 0xfde5380c, 23); + MD5STEP(F3, a, b, c, d, in[1] + 0xa4beea44, 4); + MD5STEP(F3, d, a, b, c, in[4] + 0x4bdecfa9, 11); + MD5STEP(F3, c, d, a, b, in[7] + 0xf6bb4b60, 16); + MD5STEP(F3, b, c, d, a, in[10] + 0xbebfbc70, 23); + MD5STEP(F3, a, b, c, d, in[13] + 0x289b7ec6, 4); + MD5STEP(F3, d, a, b, c, in[0] + 0xeaa127fa, 11); + MD5STEP(F3, c, d, a, b, in[3] + 0xd4ef3085, 16); + MD5STEP(F3, b, c, d, a, in[6] + 0x04881d05, 23); + MD5STEP(F3, a, b, c, d, in[9] + 0xd9d4d039, 4); + MD5STEP(F3, d, a, b, c, in[12] + 0xe6db99e5, 11); + MD5STEP(F3, c, d, a, b, in[15] + 0x1fa27cf8, 16); + MD5STEP(F3, b, c, d, a, in[2] + 0xc4ac5665, 23); + + MD5STEP(F4, a, b, c, d, in[0] + 0xf4292244, 6); + MD5STEP(F4, d, a, b, c, in[7] + 0x432aff97, 10); + MD5STEP(F4, c, d, a, b, in[14] + 0xab9423a7, 15); + MD5STEP(F4, b, c, d, a, in[5] + 0xfc93a039, 21); + MD5STEP(F4, a, b, c, d, in[12] + 0x655b59c3, 6); + MD5STEP(F4, d, a, b, c, in[3] + 0x8f0ccc92, 10); + MD5STEP(F4, c, d, a, b, in[10] + 0xffeff47d, 15); + MD5STEP(F4, b, c, d, a, in[1] + 0x85845dd1, 21); + MD5STEP(F4, a, b, c, d, in[8] + 0x6fa87e4f, 6); + MD5STEP(F4, d, a, b, c, in[15] + 0xfe2ce6e0, 10); + MD5STEP(F4, c, d, a, b, in[6] + 0xa3014314, 15); + MD5STEP(F4, b, c, d, a, in[13] + 0x4e0811a1, 21); + MD5STEP(F4, a, b, c, d, in[4] + 0xf7537e82, 6); + MD5STEP(F4, d, a, b, c, in[11] + 0xbd3af235, 10); + MD5STEP(F4, c, d, a, b, in[2] + 0x2ad7d2bb, 15); + MD5STEP(F4, b, c, d, a, in[9] + 0xeb86d391, 21); + + buf[0] += a; + buf[1] += b; + buf[2] += c; + buf[3] += d; +} + +/* lh3: the following code is added by me */ + +#ifdef MD5SUM_MAIN +#include <stdio.h> +#include <stdlib.h> +#include <string.h> +#define HEX_STR "0123456789abcdef" + +static void md5_one(const char *fn) +{ + unsigned char buf[4096], digest[16]; + MD5_CTX md5; + int l; + FILE *fp; + + fp = strcmp(fn, "-")? fopen(fn, "r") : stdin; + if (fp == 0) { + fprintf(stderr, "md5sum: %s: No such file or directory\n", fn); + exit(1); + } + MD5Init(&md5); + while ((l = fread(buf, 1, 4096, fp)) > 0) + MD5Update(&md5, buf, l); + MD5Final(digest, &md5); + if (fp != stdin) fclose(fp); + for (l = 0; l < 16; ++l) + printf("%c%c", HEX_STR[digest[l]>>4&0xf], HEX_STR[digest[l]&0xf]); + printf(" %s\n", fn); +} +int main(int argc, char *argv[]) +{ + int i; + if (argc == 1) md5_one("-"); + else for (i = 1; i < argc; ++i) md5_one(argv[i]); + return 0; +} +#endif
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/SNV/SNVMix2_source/SNVMix2-v0.12.1-rc1/samtools-0.1.6/misc/md5.h Wed Oct 12 19:50:38 2011 -0400 @@ -0,0 +1,57 @@ +/* + This file is adapted from a program in this page: + + http://www.fourmilab.ch/md5/ + + The original source code does not work on 64-bit machines due to the + wrong typedef "uint32". I also added prototypes. + + -lh3 + */ + +#ifndef MD5_H +#define MD5_H + +/* The following tests optimise behaviour on little-endian + machines, where there is no need to reverse the byte order + of 32 bit words in the MD5 computation. By default, + HIGHFIRST is defined, which indicates we're running on a + big-endian (most significant byte first) machine, on which + the byteReverse function in md5.c must be invoked. However, + byteReverse is coded in such a way that it is an identity + function when run on a little-endian machine, so calling it + on such a platform causes no harm apart from wasting time. + If the platform is known to be little-endian, we speed + things up by undefining HIGHFIRST, which defines + byteReverse as a null macro. Doing things in this manner + insures we work on new platforms regardless of their byte + order. */ + +#define HIGHFIRST + +#if __LITTLE_ENDIAN__ != 0 +#undef HIGHFIRST +#endif + +#include <stdint.h> + +struct MD5Context { + uint32_t buf[4]; + uint32_t bits[2]; + unsigned char in[64]; +}; + +void MD5Init(struct MD5Context *ctx); +void MD5Update(struct MD5Context *ctx, unsigned char *buf, unsigned len); +void MD5Final(unsigned char digest[16], struct MD5Context *ctx); + +/* + * This is needed to make RSAREF happy on some MS-DOS compilers. + */ +typedef struct MD5Context MD5_CTX; + +/* Define CHECK_HARDWARE_PROPERTIES to have main,c verify + byte order and uint32_t settings. */ +#define CHECK_HARDWARE_PROPERTIES + +#endif /* !MD5_H */
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/SNV/SNVMix2_source/SNVMix2-v0.12.1-rc1/samtools-0.1.6/misc/md5fa.c Wed Oct 12 19:50:38 2011 -0400 @@ -0,0 +1,58 @@ +#include <stdio.h> +#include <zlib.h> +#include "md5.h" +#include "kseq.h" + +#define HEX_STR "0123456789abcdef" + +KSEQ_INIT(gzFile, gzread) + +static void md5_one(const char *fn) +{ + MD5_CTX md5_one, md5_all; + int l, i, k; + gzFile fp; + kseq_t *seq; + unsigned char unordered[16], digest[16]; + + for (l = 0; l < 16; ++l) unordered[l] = 0; + fp = strcmp(fn, "-")? gzopen(fn, "r") : gzdopen(fileno(stdin), "r"); + if (fp == 0) { + fprintf(stderr, "md5fa: %s: No such file or directory\n", fn); + exit(1); + } + + MD5Init(&md5_all); + seq = kseq_init(fp); + while ((l = kseq_read(seq)) >= 0) { + for (i = k = 0; i < seq->seq.l; ++i) { + if (islower(seq->seq.s[i])) seq->seq.s[k++] = toupper(seq->seq.s[i]); + else if (isupper(seq->seq.s[i])) seq->seq.s[k++] = seq->seq.s[i]; + } + MD5Init(&md5_one); + MD5Update(&md5_one, (unsigned char*)seq->seq.s, k); + MD5Final(digest, &md5_one); + for (l = 0; l < 16; ++l) { + printf("%c%c", HEX_STR[digest[l]>>4&0xf], HEX_STR[digest[l]&0xf]); + unordered[l] ^= digest[l]; + } + printf(" %s %s\n", fn, seq->name.s); + MD5Update(&md5_all, (unsigned char*)seq->seq.s, k); + } + MD5Final(digest, &md5_all); + kseq_destroy(seq); + for (l = 0; l < 16; ++l) + printf("%c%c", HEX_STR[digest[l]>>4&0xf], HEX_STR[digest[l]&0xf]); + printf(" %s >ordered\n", fn); + for (l = 0; l < 16; ++l) + printf("%c%c", HEX_STR[unordered[l]>>4&0xf], HEX_STR[unordered[l]&0xf]); + printf(" %s >unordered\n", fn); +} + +int main(int argc, char *argv[]) +{ + int i; + if (argc == 1) md5_one("-"); + else for (i = 1; i < argc; ++i) md5_one(argv[i]); + return 0; +}
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/SNV/SNVMix2_source/SNVMix2-v0.12.1-rc1/samtools-0.1.6/misc/novo2sam.pl Wed Oct 12 19:50:38 2011 -0400 @@ -0,0 +1,281 @@ +#!/usr/bin/perl -w + +# Contact: lh3 +# Version: 0.1.3 + +#Modified by Zayed Albertyn(zayed.albertyn@gmail.com) & Colin Hercus(colin@novocraft.com) + +#use strict; +#use warnings; +use Data::Dumper; +use Getopt::Std; + +&novo2sam; +exit; + +sub mating { + my ($s1, $s2) = @_; + my $isize = 0; + if ($s1->[2] ne '*' && $s1->[2] eq $s2->[2]) { # then calculate $isize + my $x1 = ($s1->[1] & 0x10)? $s1->[3] + length($s1->[9]) : $s1->[3]; + my $x2 = ($s2->[1] & 0x10)? $s2->[3] + length($s2->[9]) : $s2->[3]; + $isize = $x2 - $x1; + } + # update mate coordinate + if ($s2->[2] ne '*') { + @$s1[6..8] = (($s2->[2] eq $s1->[2])? "=" : $s2->[2], $s2->[3], $isize); + $s1->[1] |= 0x20 if ($s2->[1] & 0x10); + } else { + $s1->[1] |= 0x8; + } + if ($s1->[2] ne '*') { + @$s2[6..8] = (($s1->[2] eq $s2->[2])? "=" : $s1->[2], $s1->[3], -$isize); + $s2->[1] |= 0x20 if ($s1->[1] & 0x10); + } else { + $s2->[1] |= 0x8; + } +} + +sub novo2sam { + my %opts = (); + getopts("p", \%opts); + die("Usage: novo2sam.pl [-p] <aln.novo>\n") if (@ARGV == 0); + my $is_paired = defined($opts{p}); + # core loop + my @s1 = (); + my @s2 = (); + my ($s_last, $s_curr) = (\@s1, \@s2); + while (<>) { + next if (/^#/); + next if (/(QC|NM)\s*$/ || /(R\s+\d+)\s*$/); + &novo2sam_aux($_, $s_curr, $is_paired); + if (@$s_last != 0 && $s_last->[0] eq $s_curr->[0]) { + &mating($s_last, $s_curr); + print join("\t", @$s_last), "\n"; + print join("\t", @$s_curr), "\n"; + @$s_last = (); @$s_curr = (); + } else { + print join("\t", @$s_last), "\n" if (@$s_last != 0); + my $s = $s_last; $s_last = $s_curr; $s_curr = $s; + } + } + print join("\t", @$s_last), "\n" if (@$s_last != 0); +} + +sub novo2sam_aux { + my ($line, $s, $is_paired) = @_; + + chomp($line); + my @t = split(/\s+/, $line); + my @variations = @t[13 .. $#t]; + @$s = (); + return if ($t[4] ne 'U'); + my $len = length($t[2]); + # read name + $s->[0] = substr($t[0], 1); + $s->[0] =~ s/\/[12]$//g; + # initial flag (will be updated later) + $s->[1] = 0; + $s->[1] |= 1 | 1<<($t[1] eq 'L'? 6 : 7); + $s->[1] |= 2 if ($t[10] eq '.'); + # read & quality + if ($t[9] eq 'R') { + $s->[9] = reverse($t[2]); + $s->[10] = reverse($t[3]); + $s->[9] =~ tr/ACGTRYMKWSNacgtrymkwsn/TGCAYRKMWSNtgcayrkmwsn/; + } else { + $s->[9] = $t[2]; $s->[10] = $t[3]; + } + # cigar + my $cigarstring =""; + if (scalar @variations ==0 ) { + $s->[5] = $len . "M"; # IMPORTANT: this cigar is not correct for gapped alignment + } else { + #convert to correct CIGAR + my $tmpstr = join" ",@variations ; + if ( $tmpstr=~ /\+|\-/ ) { + $cigarstring = cigar_method($line,\@variations,$len); + $s->[5]=$cigarstring; + } else { + $s->[5]=$len. "M"; + } +} + +# coor + $s->[2] = substr($t[7], 1); $s->[3] = $t[8]; + $s->[1] |= 0x10 if ($t[9] eq 'R'); + # mapQ + $s->[4] = $t[5] > $t[6]? $t[5] : $t[6]; + # mate coordinate + $s->[6] = '*'; $s->[7] = $s->[8] = 0; + # aux + push(@$s, "NM:i:".(@t-13)); + my $md = ''; + $md = mdtag($md,$line,\@variations,$len); + push(@$s, "MD:Z:$md"); + +} + +sub mdtag { + my $oldmd = shift; + my $line = shift; + my $ref =shift; + my $rdlen = shift; + my @variations = @$ref; + my $string=""; + my $mdtag=""; + my $t=1; + my $q=1; + my $deleteflag=0; + my $len =0; + foreach $string (@variations) { + my ($indeltype,$insert) = indeltype($string); + if ($indeltype eq "+") { + $len = length ($insert); + $q+=$len; + next; + } + my $pos = $1 if $string =~ /^(\d+)/; + $len = $pos - $t; + if ($len !=0 || ($deleteflag eq 1 && $indeltype eq ">")) { + $mdtag.=$len; + } + $t+=$len; + $q+=$len; + if ($indeltype eq ">") { + $mdtag.=$insert; + $deleteflag=0; + $t+=1; + $q+=1; + } + if ($indeltype eq "-") { + my $deletedbase = $2 if $string =~ /(\d+)\-([A-Z]+)/; + if ($deleteflag == 0 ) { + $mdtag.="^"; + } + $mdtag.=$deletedbase; + $deleteflag=1; + $t+=1; + } + } + $len = $rdlen - $q + 1; + if ($len > 0) { + $mdtag.="$len"; + } +# print "In:$line\n"; +# print "MD: OLD => NEW\nMD: $oldmd => $mdtag\n\n"; + + return $mdtag; +} + +sub indeltype { + my $string = shift; + my $insert=""; + my $indeltype; + if ($string =~ /([A-Z]+)\>/) { + $indeltype=">"; + $insert=$1; + } elsif ($string =~ /\-/) { + $indeltype="-"; + } elsif ($string =~ /\+([A-Z]+)/) { + $indeltype="+"; + $insert=$1; + } + return ($indeltype,$insert); + +} + + +sub cigar_method { + my $line = shift; + my $ref =shift; + my $rdlen = shift; + my @variations = @$ref; + my $string=""; + my $type=""; + my $t =1; + my $q=1; + my $indeltype=""; + my $cigar= ""; + my $insert = ""; + my $len=0; + my @cig=(); + foreach $string (@variations) { + next if $string =~ />/; + my $pos = $1 if $string =~ /^(\d+)/; + + if ($string =~ /\+([A-Z]+)/) { + $indeltype="+"; + $insert = $1; + }elsif ($string =~ /\-([A-Z]+)/) { + $indeltype="-"; + $insert = $1; + } +#print "$pos $indeltype $insert $t $q\n"; + $len = $pos - $t; + if ( $len > 0) { + $cigar.=$len."M"; + push(@cig,$len."M"); + } + $t+=$len; + $q+=$len; + + if ($indeltype eq "-") { + $cigar.="D"; + push(@cig,"D"); + $t++; + } + if ($indeltype eq "+") { + $len = length ($insert); + if ($len == 1) { + $cigar.="I"; + push(@cig,"I"); + } + if ($len > 1) { + $cigar.=$len."I"; + push(@cig,$len."I") + } + $q+=$len; + } + $insert=""; + } + $len= $rdlen - $q + 1; + if ($len > 0) { + $cigar.=$len."M"; + push(@cig,$len."M"); + } + + $cigar = newcigar($cigar,'D'); + $cigar = newcigar($cigar,'I'); + + #print "$line\n"; + #print "c CIGAR:\t$cigar\n\n"; + return $cigar; + +} + + + +sub newcigar { + my $cigar = shift; + my $char = shift; + my $new = ""; + my $copy = $cigar; +#print "$cigar\n"; + $copy =~ s/^($char+)/$1;/g; +#print "$copy\n"; + $copy =~ s/([^0-9$char])($char+)/$1;$2;/g; +#print "$copy\n"; + my @parts = split(/;/,$copy); + my $el=""; + foreach $el (@parts) { +#print "$el\n"; + if ($el =~ /^$char+$/) { + $new.=length($el).$char; + }else { + $new.=$el; + } + + } + return $new; +}
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/SNV/SNVMix2_source/SNVMix2-v0.12.1-rc1/samtools-0.1.6/misc/psl2sam.pl Wed Oct 12 19:50:38 2011 -0400 @@ -0,0 +1,65 @@ +#!/usr/bin/perl -w + +# Author: lh3 + +# This script calculates a score using the BLAST scoring +# system. However, I am not sure how to count gap opens and gap +# extensions. It seems to me that column 5-8 are not what I am +# after. This script counts gaps from the last three columns. It does +# not generate reference skip (N) in the CIGAR as it is not easy to +# directly tell which gaps correspond to introns. + +use strict; +use warnings; +use Getopt::Std; + +my %opts = (a=>1, b=>3, q=>5, r=>2); +getopts('a:b:q:r:', \%opts); +die("Usage: psl2sam.pl [-a $opts{a}] [-b $opts{b}] [-q $opts{q}] [-r $opts{r}] <in.psl>\n") if (@ARGV == 0 && -t STDIN); + +my @stack; +my $last = ''; +my ($a, $b, $q, $r) = ($opts{a}, $opts{b}, $opts{q}, $opts{r}); +while (<>) { + next unless (/^\d/); + my @t = split; + my @s; + my $cigar = ''; + if ($t[8] eq '-') { + my $tmp = $t[11]; + $t[11] = $t[10] - $t[12]; + $t[12] = $t[10] - $tmp; + } + @s[0..4] = ($t[9], (($t[8] eq '+')? 0 : 16), $t[13], $t[15]+1, 0); + @s[6..10] = ('*', 0, 0, '*', '*'); + $cigar .= $t[11].'H' if ($t[11]); # 5'-end clipping + my @x = split(',', $t[18]); + my @y = split(',', $t[19]); + my @z = split(',', $t[20]); + my ($y0, $z0) = ($y[0], $z[0]); + my ($gap_open, $gap_ext) = (0, 0, 0); + for (1 .. $t[17]-1) { + my $ly = $y[$_] - $y[$_-1] - $x[$_-1]; + my $lz = $z[$_] - $z[$_-1] - $x[$_-1]; + if ($ly < $lz) { # del: the reference gap is longer + ++$gap_open; + $gap_ext += $lz - $ly; + $cigar .= ($y[$_] - $y0) . 'M'; + $cigar .= ($lz - $ly) . 'D'; + ($y0, $z0) = ($y[$_], $z[$_]); + } elsif ($lz < $ly) { # ins: the query gap is longer + ++$gap_open; + $gap_ext += $ly - $lz; + $cigar .= ($z[$_] - $z0) . 'M'; + $cigar .= ($ly - $lz) . 'I'; + ($y0, $z0) = ($y[$_], $z[$_]); + } + } + $cigar .= ($t[12] - $y0) . 'M'; + $cigar .= ($t[10] - $t[12]).'H' if ($t[10] != $t[12]); # 3'-end clipping + $s[5] = $cigar; + my $score = $a * $t[0] - $b * $t[1] - $q * $gap_open - $r * $gap_ext; + $score = 0 if ($score < 0); + $s[11] = "AS:i:$score"; + print join("\t", @s), "\n"; +}
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/SNV/SNVMix2_source/SNVMix2-v0.12.1-rc1/samtools-0.1.6/misc/samtools.pl Wed Oct 12 19:50:38 2011 -0400 @@ -0,0 +1,358 @@ +#!/usr/bin/perl -w + +# Author: lh3 + +use strict; +use warnings; +use Getopt::Std; + +my $version = '0.3.3'; +&usage if (@ARGV < 1); + +my $command = shift(@ARGV); +my %func = (showALEN=>\&showALEN, pileup2fq=>\&pileup2fq, varFilter=>\&varFilter, + unique=>\&unique, uniqcmp=>\&uniqcmp); + +die("Unknown command \"$command\".\n") if (!defined($func{$command})); +&{$func{$command}}; +exit(0); + +# +# showALEN +# + +sub showALEN { + die(qq/Usage: samtools.pl showALEN <in.sam>\n/) if (@ARGV == 0 && -t STDIN); + while (<>) { + my @t = split; + next if (/^\@/ || @t < 11); + my $l = 0; + $_ = $t[5]; + s/(\d+)[MI]/$l+=$1/eg; + print join("\t", @t[0..5]), "\t$l\t", join("\t", @t[6..$#t]), "\n"; + } +} + +# +# varFilter +# + +sub varFilter { + my %opts = (d=>3, D=>100, l=>30, Q=>25, q=>10, G=>25, s=>100, w=>10, W=>10, N=>2, p=>undef); + getopts('pq:d:D:l:Q:w:W:N:G:', \%opts); + die(qq/ +Usage: samtools.pl varFilter [options] <in.cns-pileup> + +Options: -Q INT minimum RMS mapping quality for SNPs [$opts{Q}] + -q INT minimum RMS mapping quality for gaps [$opts{q}] + -d INT minimum read depth [$opts{d}] + -D INT maximum read depth [$opts{D}] + + -G INT min indel score for nearby SNP filtering [$opts{G}] + -w INT SNP within INT bp around a gap to be filtered [$opts{w}] + + -W INT window size for filtering dense SNPs [$opts{W}] + -N INT max number of SNPs in a window [$opts{N}] + + -l INT window size for filtering adjacent gaps [$opts{l}] + + -p print filtered variants +\n/) if (@ARGV == 0 && -t STDIN); + + # calculate the window size + my ($ol, $ow, $oW) = ($opts{l}, $opts{w}, $opts{W}); + my $max_dist = $ol > $ow? $ol : $ow; + $max_dist = $oW if ($max_dist < $oW); + # the core loop + my @staging; # (indel_filtering_score, flt_tag) + while (<>) { + my @t = split; + next if (uc($t[2]) eq uc($t[3]) || $t[3] eq '*/*'); # skip non-var sites + # clear the out-of-range elements + while (@staging) { + last if ($staging[0][2] eq $t[0] && $staging[0][3] + $max_dist >= $t[1]); + varFilter_aux(shift(@staging), $opts{p}); # calling a function is a bit slower, not much + } + my ($flt, $score) = (0, -1); + # first a simple filter + if ($t[7] < $opts{d}) { + $flt = 2; + } elsif ($t[7] > $opts{D}) { + $flt = 3; + } + # site dependent filters + if ($flt == 0) { + if ($t[2] eq '*') { # an indel + $flt = 1 if ($t[6] < $opts{q}); + # filtering SNPs + if ($t[5] >= $opts{G}) { + for my $x (@staging) { + next if ($x->[0] >= 0 || $x->[3] + $ow < $t[1]); + $x->[1] = 5 if ($x->[1] == 0); + } + } + # calculate the filtering score (different from indel quality) + $score = $t[5]; + $score += $opts{s} * $t[10] if ($t[8] ne '*'); + $score += $opts{s} * $t[11] if ($t[9] ne '*'); + # check the staging list for indel filtering + for my $x (@staging) { + next if ($x->[0] < 0 || $x->[3] + $ol < $t[1]); + if ($x->[0] < $score) { + $x->[1] = 6; + } else { + $flt = 6; last; + } + } + } else { # a SNP + $flt = 1 if ($t[6] < $opts{Q}); + # check adjacent SNPs + my $k = 1; + for my $x (@staging) { + ++$k if ($x->[0] < 0 && $x->[3] + $oW >= $t[1] && ($x->[1] == 0 || $x->[1] == 4 || $x->[1] == 5)); + } + # filtering is necessary + if ($k > $opts{N}) { + $flt = 4; + for my $x (@staging) { + $x->[1] = 4 if ($x->[0] < 0 && $x->[3] + $oW >= $t[1] && $x->[1] == 0); + } + } else { # then check gap filter + for my $x (@staging) { + next if ($x->[0] < 0 || $x->[3] + $ow < $t[1]); + if ($x->[0] >= $opts{G}) { + $flt = 5; last; + } + } + } + } + } + push(@staging, [$score, $flt, @t]); + } + # output the last few elements in the staging list + while (@staging) { + varFilter_aux(shift @staging, $opts{p}); + } +} + +sub varFilter_aux { + my ($first, $is_print) = @_; + if ($first->[1] == 0) { + print join("\t", @$first[2 .. @$first-1]), "\n"; + } elsif ($is_print) { + print STDERR join("\t", substr("UQdDWGgX", $first->[1], 1), @$first[2 .. @$first-1]), "\n"; + } +} + +# +# pileup2fq +# + +sub pileup2fq { + my %opts = (d=>3, D=>255, Q=>25, G=>25, l=>10); + getopts('d:D:Q:G:l:', \%opts); + die(qq/ +Usage: samtools.pl pileup2fq [options] <in.cns-pileup> + +Options: -d INT minimum depth [$opts{d}] + -D INT maximum depth [$opts{D}] + -Q INT min RMS mapQ [$opts{Q}] + -G INT minimum indel score [$opts{G}] + -l INT indel filter winsize [$opts{l}]\n +/) if (@ARGV == 0 && -t STDIN); + + my ($last_chr, $seq, $qual, @gaps, $last_pos); + my $_Q = $opts{Q}; + my $_d = $opts{d}; + my $_D = $opts{D}; + + $last_chr = ''; + while (<>) { + my @t = split; + if ($last_chr ne $t[0]) { + &p2q_post_process($last_chr, \$seq, \$qual, \@gaps, $opts{l}) if ($last_chr); + $last_chr = $t[0]; + $last_pos = 0; + $seq = ''; $qual = ''; + @gaps = (); + } + if ($t[1] - $last_pos != 1) { + $seq .= 'n' x ($t[1] - $last_pos - 1); + $qual .= '!' x ($t[1] - $last_pos - 1); + } + if ($t[2] eq '*') { + push(@gaps, $t[1]) if ($t[5] >= $opts{G}); + } else { + $seq .= ($t[6] >= $_Q && $t[7] >= $_d && $t[7] <= $_D)? uc($t[3]) : lc($t[3]); + my $q = $t[4] + 33; + $q = 126 if ($q > 126); + $qual .= chr($q); + } + $last_pos = $t[1]; + } + &p2q_post_process($last_chr, \$seq, \$qual, \@gaps, $opts{l}); +} + +sub p2q_post_process { + my ($chr, $seq, $qual, $gaps, $l) = @_; + &p2q_filter_gaps($seq, $gaps, $l); + print "\@$chr\n"; &p2q_print_str($seq); + print "+\n"; &p2q_print_str($qual); +} + +sub p2q_filter_gaps { + my ($seq, $gaps, $l) = @_; + for my $g (@$gaps) { + my $x = $g > $l? $g - $l : 0; + substr($$seq, $x, $l + $l) = lc(substr($$seq, $x, $l + $l)); + } +} + +sub p2q_print_str { + my ($s) = @_; + my $l = length($$s); + for (my $i = 0; $i < $l; $i += 60) { + print substr($$s, $i, 60), "\n"; + } +} + +# +# unique +# + +sub unique { + my %opts = (f=>250.0, q=>5, r=>2, a=>1, b=>3); + getopts('Qf:q:r:a:b:', \%opts); + die("Usage: samtools.pl unique [-f $opts{f}] <in.sam>\n") if (@ARGV == 0 && -t STDIN); + my $last = ''; + my $recal_Q = !defined($opts{Q}); + my @a; + while (<>) { + my $score = -1; + print $_ if (/^\@/); + $score = $1 if (/AS:i:(\d+)/); + my @t = split("\t"); + next if (@t < 11); + if ($score < 0) { # AS tag is unavailable + my $cigar = $t[5]; + my ($mm, $go, $ge) = (0, 0, 0); + $cigar =~ s/(\d+)[ID]/++$go,$ge+=$1/eg; + $cigar = $t[5]; + $cigar =~ s/(\d+)M/$mm+=$1/eg; + $score = $mm * $opts{a} - $go * $opts{q} - $ge * $opts{r}; # no mismatches... + } + $score = 1 if ($score < 1); + if ($t[0] ne $last) { + &unique_aux(\@a, $opts{f}, $recal_Q) if (@a); + $last = $t[0]; + } + push(@a, [$score, \@t]); + } + &unique_aux(\@a, $opts{f}, $recal_Q) if (@a); +} + +sub unique_aux { + my ($a, $fac, $is_recal) = @_; + my ($max, $max2, $max_i) = (0, 0, -1); + for (my $i = 0; $i < @$a; ++$i) { + if ($a->[$i][0] > $max) { + $max2 = $max; $max = $a->[$i][0]; $max_i = $i; + } elsif ($a->[$i][0] > $max2) { + $max2 = $a->[$i][0]; + } + } + if ($is_recal) { + my $q = int($fac * ($max - $max2) / $max + .499); + $q = 250 if ($q > 250); + $a->[$max_i][1][4] = $q < 250? $q : 250; + } + print join("\t", @{$a->[$max_i][1]}); + @$a = (); +} + +# +# uniqcmp: compare two SAM files +# + +sub uniqcmp { + my %opts = (q=>10, s=>100); + getopts('pq:s:', \%opts); + die("Usage: samtools.pl uniqcmp <in1.sam> <in2.sam>\n") if (@ARGV < 2); + my ($fh, %a); + warn("[uniqcmp] read the first file...\n"); + &uniqcmp_aux($ARGV[0], \%a, 0); + warn("[uniqcmp] read the second file...\n"); + &uniqcmp_aux($ARGV[1], \%a, 1); + warn("[uniqcmp] stats...\n"); + my @cnt; + $cnt[$_] = 0 for (0..9); + for my $x (keys %a) { + my $p = $a{$x}; + my $z; + if (defined($p->[0]) && defined($p->[1])) { + $z = ($p->[0][0] == $p->[1][0] && $p->[0][1] eq $p->[1][1] && abs($p->[0][2] - $p->[1][2]) < $opts{s})? 0 : 1; + if ($p->[0][3] >= $opts{q} && $p->[1][3] >= $opts{q}) { + ++$cnt[$z*3+0]; + } elsif ($p->[0][3] >= $opts{q}) { + ++$cnt[$z*3+1]; + } elsif ($p->[1][3] >= $opts{q}) { + ++$cnt[$z*3+2]; + } + print STDERR "$x\t$p->[0][1]:$p->[0][2]\t$p->[0][3]\t$p->[0][4]\t$p->[1][1]:$p->[1][2]\t$p->[1][3]\t$p->[1][4]\t", + $p->[0][5]-$p->[1][5], "\n" if ($z && defined($opts{p}) && ($p->[0][3] >= $opts{q} || $p->[1][3] >= $opts{q})); + } elsif (defined($p->[0])) { + ++$cnt[$p->[0][3]>=$opts{q}? 6 : 7]; + print STDERR "$x\t$p->[0][1]:$p->[0][2]\t$p->[0][3]\t$p->[0][4]\t*\t0\t*\t", + $p->[0][5], "\n" if (defined($opts{p}) && $p->[0][3] >= $opts{q}); + } else { + print STDERR "$x\t*\t0\t*\t$p->[1][1]:$p->[1][2]\t$p->[1][3]\t$p->[1][4]\t", + -$p->[1][5], "\n" if (defined($opts{p}) && $p->[1][3] >= $opts{q}); + ++$cnt[$p->[1][3]>=$opts{q}? 8 : 9]; + } + } + print "Consistent (high, high): $cnt[0]\n"; + print "Consistent (high, low ): $cnt[1]\n"; + print "Consistent (low , high): $cnt[2]\n"; + print "Inconsistent (high, high): $cnt[3]\n"; + print "Inconsistent (high, low ): $cnt[4]\n"; + print "Inconsistent (low , high): $cnt[5]\n"; + print "Second missing (high): $cnt[6]\n"; + print "Second missing (low ): $cnt[7]\n"; + print "First missing (high): $cnt[8]\n"; + print "First missing (low ): $cnt[9]\n"; +} + +sub uniqcmp_aux { + my ($fn, $a, $which) = @_; + my $fh; + $fn = "samtools view $fn |" if ($fn =~ /\.bam/); + open($fh, $fn) || die; + while (<$fh>) { + my @t = split; + next if (@t < 11); +# my $l = ($t[5] =~ /^(\d+)S/)? $1 : 0; + my $l = 0; + my ($x, $nm) = (0, 0); + $nm = $1 if (/NM:i:(\d+)/); + $_ = $t[5]; + s/(\d+)[MI]/$x+=$1/eg; + @{$a->{$t[0]}[$which]} = (($t[1]&0x10)? 1 : 0, $t[2], $t[3]-$l, $t[4], "$x:$nm", $x - 4 * $nm); + } + close($fh); +} + +# +# Usage +# + +sub usage { + die(qq/ +Program: samtools.pl (helper script for SAMtools) +Version: $version +Contact: Heng Li <lh3\@sanger.ac.uk>\n +Usage: samtools.pl <command> [<arguments>]\n +Command: varFilter filtering SNPs and short indels + pileup2fq generate fastq from `pileup -c' + showALEN print alignment length (ALEN) following CIGAR +\n/); +}
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/SNV/SNVMix2_source/SNVMix2-v0.12.1-rc1/samtools-0.1.6/misc/soap2sam.pl Wed Oct 12 19:50:38 2011 -0400 @@ -0,0 +1,109 @@ +#!/usr/bin/perl -w + +# Contact: lh3 +# Version: 0.1.1 + +use strict; +use warnings; +use Getopt::Std; + +&soap2sam; +exit; + +sub mating { + my ($s1, $s2) = @_; + my $isize = 0; + if ($s1->[2] ne '*' && $s1->[2] eq $s2->[2]) { # then calculate $isize + my $x1 = ($s1->[1] & 0x10)? $s1->[3] + length($s1->[9]) : $s1->[3]; + my $x2 = ($s2->[1] & 0x10)? $s2->[3] + length($s2->[9]) : $s2->[3]; + $isize = $x2 - $x1; + } + # update mate coordinate + if ($s2->[2] ne '*') { + @$s1[6..8] = (($s2->[2] eq $s1->[2])? "=" : $s2->[2], $s2->[3], $isize); + $s1->[1] |= 0x20 if ($s2->[1] & 0x10); + } else { + $s1->[1] |= 0x8; + } + if ($s1->[2] ne '*') { + @$s2[6..8] = (($s1->[2] eq $s2->[2])? "=" : $s1->[2], $s1->[3], -$isize); + $s2->[1] |= 0x20 if ($s1->[1] & 0x10); + } else { + $s2->[1] |= 0x8; + } +} + +sub soap2sam { + my %opts = (); + getopts("p", \%opts); + die("Usage: soap2sam.pl [-p] <aln.soap>\n") if (@ARGV == 0 && -t STDIN); + my $is_paired = defined($opts{p}); + # core loop + my @s1 = (); + my @s2 = (); + my ($s_last, $s_curr) = (\@s1, \@s2); + while (<>) { + s/[\177-\377]|[\000-\010]|[\012-\040]//g; + next if (&soap2sam_aux($_, $s_curr, $is_paired) < 0); + if (@$s_last != 0 && $s_last->[0] eq $s_curr->[0]) { + &mating($s_last, $s_curr); + print join("\t", @$s_last), "\n"; + print join("\t", @$s_curr), "\n"; + @$s_last = (); @$s_curr = (); + } else { + print join("\t", @$s_last), "\n" if (@$s_last != 0); + my $s = $s_last; $s_last = $s_curr; $s_curr = $s; + } + } + print join("\t", @$s_last), "\n" if (@$s_last != 0); +} + +sub soap2sam_aux { + my ($line, $s, $is_paired) = @_; + chomp($line); + my @t = split(/\s+/, $line); + return -1 if (@t < 9 || $line =~ /^\s/ || !$t[0]); + @$s = (); + # fix SOAP-2.1.x bugs + @t = @t[0..2,4..$#t] unless ($t[3] =~ /^\d+$/); + # read name + $s->[0] = $t[0]; + $s->[0] =~ s/\/[12]$//g; + # initial flag (will be updated later) + $s->[1] = 0; + $s->[1] |= 1 | 1<<($t[4] eq 'a'? 6 : 7); + $s->[1] |= 2 if ($is_paired); + # read & quality + $s->[9] = $t[1]; + $s->[10] = (length($t[2]) > length($t[1]))? substr($t[2], 0, length($t[1])) : $t[2]; + # cigar + $s->[5] = length($s->[9]) . "M"; + # coor + $s->[2] = $t[7]; $s->[3] = $t[8]; + $s->[1] |= 0x10 if ($t[6] eq '-'); + # mapQ + $s->[4] = $t[3] == 1? 30 : 0; + # mate coordinate + $s->[6] = '*'; $s->[7] = $s->[8] = 0; + # aux + push(@$s, "NM:i:$t[9]"); + my $md = ''; + if ($t[9]) { + my @x; + for (10 .. $#t) { + push(@x, sprintf("%.3d,$1", $2)) if ($t[$_] =~ /^([ACGT])->(\d+)/i); + } + @x = sort(@x); + my $a = 0; + for (@x) { + my ($y, $z) = split(","); + $md .= (int($y)-$a) . $z; + $a += $y - $a + 1; + } + $md .= length($t[1]) - $a; + } else { + $md = length($t[1]); + } + push(@$s, "MD:Z:$md"); + return 0; +}
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/SNV/SNVMix2_source/SNVMix2-v0.12.1-rc1/samtools-0.1.6/misc/wgsim.c Wed Oct 12 19:50:38 2011 -0400 @@ -0,0 +1,502 @@ +/* The MIT License + + Copyright (c) 2008 Genome Research Ltd (GRL). + + Permission is hereby granted, free of charge, to any person obtaining + a copy of this software and associated documentation files (the + "Software"), to deal in the Software without restriction, including + without limitation the rights to use, copy, modify, merge, publish, + distribute, sublicense, and/or sell copies of the Software, and to + permit persons to whom the Software is furnished to do so, subject to + the following conditions: + + The above copyright notice and this permission notice shall be + included in all copies or substantial portions of the Software. + + THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, + EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF + MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND + NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS + BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN + ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN + CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE + SOFTWARE. +*/ + +/* Contact: Heng Li <lh3@sanger.ac.uk> */ + +/* This program is separated from maq's read simulator with Colin + * Hercus' modification to allow longer indels. Colin is the chief + * developer of novoalign. */ + +#include <stdlib.h> +#include <math.h> +#include <time.h> +#include <assert.h> +#include <stdio.h> +#include <unistd.h> +#include <stdint.h> +#include <ctype.h> +#include <string.h> + +#define PACKAGE_VERSION "0.2.3" + +const uint8_t nst_nt4_table[256] = { + 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, + 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, + 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 5 /*'-'*/, 4, 4, + 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, + 4, 0, 4, 1, 4, 4, 4, 2, 4, 4, 4, 4, 4, 4, 4, 4, + 4, 4, 4, 4, 3, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, + 4, 0, 4, 1, 4, 4, 4, 2, 4, 4, 4, 4, 4, 4, 4, 4, + 4, 4, 4, 4, 3, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, + 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, + 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, + 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, + 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, + 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, + 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, + 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, + 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4 +}; + +const int nst_color_space_table[] = { 4, 0, 0, 1, 0, 2, 3, 4, 0, 3, 2, 4, 1, 4, 4, 4}; + +/* Simple normal random number generator, copied from genran.c */ + +double ran_normal() +{ + static int iset = 0; + static double gset; + double fac, rsq, v1, v2; + if (iset == 0) { + do { + v1 = 2.0 * drand48() - 1.0; + v2 = 2.0 * drand48() - 1.0; + rsq = v1 * v1 + v2 * v2; + } while (rsq >= 1.0 || rsq == 0.0); + fac = sqrt(-2.0 * log(rsq) / rsq); + gset = v1 * fac; + iset = 1; + return v2 * fac; + } else { + iset = 0; + return gset; + } +} + +/* FASTA parser, copied from seq.c */ + +typedef struct { + int l, m; /* length and maximum buffer size */ + unsigned char *s; /* sequence */ +} seq_t; + +#define INIT_SEQ(seq) (seq).s = 0; (seq).l = (seq).m = 0 + +static int SEQ_BLOCK_SIZE = 512; + +void seq_set_block_size(int size) +{ + SEQ_BLOCK_SIZE = size; +} + +int seq_read_fasta(FILE *fp, seq_t *seq, char *locus, char *comment) +{ + int c, l, max; + char *p; + + c = 0; + while (!feof(fp) && fgetc(fp) != '>'); + if (feof(fp)) return -1; + p = locus; + while (!feof(fp) && (c = fgetc(fp)) != ' ' && c != '\t' && c != '\n') + if (c != '\r') *p++ = c; + *p = '\0'; + if (comment) { + p = comment; + if (c != '\n') { + while (!feof(fp) && ((c = fgetc(fp)) == ' ' || c == '\t')); + if (c != '\n') { + *p++ = c; + while (!feof(fp) && (c = fgetc(fp)) != '\n') + if (c != '\r') *p++ = c; + } + } + *p = '\0'; + } else if (c != '\n') while (!feof(fp) && fgetc(fp) != '\n'); + l = 0; max = seq->m; + while (!feof(fp) && (c = fgetc(fp)) != '>') { + if (isalpha(c) || c == '-' || c == '.') { + if (l + 1 >= max) { + max += SEQ_BLOCK_SIZE; + seq->s = (unsigned char*)realloc(seq->s, sizeof(char) * max); + } + seq->s[l++] = (unsigned char)c; + } + } + if (c == '>') ungetc(c,fp); + seq->s[l] = 0; + seq->m = max; seq->l = l; + return l; +} + +/* Error-checking open, copied from utils.c */ + +#define xopen(fn, mode) err_xopen_core(__func__, fn, mode) + +FILE *err_xopen_core(const char *func, const char *fn, const char *mode) +{ + FILE *fp = 0; + if (strcmp(fn, "-") == 0) + return (strstr(mode, "r"))? stdin : stdout; + if ((fp = fopen(fn, mode)) == 0) { + fprintf(stderr, "[%s] fail to open file '%s'. Abort!\n", func, fn); + abort(); + } + return fp; +} + +/* wgsim */ + +enum muttype_t {NOCHANGE = 0, INSERT = 0x1000, SUBSTITUTE = 0xe000, DELETE = 0xf000}; +typedef unsigned short mut_t; +static mut_t mutmsk = (mut_t)0xf000; + +typedef struct { + int l, m; /* length and maximum buffer size */ + mut_t *s; /* sequence */ +} mutseq_t; + +static double ERR_RATE = 0.02; +static double MUT_RATE = 0.001; +static double INDEL_FRAC = 0.1; +static double INDEL_EXTEND = 0.3; +static int IS_SOLID = 0; +static int SHOW_MM_INFO = 1; + +void maq_mut_diref(const seq_t *seq, int is_hap, mutseq_t *hap1, mutseq_t *hap2) +{ + int i, deleting = 0; + mutseq_t *ret[2]; + + ret[0] = hap1; ret[1] = hap2; + ret[0]->l = seq->l; ret[1]->l = seq->l; + ret[0]->m = seq->m; ret[1]->m = seq->m; + ret[0]->s = (mut_t *)calloc(seq->m, sizeof(mut_t)); + ret[1]->s = (mut_t *)calloc(seq->m, sizeof(mut_t)); + for (i = 0; i != seq->l; ++i) { + int c; + c = ret[0]->s[i] = ret[1]->s[i] = (mut_t)nst_nt4_table[(int)seq->s[i]]; + if (deleting) { + if (drand48() < INDEL_EXTEND) { + if (deleting & 1) ret[0]->s[i] |= DELETE; + if (deleting & 2) ret[1]->s[i] |= DELETE; + continue; + } else deleting = 0; + } + if (c < 4 && drand48() < MUT_RATE) { // mutation + if (drand48() >= INDEL_FRAC) { // substitution + double r = drand48(); + c = (c + (int)(r * 3.0 + 1)) & 3; + if (is_hap || drand48() < 0.333333) { // hom + ret[0]->s[i] = ret[1]->s[i] = SUBSTITUTE|c; + } else { // het + ret[drand48()<0.5?0:1]->s[i] = SUBSTITUTE|c; + } + } else { // indel + if (drand48() < 0.5) { // deletion + if (is_hap || drand48() < 0.333333) { // hom-del + ret[0]->s[i] = ret[1]->s[i] = DELETE; + deleting = 3; + } else { // het-del + deleting = drand48()<0.5?1:2; + ret[deleting-1]->s[i] = DELETE; + } + } else { // insertion + int num_ins = 0, ins = 0; + do { + num_ins++; + ins = (ins << 2) | (int)(drand48() * 4.0); + } while (num_ins < 4 && drand48() < INDEL_EXTEND); + + if (is_hap || drand48() < 0.333333) { // hom-ins + ret[0]->s[i] = ret[1]->s[i] = (num_ins << 12) | (ins << 4) | c; + } else { // het-ins + ret[drand48()<0.5?0:1]->s[i] = (num_ins << 12) | (ins << 4) | c; + } + } + } + } + } +} +void maq_print_mutref(const char *name, const seq_t *seq, mutseq_t *hap1, mutseq_t *hap2) +{ + int i; + for (i = 0; i != seq->l; ++i) { + int c[3]; + c[0] = nst_nt4_table[(int)seq->s[i]]; + c[1] = hap1->s[i]; c[2] = hap2->s[i]; + if (c[0] >= 4) continue; + if ((c[1] & mutmsk) != NOCHANGE || (c[1] & mutmsk) != NOCHANGE) { + printf("%s\t%d\t", name, i+1); + if (c[1] == c[2]) { // hom + if ((c[1]&mutmsk) == SUBSTITUTE) { // substitution + printf("%c\t%c\t-\n", "ACGTN"[c[0]], "ACGTN"[c[1]&0xf]); + } else if ((c[1]&mutmsk) == DELETE) { // del + printf("%c\t-\t-\n", "ACGTN"[c[0]]); + } else if (((c[1] & mutmsk) >> 12) <= 5) { // ins + printf("-\t"); + int n = (c[1]&mutmsk) >> 12, ins = c[1] >> 4; + while(n > 0) { + putchar("ACGTN"[ins & 0x3]); + n--; + } + printf("\t-\n"); + } else assert(0); + } else { // het + if ((c[1]&mutmsk) == SUBSTITUTE || (c[2]&mutmsk) == SUBSTITUTE) { // substitution + printf("%c\t%c\t+\n", "ACGTN"[c[0]], "XACMGRSVTWYHKDBN"[1<<(c[1]&0x3)|1<<(c[2]&0x3)]); + } else if ((c[1]&mutmsk) == DELETE) { + printf("%c\t-\t+\n", "ACGTN"[c[0]]); + } else if ((c[2]&mutmsk) == DELETE) { + printf("%c\t-\t+\n", "ACGTN"[c[0]]); + } else if (((c[1] & mutmsk) >> 12) <= 4) { // ins1 + printf("-\t"); + int n = (c[1]&mutmsk) >> 12, ins = c[1] >> 4; + while (n > 0) { + putchar("ACGTN"[ins & 0x3]); + n--; + } + printf("\t+\n"); + } else if (((c[2] & mutmsk) >> 12) <= 5) { // ins2 + printf("-\t"); + int n = (c[2]&mutmsk) >> 12, ins = c[2] >> 4; + while (n > 0) { + putchar("ACGTN"[ins & 0x3]); + ins >>= 2; + n--; + } + printf("\t+\n"); + } else assert(0); + } + } + } +} + +void wgsim_core(FILE *fpout1, FILE *fpout2, FILE *fp_fa, int is_hap, uint64_t N, int dist, int std_dev, int size_l, int size_r) +{ + seq_t seq; + mutseq_t rseq[2]; + uint64_t tot_len, ii; + int i, l, n_ref; + char name[256], *qstr; + int size[2], Q; + uint8_t *tmp_seq[2]; + mut_t *target; + + INIT_SEQ(seq); + srand48(time(0)); + seq_set_block_size(0x1000000); + l = size_l > size_r? size_l : size_r; + qstr = (char*)calloc(l+1, 1); + tmp_seq[0] = (uint8_t*)calloc(l+2, 1); + tmp_seq[1] = (uint8_t*)calloc(l+2, 1); + size[0] = size_l; size[1] = size_r; + + Q = (int)(-10.0 * log(ERR_RATE) / log(10.0) + 0.499) + 33; + + tot_len = n_ref = 0; + while ((l = seq_read_fasta(fp_fa, &seq, name, 0)) >= 0) { + tot_len += l; + ++n_ref; + } + fprintf(stderr, "[wgsim_core] %d sequences, total length: %llu\n", n_ref, (long long)tot_len); + rewind(fp_fa); + + while ((l = seq_read_fasta(fp_fa, &seq, name, 0)) >= 0) { + uint64_t n_pairs = (uint64_t)((long double)l / tot_len * N + 0.5); + if (l < dist + 3 * std_dev) { + fprintf(stderr, "[wgsim_core] kkip sequence '%s' as it is shorter than %d!\n", name, dist + 3 * std_dev); + continue; + } + + // generate mutations and print them out + maq_mut_diref(&seq, is_hap, rseq, rseq+1); + maq_print_mutref(name, &seq, rseq, rseq+1); + + for (ii = 0; ii != n_pairs; ++ii) { // the core loop + double ran; + int d, pos, s[2], is_flip = 0; + int n_sub[2], n_indel[2], n_err[2], ext_coor[2], j, k; + FILE *fpo[2]; + + do { // avoid boundary failure + ran = ran_normal(); + ran = ran * std_dev + dist; + d = (int)(ran + 0.5); + pos = (int)((l - d + 1) * drand48()); + } while (pos < 0 || pos >= seq.l || pos + d - 1 >= seq.l); + + // flip or not + if (drand48() < 0.5) { + fpo[0] = fpout1; fpo[1] = fpout2; + s[0] = size[0]; s[1] = size[1]; + } else { + fpo[1] = fpout1; fpo[0] = fpout2; + s[1] = size[0]; s[0] = size[1]; + is_flip = 1; + } + + // generate the read sequences + target = rseq[drand48()<0.5?0:1].s; // haplotype from which the reads are generated + n_sub[0] = n_sub[1] = n_indel[0] = n_indel[1] = n_err[0] = n_err[1] = 0; + +#define __gen_read(x, start, iter) do { \ + for (i = (start), k = 0, ext_coor[x] = -10; i >= 0 && i < seq.l && k < s[x]; iter) { \ + int c = target[i], mut_type = c & mutmsk; \ + if (ext_coor[x] < 0) { \ + if (mut_type != NOCHANGE && mut_type != SUBSTITUTE) continue; \ + ext_coor[x] = i; \ + } \ + if (mut_type == DELETE) ++n_indel[x]; \ + else if (mut_type == NOCHANGE || mut_type == SUBSTITUTE) { \ + tmp_seq[x][k++] = c & 0xf; \ + if (mut_type == SUBSTITUTE) ++n_sub[x]; \ + } else { \ + int n, ins; \ + ++n_indel[x]; \ + tmp_seq[x][k++] = c & 0xf; \ + for (n = mut_type>>12, ins = c>>4; n > 0 && k < s[x]; --n, ins >>= 2) \ + tmp_seq[x][k++] = ins & 0x3; \ + } \ + } \ + if (k != s[x]) ext_coor[x] = -10; \ + } while (0) + + if (!IS_SOLID) { + __gen_read(0, pos, ++i); + __gen_read(1, pos + d - 1, --i); + for (k = 0; k < s[1]; ++k) tmp_seq[1][k] = tmp_seq[1][k] < 4? 3 - tmp_seq[1][k] : 4; // complement + } else { + int c1, c2, c; + ++s[0]; ++s[1]; // temporarily increase read length by 1 + if (is_flip) { // RR pair + __gen_read(0, pos + s[0], --i); + __gen_read(1, pos + d - 1, --i); + } else { // FF pair + __gen_read(0, pos, ++i); + __gen_read(1, pos + d - 1 - s[1], ++i); + ++ext_coor[0]; ++ext_coor[1]; + } + // change to color sequence: (0,1,2,3) -> (A,C,G,T) + for (j = 0; j < 2; ++j) { + c1 = tmp_seq[j][0]; + for (i = 1; i < s[j]; ++i) { + c2 = tmp_seq[j][i]; + c = (c1 >= 4 || c2 >= 4)? 4 : nst_color_space_table[(1<<c1)|(1<<c2)]; + tmp_seq[j][i-1] = c; + c1 = c2; + } + } + --s[0]; --s[1]; // change back + } + if (ext_coor[0] < 0 || ext_coor[1] < 0) { // fail to generate the read(s) + --ii; + continue; + } + + // generate sequencing errors + for (j = 0; j < 2; ++j) { + for (i = 0; i < s[j]; ++i) { + int c = tmp_seq[j][i]; + if (c >= 4) c = 4; // actually c should be never larger than 4 if everything is correct + else if (drand48() < ERR_RATE) { + c = (c + (int)(drand48() * 3.0 + 1)) & 3; + ++n_err[j]; + } + tmp_seq[j][i] = c; + } + } + + // print + for (j = 0; j < 2; ++j) { + for (i = 0; i < s[j]; ++i) qstr[i] = Q; + qstr[i] = 0; + if (SHOW_MM_INFO) { + fprintf(fpo[j], "@%s_%u_%u_%d:%d:%d_%d:%d:%d_%llx/%d\n", name, ext_coor[0]+1, ext_coor[1]+1, + n_err[0], n_sub[0], n_indel[0], n_err[1], n_sub[1], n_indel[1], + (long long)ii, j==0? is_flip+1 : 2-is_flip); + } else { + fprintf(fpo[j], "@%s_%u_%u_%llx/%d %d:%d:%d_%d:%d:%d\n", name, ext_coor[0]+1, ext_coor[1]+1, + (long long)ii, j==0? is_flip+1 : 2-is_flip, + n_err[0], n_sub[0], n_indel[0], n_err[1], n_sub[1], n_indel[1]); + } + for (i = 0; i < s[j]; ++i) + fputc("ACGTN"[(int)tmp_seq[j][i]], fpo[j]); + fprintf(fpo[j], "\n+\n%s\n", qstr); + } + } + free(rseq[0].s); free(rseq[1].s); + } + free(seq.s); free(qstr); + free(tmp_seq[0]); free(tmp_seq[1]); +} + +static int simu_usage() +{ + fprintf(stderr, "\n"); + fprintf(stderr, "Program: wgsim (short read simulator)\n"); + fprintf(stderr, "Version: %s\n", PACKAGE_VERSION); + fprintf(stderr, "Contact: Heng Li <lh3@sanger.ac.uk>\n\n"); + fprintf(stderr, "Usage: wgsim [options] <in.ref.fa> <out.read1.fq> <out.read2.fq>\n\n"); + fprintf(stderr, "Options: -e FLOAT base error rate [%.3f]\n", ERR_RATE); + fprintf(stderr, " -d INT outer distance between the two ends [500]\n"); + fprintf(stderr, " -s INT standard deviation [50]\n"); + fprintf(stderr, " -N INT number of read pairs [1000000]\n"); + fprintf(stderr, " -1 INT length of the first read [70]\n"); + fprintf(stderr, " -2 INT length of the second read [70]\n"); + fprintf(stderr, " -r FLOAT rate of mutations [%.4f]\n", MUT_RATE); + fprintf(stderr, " -R FLOAT fraction of indels [%.2f]\n", INDEL_FRAC); + fprintf(stderr, " -X FLOAT probability an indel is extended [%.2f]\n", INDEL_EXTEND); + fprintf(stderr, " -c generate reads in color space (SOLiD reads)\n"); + fprintf(stderr, " -C show mismatch info in comment rather than read name\n"); + fprintf(stderr, " -h haplotype mode\n"); + fprintf(stderr, "\n"); + fprintf(stderr, "Note: For SOLiD reads, the first read is F3 and the second is R3.\n\n"); + return 1; +} + +int main(int argc, char *argv[]) +{ + int64_t N; + int dist, std_dev, c, size_l, size_r, is_hap = 0; + FILE *fpout1, *fpout2, *fp_fa; + + N = 1000000; dist = 500; std_dev = 50; + size_l = size_r = 70; + while ((c = getopt(argc, argv, "e:d:s:N:1:2:r:R:hX:cC")) >= 0) { + switch (c) { + case 'd': dist = atoi(optarg); break; + case 's': std_dev = atoi(optarg); break; + case 'N': N = atoi(optarg); break; + case '1': size_l = atoi(optarg); break; + case '2': size_r = atoi(optarg); break; + case 'e': ERR_RATE = atof(optarg); break; + case 'r': MUT_RATE = atof(optarg); break; + case 'R': INDEL_FRAC = atof(optarg); break; + case 'X': INDEL_EXTEND = atof(optarg); break; + case 'c': IS_SOLID = 1; break; + case 'C': SHOW_MM_INFO = 0; break; + case 'h': is_hap = 1; break; + } + } + if (argc - optind < 3) return simu_usage(); + fp_fa = (strcmp(argv[optind+0], "-") == 0)? stdin : xopen(argv[optind+0], "r"); + fpout1 = xopen(argv[optind+1], "w"); + fpout2 = xopen(argv[optind+2], "w"); + wgsim_core(fpout1, fpout2, fp_fa, is_hap, N, dist, std_dev, size_l, size_r); + + fclose(fpout1); fclose(fpout2); fclose(fp_fa); + return 0; +}
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/SNV/SNVMix2_source/SNVMix2-v0.12.1-rc1/samtools-0.1.6/misc/wgsim_eval.pl Wed Oct 12 19:50:38 2011 -0400 @@ -0,0 +1,79 @@ +#!/usr/bin/perl -w + +# Contact: lh3 +# Version: 0.1.5 + +use strict; +use warnings; +use Getopt::Std; + +&wgsim_eval; +exit; + +sub wgsim_eval { + my %opts = (g=>5); + getopts('pcg:', \%opts); + die("Usage: wgsim_eval.pl [-pc] [-g $opts{g}] <in.sam>\n") if (@ARGV == 0 && -t STDIN); + my (@c0, @c1); + my ($max_q, $flag) = (0, 0); + my $gap = $opts{g}; + $flag |= 1 if (defined $opts{p}); + $flag |= 2 if (defined $opts{c}); + while (<>) { + next if (/^\@/); + my @t = split("\t"); + next if (@t < 11); + my $line = $_; + my ($q, $is_correct, $chr, $left, $rght) = (int($t[4]/10), 1, $t[2], $t[3], $t[3]); + $max_q = $q if ($q > $max_q); + # right coordinate + $_ = $t[5]; s/(\d+)[MDN]/$rght+=$1,'x'/eg; + --$rght; + # correct for soft clipping + my ($left0, $rght0) = ($left, $rght); + $left -= $1 if (/^(\d+)[SH]/); + $rght += $1 if (/(\d+)[SH]$/); + $left0 -= $1 if (/(\d+)[SH]$/); + $rght0 += $1 if (/^(\d+)[SH]/); + # skip unmapped reads + next if (($t[1]&0x4) || $chr eq '*'); + # parse read name and check + if ($t[0] =~ /^(\S+)_(\d+)_(\d+)_/) { + if ($1 ne $chr) { # different chr + $is_correct = 0; + } else { + if ($flag & 2) { + if (($t[1]&0x40) && !($t[1]&0x10)) { # F3, forward + $is_correct = 0 if (abs($2 - $left) > $gap && abs($2 - $left0) > $gap); + } elsif (($t[1]&0x40) && ($t[1]&0x10)) { # F3, reverse + $is_correct = 0 if (abs($3 - $rght) > $gap && abs($3 - $rght0) > $gap); + } elsif (($t[1]&0x80) && !($t[1]&0x10)) { # R3, forward + $is_correct = 0 if (abs($3 - $left) > $gap && abs($3 - $left0) > $gap); + } else { # R3, reverse + $is_correct = 0 if (abs($2 - $rght) > $gap && abs($3 - $rght0) > $gap); + } + } else { + if ($t[1] & 0x10) { # reverse + $is_correct = 0 if (abs($3 - $rght) > $gap && abs($3 - $rght0) > $gap); # in case of indels that are close to the end of a reads + } else { + $is_correct = 0 if (abs($2 - $left) > $gap && abs($2 - $left0) > $gap); + } + } + } + } else { + warn("[wgsim_eval] read '$t[0]' was not generated by wgsim?\n"); + next; + } + ++$c0[$q]; + ++$c1[$q] unless ($is_correct); + print STDERR $line if (($flag&1) && !$is_correct && $q > 0); + } + # print + my ($cc0, $cc1) = (0, 0); + for (my $i = $max_q; $i >= 0; --$i) { + $c0[$i] = 0 unless (defined $c0[$i]); + $c1[$i] = 0 unless (defined $c1[$i]); + $cc0 += $c0[$i]; $cc1 += $c1[$i]; + printf("%.2dx %12d / %-12d %12d %.3e\n", $i, $c1[$i], $c0[$i], $cc0, $cc1/$cc0); + } +}
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/SNV/SNVMix2_source/SNVMix2-v0.12.1-rc1/samtools-0.1.6/misc/zoom2sam.pl Wed Oct 12 19:50:38 2011 -0400 @@ -0,0 +1,97 @@ +#!/usr/bin/perl -w + +# Contact: lh3 +# Version: 0.1.0 + +use strict; +use warnings; +use Getopt::Std; + +&zoom2sam; +exit; + +sub mating { + my ($s1, $s2) = @_; + my $isize = 0; + if ($s1->[2] ne '*' && $s1->[2] eq $s2->[2]) { # then calculate $isize + my $x1 = ($s1->[1] & 0x10)? $s1->[3] + length($s1->[9]) : $s1->[3]; + my $x2 = ($s2->[1] & 0x10)? $s2->[3] + length($s2->[9]) : $s2->[3]; + $isize = $x2 - $x1; + } + # update mate coordinate + if ($s2->[2] ne '*') { + @$s1[6..8] = (($s2->[2] eq $s1->[2])? "=" : $s2->[2], $s2->[3], $isize); + $s1->[1] |= 0x20 if ($s2->[1] & 0x10); + } else { + $s1->[1] |= 0x8; + } + if ($s1->[2] ne '*') { + @$s2[6..8] = (($s1->[2] eq $s2->[2])? "=" : $s1->[2], $s1->[3], -$isize); + $s2->[1] |= 0x20 if ($s1->[1] & 0x10); + } else { + $s2->[1] |= 0x8; + } +} + +sub zoom2sam { + my %opts = (); + getopts("p", \%opts); + die("Usage: zoom2sam.pl [-p] <readLen> <aln.zoom> +Warnings: This script only supports the default Illumina outputs.\n") if (@ARGV < 2); + my $is_paired = defined($opts{p}); + my $len = shift(@ARGV); + # core loop + my @s1 = (); + my @s2 = (); + my ($s_last, $s_curr) = (\@s1, \@s2); + while (<>) { + &zoom2sam_aux($_, $s_curr, $is_paired, $len); + if (@$s_last != 0 && $s_last->[0] eq $s_curr->[0]) { + &mating($s_last, $s_curr); + print join("\t", @$s_last), "\n"; + print join("\t", @$s_curr), "\n"; + @$s_last = (); @$s_curr = (); + } else { + print join("\t", @$s_last), "\n" if (@$s_last != 0); + my $s = $s_last; $s_last = $s_curr; $s_curr = $s; + } + } + print join("\t", @$s_last), "\n" if (@$s_last != 0); +} + +sub zoom2sam_aux { + my ($line, $s, $is_paired, $len) = @_; + chomp($line); + my @t = split("\t", $line); + @$s = (); + # read name + $s->[0] = $t[0]; + # initial flag (will be updated later) + $s->[1] = 0; + $s->[1] |= 1 | 1<<6 if ($s->[0] =~ /_F$/); + $s->[1] |= 1 | 1<<7 if ($s->[0] =~ /_R$/); + $s->[1] |= 2 if ($is_paired); + # read & quality + $s->[9] = "*"; $s->[10] = "*"; + # cigar + $s->[5] = $len . "M"; + # coor + my @s = split(/\s+/, $t[1]); + $s->[2] = $s[0]; + $t[1] =~ /:(\d+)$/; + $s->[3] = $1 + 1; + if ($s->[0] =~ /_[FR]$/) { + my $u = ($s->[0] =~ /_F$/)? 1 : 0; + my $w = ($t[2] eq '+')? 1 : 0; + $s->[1] |= 0x10 if ($u ^ $w); + $s->[0] =~ s/_[FR]$//; + } else { + $s->[1] |= 0x10 if ($t[2] eq '-'); + } + # mapQ + $s->[4] = 30; + # mate coordinate + $s->[6] = '*'; $s->[7] = $s->[8] = 0; + # aux + push(@$s, "NM:i:$t[3]"); +}
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/SNV/SNVMix2_source/SNVMix2-v0.12.1-rc1/samtools-0.1.6/razf.c Wed Oct 12 19:50:38 2011 -0400 @@ -0,0 +1,698 @@ +/* + * RAZF : Random Access compressed(Z) File + * Version: 1.0 + * Release Date: 2008-10-27 + * + * Copyright 2008, Jue Ruan <ruanjue@gmail.com>, Heng Li <lh3@sanger.ac.uk> + * + * All rights reserved. + * + * Redistribution and use in source and binary forms, with or without + * modification, are permitted provided that the following conditions + * are met: + * 1. Redistributions of source code must retain the above copyright + * notice, this list of conditions and the following disclaimer. + * 2. Redistributions in binary form must reproduce the above copyright + * notice, this list of conditions and the following disclaimer in the + * documentation and/or other materials provided with the distribution. + * + * THIS SOFTWARE IS PROVIDED BY THE AUTHOR AND CONTRIBUTORS ``AS IS'' AND + * ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE + * IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE + * ARE DISCLAIMED. IN NO EVENT SHALL THE AUTHOR OR CONTRIBUTORS BE LIABLE + * FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL + * DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS + * OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION) + * HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT + * LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY + * OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF + * SUCH DAMAGE. + */ + +#ifndef _NO_RAZF + +#include <fcntl.h> +#include <stdio.h> +#include <stdlib.h> +#include <string.h> +#include <unistd.h> +#include "razf.h" + +#if ZLIB_VERNUM < 0x1221 +struct _gz_header_s { + int text; + uLong time; + int xflags; + int os; + Bytef *extra; + uInt extra_len; + uInt extra_max; + Bytef *name; + uInt name_max; + Bytef *comment; + uInt comm_max; + int hcrc; + int done; +}; +#warning "zlib < 1.2.2.1; RAZF writing is disabled." +#endif + +#define DEF_MEM_LEVEL 8 + +static inline uint32_t byte_swap_4(uint32_t v){ + v = ((v & 0x0000FFFFU) << 16) | (v >> 16); + return ((v & 0x00FF00FFU) << 8) | ((v & 0xFF00FF00U) >> 8); +} + +static inline uint64_t byte_swap_8(uint64_t v){ + v = ((v & 0x00000000FFFFFFFFLLU) << 32) | (v >> 32); + v = ((v & 0x0000FFFF0000FFFFLLU) << 16) | ((v & 0xFFFF0000FFFF0000LLU) >> 16); + return ((v & 0x00FF00FF00FF00FFLLU) << 8) | ((v & 0xFF00FF00FF00FF00LLU) >> 8); +} + +static inline int is_big_endian(){ + int x = 0x01; + char *c = (char*)&x; + return (c[0] != 0x01); +} + +#ifndef _RZ_READONLY +static void add_zindex(RAZF *rz, int64_t in, int64_t out){ + if(rz->index->size == rz->index->cap){ + rz->index->cap = rz->index->cap * 1.5 + 2; + rz->index->cell_offsets = realloc(rz->index->cell_offsets, sizeof(int) * rz->index->cap); + rz->index->bin_offsets = realloc(rz->index->bin_offsets, sizeof(int64_t) * (rz->index->cap/RZ_BIN_SIZE + 1)); + } + if(rz->index->size % RZ_BIN_SIZE == 0) rz->index->bin_offsets[rz->index->size / RZ_BIN_SIZE] = out; + rz->index->cell_offsets[rz->index->size] = out - rz->index->bin_offsets[rz->index->size / RZ_BIN_SIZE]; + rz->index->size ++; +} + +static void save_zindex(RAZF *rz, int fd){ + int32_t i, v32; + int is_be; + is_be = is_big_endian(); + if(is_be) write(fd, &rz->index->size, sizeof(int)); + else { + v32 = byte_swap_4((uint32_t)rz->index->size); + write(fd, &v32, sizeof(uint32_t)); + } + v32 = rz->index->size / RZ_BIN_SIZE + 1; + if(!is_be){ + for(i=0;i<v32;i++) rz->index->bin_offsets[i] = byte_swap_8((uint64_t)rz->index->bin_offsets[i]); + for(i=0;i<rz->index->size;i++) rz->index->cell_offsets[i] = byte_swap_4((uint32_t)rz->index->cell_offsets[i]); + } + write(fd, rz->index->bin_offsets, sizeof(int64_t) * v32); + write(fd, rz->index->cell_offsets, sizeof(int32_t) * rz->index->size); +} +#endif + +static void load_zindex(RAZF *rz, int fd){ + int32_t i, v32; + int is_be; + if(!rz->load_index) return; + if(rz->index == NULL) rz->index = malloc(sizeof(ZBlockIndex)); + is_be = is_big_endian(); + read(fd, &rz->index->size, sizeof(int)); + if(!is_be) rz->index->size = byte_swap_4((uint32_t)rz->index->size); + rz->index->cap = rz->index->size; + v32 = rz->index->size / RZ_BIN_SIZE + 1; + rz->index->bin_offsets = malloc(sizeof(int64_t) * v32); + read(fd, rz->index->bin_offsets, sizeof(int64_t) * v32); + rz->index->cell_offsets = malloc(sizeof(int) * rz->index->size); + read(fd, rz->index->cell_offsets, sizeof(int) * rz->index->size); + if(!is_be){ + for(i=0;i<v32;i++) rz->index->bin_offsets[i] = byte_swap_8((uint64_t)rz->index->bin_offsets[i]); + for(i=0;i<rz->index->size;i++) rz->index->cell_offsets[i] = byte_swap_4((uint32_t)rz->index->cell_offsets[i]); + } +} + +#ifdef _RZ_READONLY +static RAZF* razf_open_w(int fd) +{ + fprintf(stderr, "[razf_open_w] Writing is not available with zlib ver < 1.2.2.1\n"); + return 0; +} +#else +static RAZF* razf_open_w(int fd){ + RAZF *rz; +#ifdef _WIN32 + setmode(fd, O_BINARY); +#endif + rz = calloc(1, sizeof(RAZF)); + rz->mode = 'w'; + rz->filedes = fd; + rz->stream = calloc(sizeof(z_stream), 1); + rz->inbuf = malloc(RZ_BUFFER_SIZE); + rz->outbuf = malloc(RZ_BUFFER_SIZE); + rz->index = calloc(sizeof(ZBlockIndex), 1); + deflateInit2(rz->stream, RZ_COMPRESS_LEVEL, Z_DEFLATED, WINDOW_BITS + 16, DEF_MEM_LEVEL, Z_DEFAULT_STRATEGY); + rz->stream->avail_out = RZ_BUFFER_SIZE; + rz->stream->next_out = rz->outbuf; + rz->header = calloc(sizeof(gz_header), 1); + rz->header->os = 0x03; //Unix + rz->header->text = 0; + rz->header->time = 0; + rz->header->extra = malloc(7); + strncpy((char*)rz->header->extra, "RAZF", 4); + rz->header->extra[4] = 1; // obsolete field + // block size = RZ_BLOCK_SIZE, Big-Endian + rz->header->extra[5] = RZ_BLOCK_SIZE >> 8; + rz->header->extra[6] = RZ_BLOCK_SIZE & 0xFF; + rz->header->extra_len = 7; + rz->header->name = rz->header->comment = 0; + rz->header->hcrc = 0; + deflateSetHeader(rz->stream, rz->header); + rz->block_pos = rz->block_off = 0; + return rz; +} + +static void _razf_write(RAZF* rz, const void *data, int size){ + int tout; + rz->stream->avail_in = size; + rz->stream->next_in = (void*)data; + while(1){ + tout = rz->stream->avail_out; + deflate(rz->stream, Z_NO_FLUSH); + rz->out += tout - rz->stream->avail_out; + if(rz->stream->avail_out) break; + write(rz->filedes, rz->outbuf, RZ_BUFFER_SIZE - rz->stream->avail_out); + rz->stream->avail_out = RZ_BUFFER_SIZE; + rz->stream->next_out = rz->outbuf; + if(rz->stream->avail_in == 0) break; + }; + rz->in += size - rz->stream->avail_in; + rz->block_off += size - rz->stream->avail_in; +} + +static void razf_flush(RAZF *rz){ + uint32_t tout; + if(rz->buf_len){ + _razf_write(rz, rz->inbuf, rz->buf_len); + rz->buf_off = rz->buf_len = 0; + } + if(rz->stream->avail_out){ + write(rz->filedes, rz->outbuf, RZ_BUFFER_SIZE - rz->stream->avail_out); + rz->stream->avail_out = RZ_BUFFER_SIZE; + rz->stream->next_out = rz->outbuf; + } + while(1){ + tout = rz->stream->avail_out; + deflate(rz->stream, Z_FULL_FLUSH); + rz->out += tout - rz->stream->avail_out; + if(rz->stream->avail_out == 0){ + write(rz->filedes, rz->outbuf, RZ_BUFFER_SIZE - rz->stream->avail_out); + rz->stream->avail_out = RZ_BUFFER_SIZE; + rz->stream->next_out = rz->outbuf; + } else break; + } + rz->block_pos = rz->out; + rz->block_off = 0; +} + +static void razf_end_flush(RAZF *rz){ + uint32_t tout; + if(rz->buf_len){ + _razf_write(rz, rz->inbuf, rz->buf_len); + rz->buf_off = rz->buf_len = 0; + } + while(1){ + tout = rz->stream->avail_out; + deflate(rz->stream, Z_FINISH); + rz->out += tout - rz->stream->avail_out; + if(rz->stream->avail_out < RZ_BUFFER_SIZE){ + write(rz->filedes, rz->outbuf, RZ_BUFFER_SIZE - rz->stream->avail_out); + rz->stream->avail_out = RZ_BUFFER_SIZE; + rz->stream->next_out = rz->outbuf; + } else break; + } +} + +static void _razf_buffered_write(RAZF *rz, const void *data, int size){ + int i, n; + while(1){ + if(rz->buf_len == RZ_BUFFER_SIZE){ + _razf_write(rz, rz->inbuf, rz->buf_len); + rz->buf_len = 0; + } + if(size + rz->buf_len < RZ_BUFFER_SIZE){ + for(i=0;i<size;i++) ((char*)rz->inbuf + rz->buf_len)[i] = ((char*)data)[i]; + rz->buf_len += size; + return; + } else { + n = RZ_BUFFER_SIZE - rz->buf_len; + for(i=0;i<n;i++) ((char*)rz->inbuf + rz->buf_len)[i] = ((char*)data)[i]; + size -= n; + data += n; + rz->buf_len += n; + } + } +} + +int razf_write(RAZF* rz, const void *data, int size){ + int ori_size, n; + int64_t next_block; + ori_size = size; + next_block = ((rz->in / RZ_BLOCK_SIZE) + 1) * RZ_BLOCK_SIZE; + while(rz->in + rz->buf_len + size >= next_block){ + n = next_block - rz->in - rz->buf_len; + _razf_buffered_write(rz, data, n); + data += n; + size -= n; + razf_flush(rz); + add_zindex(rz, rz->in, rz->out); + next_block = ((rz->in / RZ_BLOCK_SIZE) + 1) * RZ_BLOCK_SIZE; + } + _razf_buffered_write(rz, data, size); + return ori_size; +} +#endif + +/* gzip flag byte */ +#define ASCII_FLAG 0x01 /* bit 0 set: file probably ascii text */ +#define HEAD_CRC 0x02 /* bit 1 set: header CRC present */ +#define EXTRA_FIELD 0x04 /* bit 2 set: extra field present */ +#define ORIG_NAME 0x08 /* bit 3 set: original file name present */ +#define COMMENT 0x10 /* bit 4 set: file comment present */ +#define RESERVED 0xE0 /* bits 5..7: reserved */ + +static int _read_gz_header(unsigned char *data, int size, int *extra_off, int *extra_len){ + int method, flags, n, len; + if(size < 2) return 0; + if(data[0] != 0x1f || data[1] != 0x8b) return 0; + if(size < 4) return 0; + method = data[2]; + flags = data[3]; + if(method != Z_DEFLATED || (flags & RESERVED)) return 0; + n = 4 + 6; // Skip 6 bytes + *extra_off = n + 2; + *extra_len = 0; + if(flags & EXTRA_FIELD){ + if(size < n + 2) return 0; + len = ((int)data[n + 1] << 8) | data[n]; + n += 2; + *extra_off = n; + while(len){ + if(n >= size) return 0; + n ++; + len --; + } + *extra_len = n - (*extra_off); + } + if(flags & ORIG_NAME) while(n < size && data[n++]); + if(flags & COMMENT) while(n < size && data[n++]); + if(flags & HEAD_CRC){ + if(n + 2 > size) return 0; + n += 2; + } + return n; +} + +static RAZF* razf_open_r(int fd, int _load_index){ + RAZF *rz; + int ext_off, ext_len; + int n, is_be, ret; + int64_t end; + unsigned char c[] = "RAZF"; +#ifdef _WIN32 + setmode(fd, O_BINARY); +#endif + rz = calloc(1, sizeof(RAZF)); + rz->mode = 'r'; + rz->filedes = fd; + rz->stream = calloc(sizeof(z_stream), 1); + rz->inbuf = malloc(RZ_BUFFER_SIZE); + rz->outbuf = malloc(RZ_BUFFER_SIZE); + rz->end = rz->src_end = 0x7FFFFFFFFFFFFFFFLL; + n = read(rz->filedes, rz->inbuf, RZ_BUFFER_SIZE); + ret = _read_gz_header(rz->inbuf, n, &ext_off, &ext_len); + if(ret == 0){ + PLAIN_FILE: + rz->in = n; + rz->file_type = FILE_TYPE_PLAIN; + memcpy(rz->outbuf, rz->inbuf, n); + rz->buf_len = n; + free(rz->stream); + rz->stream = NULL; + return rz; + } + rz->header_size = ret; + ret = inflateInit2(rz->stream, -WINDOW_BITS); + if(ret != Z_OK){ inflateEnd(rz->stream); goto PLAIN_FILE;} + rz->stream->avail_in = n - rz->header_size; + rz->stream->next_in = rz->inbuf + rz->header_size; + rz->stream->avail_out = RZ_BUFFER_SIZE; + rz->stream->next_out = rz->outbuf; + rz->file_type = FILE_TYPE_GZ; + rz->in = rz->header_size; + rz->block_pos = rz->header_size; + rz->next_block_pos = rz->header_size; + rz->block_off = 0; + if(ext_len < 7 || memcmp(rz->inbuf + ext_off, c, 4) != 0) return rz; + if(((((unsigned char*)rz->inbuf)[ext_off + 5] << 8) | ((unsigned char*)rz->inbuf)[ext_off + 6]) != RZ_BLOCK_SIZE){ + fprintf(stderr, " -- WARNING: RZ_BLOCK_SIZE is not %d, treat source as gz file. in %s -- %s:%d --\n", RZ_BLOCK_SIZE, __FUNCTION__, __FILE__, __LINE__); + return rz; + } + rz->load_index = _load_index; + rz->file_type = FILE_TYPE_RZ; + if(lseek(fd, -16, SEEK_END) == -1){ + UNSEEKABLE: + rz->seekable = 0; + rz->index = NULL; + rz->src_end = rz->end = 0x7FFFFFFFFFFFFFFFLL; + } else { + is_be = is_big_endian(); + rz->seekable = 1; + read(fd, &end, sizeof(int64_t)); + if(!is_be) rz->src_end = (int64_t)byte_swap_8((uint64_t)end); + else rz->src_end = end; + read(fd, &end, sizeof(int64_t)); + if(!is_be) rz->end = (int64_t)byte_swap_8((uint64_t)end); + else rz->end = end; + if(n > rz->end){ + rz->stream->avail_in -= n - rz->end; + n = rz->end; + } + if(rz->end > rz->src_end){ + lseek(fd, rz->in, SEEK_SET); + goto UNSEEKABLE; + } + if(lseek(fd, rz->end, SEEK_SET) != rz->end){ + lseek(fd, rz->in, SEEK_SET); + goto UNSEEKABLE; + } + load_zindex(rz, fd); + lseek(fd, n, SEEK_SET); + } + return rz; +} + +RAZF* razf_dopen(int fd, const char *mode){ + if(strstr(mode, "r")) return razf_open_r(fd, 1); + else if(strstr(mode, "w")) return razf_open_w(fd); + else return NULL; +} + +RAZF* razf_dopen2(int fd, const char *mode) +{ + if(strstr(mode, "r")) return razf_open_r(fd, 0); + else if(strstr(mode, "w")) return razf_open_w(fd); + else return NULL; +} + +static inline RAZF* _razf_open(const char *filename, const char *mode, int _load_index){ + int fd; + RAZF *rz; + if(strstr(mode, "r")){ +#ifdef _WIN32 + fd = open(filename, O_RDONLY | O_BINARY); +#else + fd = open(filename, O_RDONLY); +#endif + rz = razf_open_r(fd, _load_index); + } else if(strstr(mode, "w")){ +#ifdef _WIN32 + fd = open(filename, O_WRONLY | O_CREAT | O_TRUNC | O_BINARY, 0644); +#else + fd = open(filename, O_WRONLY | O_CREAT | O_TRUNC, 0644); +#endif + rz = razf_open_w(fd); + } else return NULL; + return rz; +} + +RAZF* razf_open(const char *filename, const char *mode){ + return _razf_open(filename, mode, 1); +} + +RAZF* razf_open2(const char *filename, const char *mode){ + return _razf_open(filename, mode, 0); +} + +int razf_get_data_size(RAZF *rz, int64_t *u_size, int64_t *c_size){ + int64_t n; + if(rz->mode != 'r' && rz->mode != 'R') return 0; + switch(rz->file_type){ + case FILE_TYPE_PLAIN: + if(rz->end == 0x7fffffffffffffffLL){ + if((n = lseek(rz->filedes, 0, SEEK_CUR)) == -1) return 0; + rz->end = lseek(rz->filedes, 0, SEEK_END); + lseek(rz->filedes, n, SEEK_SET); + } + *u_size = *c_size = rz->end; + return 1; + case FILE_TYPE_GZ: + return 0; + case FILE_TYPE_RZ: + if(rz->src_end == rz->end) return 0; + *u_size = rz->src_end; + *c_size = rz->end; + return 1; + default: + return 0; + } +} + +static int _razf_read(RAZF* rz, void *data, int size){ + int ret, tin; + if(rz->z_eof || rz->z_err) return 0; + if (rz->file_type == FILE_TYPE_PLAIN) { + ret = read(rz->filedes, data, size); + if (ret == 0) rz->z_eof = 1; + return ret; + } + rz->stream->avail_out = size; + rz->stream->next_out = data; + while(rz->stream->avail_out){ + if(rz->stream->avail_in == 0){ + if(rz->in >= rz->end){ rz->z_eof = 1; break; } + if(rz->end - rz->in < RZ_BUFFER_SIZE){ + rz->stream->avail_in = read(rz->filedes, rz->inbuf, rz->end -rz->in); + } else { + rz->stream->avail_in = read(rz->filedes, rz->inbuf, RZ_BUFFER_SIZE); + } + if(rz->stream->avail_in == 0){ + rz->z_eof = 1; + break; + } + rz->stream->next_in = rz->inbuf; + } + tin = rz->stream->avail_in; + ret = inflate(rz->stream, Z_BLOCK); + rz->in += tin - rz->stream->avail_in; + if(ret == Z_NEED_DICT || ret == Z_MEM_ERROR || ret == Z_DATA_ERROR){ + fprintf(stderr, "[_razf_read] inflate error: %d (at %s:%d)\n", ret, __FILE__, __LINE__); + rz->z_err = 1; + break; + } + if(ret == Z_STREAM_END){ + rz->z_eof = 1; + break; + } + if ((rz->stream->data_type&128) && !(rz->stream->data_type&64)){ + rz->buf_flush = 1; + rz->next_block_pos = rz->in; + break; + } + } + return size - rz->stream->avail_out; +} + +int razf_read(RAZF *rz, void *data, int size){ + int ori_size, i; + ori_size = size; + while(size > 0){ + if(rz->buf_len){ + if(size < rz->buf_len){ + for(i=0;i<size;i++) ((char*)data)[i] = ((char*)rz->outbuf + rz->buf_off)[i]; + rz->buf_off += size; + rz->buf_len -= size; + data += size; + rz->block_off += size; + size = 0; + break; + } else { + for(i=0;i<rz->buf_len;i++) ((char*)data)[i] = ((char*)rz->outbuf + rz->buf_off)[i]; + data += rz->buf_len; + size -= rz->buf_len; + rz->block_off += rz->buf_len; + rz->buf_off = 0; + rz->buf_len = 0; + if(rz->buf_flush){ + rz->block_pos = rz->next_block_pos; + rz->block_off = 0; + rz->buf_flush = 0; + } + } + } else if(rz->buf_flush){ + rz->block_pos = rz->next_block_pos; + rz->block_off = 0; + rz->buf_flush = 0; + } + if(rz->buf_flush) continue; + rz->buf_len = _razf_read(rz, rz->outbuf, RZ_BUFFER_SIZE); + if(rz->z_eof && rz->buf_len == 0) break; + } + rz->out += ori_size - size; + return ori_size - size; +} + +int razf_skip(RAZF* rz, int size){ + int ori_size; + ori_size = size; + while(size > 0){ + if(rz->buf_len){ + if(size < rz->buf_len){ + rz->buf_off += size; + rz->buf_len -= size; + rz->block_off += size; + size = 0; + break; + } else { + size -= rz->buf_len; + rz->buf_off = 0; + rz->buf_len = 0; + rz->block_off += rz->buf_len; + if(rz->buf_flush){ + rz->block_pos = rz->next_block_pos; + rz->block_off = 0; + rz->buf_flush = 0; + } + } + } else if(rz->buf_flush){ + rz->block_pos = rz->next_block_pos; + rz->block_off = 0; + rz->buf_flush = 0; + } + if(rz->buf_flush) continue; + rz->buf_len = _razf_read(rz, rz->outbuf, RZ_BUFFER_SIZE); + if(rz->z_eof) break; + } + rz->out += ori_size - size; + return ori_size - size; +} + +static void _razf_reset_read(RAZF *rz, int64_t in, int64_t out){ + lseek(rz->filedes, in, SEEK_SET); + rz->in = in; + rz->out = out; + rz->block_pos = in; + rz->next_block_pos = in; + rz->block_off = 0; + rz->buf_flush = 0; + rz->z_eof = rz->z_err = 0; + inflateReset(rz->stream); + rz->stream->avail_in = 0; + rz->buf_off = rz->buf_len = 0; +} + +int64_t razf_jump(RAZF *rz, int64_t block_start, int block_offset){ + int64_t pos; + rz->z_eof = 0; + if(rz->file_type == FILE_TYPE_PLAIN){ + rz->buf_off = rz->buf_len = 0; + pos = block_start + block_offset; + pos = lseek(rz->filedes, pos, SEEK_SET); + rz->out = rz->in = pos; + return pos; + } + if(block_start == rz->block_pos && block_offset >= rz->block_off) { + block_offset -= rz->block_off; + goto SKIP; // Needn't reset inflate + } + if(block_start == 0) block_start = rz->header_size; // Automaticly revist wrong block_start + _razf_reset_read(rz, block_start, 0); + SKIP: + if(block_offset) razf_skip(rz, block_offset); + return rz->block_off; +} + +int64_t razf_seek(RAZF* rz, int64_t pos, int where){ + int64_t idx; + int64_t seek_pos, new_out; + rz->z_eof = 0; + if (where == SEEK_CUR) pos += rz->out; + else if (where == SEEK_END) pos += rz->src_end; + if(rz->file_type == FILE_TYPE_PLAIN){ + seek_pos = lseek(rz->filedes, pos, SEEK_SET); + rz->buf_off = rz->buf_len = 0; + rz->out = rz->in = seek_pos; + return seek_pos; + } else if(rz->file_type == FILE_TYPE_GZ){ + if(pos >= rz->out) goto SKIP; + return rz->out; + } + if(pos == rz->out) return pos; + if(pos > rz->src_end) return rz->out; + if(!rz->seekable || !rz->load_index){ + if(pos >= rz->out) goto SKIP; + } + idx = pos / RZ_BLOCK_SIZE - 1; + seek_pos = (idx < 0)? rz->header_size:(rz->index->cell_offsets[idx] + rz->index->bin_offsets[idx / RZ_BIN_SIZE]); + new_out = (idx + 1) * RZ_BLOCK_SIZE; + if(pos > rz->out && new_out <= rz->out) goto SKIP; + _razf_reset_read(rz, seek_pos, new_out); + SKIP: + razf_skip(rz, (int)(pos - rz->out)); + return rz->out; +} + +uint64_t razf_tell2(RAZF *rz) +{ + /* + if (rz->load_index) { + int64_t idx, seek_pos; + idx = rz->out / RZ_BLOCK_SIZE - 1; + seek_pos = (idx < 0)? rz->header_size:(rz->index->cell_offsets[idx] + rz->index->bin_offsets[idx / RZ_BIN_SIZE]); + if (seek_pos != rz->block_pos || rz->out%RZ_BLOCK_SIZE != rz->block_off) + fprintf(stderr, "[razf_tell2] inconsistent block offset: (%lld, %lld) != (%lld, %lld)\n", + (long long)seek_pos, (long long)rz->out%RZ_BLOCK_SIZE, (long long)rz->block_pos, (long long) rz->block_off); + } + */ + return (uint64_t)rz->block_pos<<16 | (rz->block_off&0xffff); +} + +int64_t razf_seek2(RAZF *rz, uint64_t voffset, int where) +{ + if (where != SEEK_SET) return -1; + return razf_jump(rz, voffset>>16, voffset&0xffff); +} + +void razf_close(RAZF *rz){ + if(rz->mode == 'w'){ +#ifndef _RZ_READONLY + razf_end_flush(rz); + deflateEnd(rz->stream); + save_zindex(rz, rz->filedes); + if(is_big_endian()){ + write(rz->filedes, &rz->in, sizeof(int64_t)); + write(rz->filedes, &rz->out, sizeof(int64_t)); + } else { + uint64_t v64 = byte_swap_8((uint64_t)rz->in); + write(rz->filedes, &v64, sizeof(int64_t)); + v64 = byte_swap_8((uint64_t)rz->out); + write(rz->filedes, &v64, sizeof(int64_t)); + } +#endif + } else if(rz->mode == 'r'){ + if(rz->stream) inflateEnd(rz->stream); + } + if(rz->inbuf) free(rz->inbuf); + if(rz->outbuf) free(rz->outbuf); + if(rz->header){ + free(rz->header->extra); + free(rz->header->name); + free(rz->header->comment); + free(rz->header); + } + if(rz->index){ + free(rz->index->bin_offsets); + free(rz->index->cell_offsets); + free(rz->index); + } + free(rz->stream); + close(rz->filedes); + free(rz); +} + +#endif
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/SNV/SNVMix2_source/SNVMix2-v0.12.1-rc1/samtools-0.1.6/razf.h Wed Oct 12 19:50:38 2011 -0400 @@ -0,0 +1,123 @@ + /*- + * RAZF : Random Access compressed(Z) File + * Version: 1.0 + * Release Date: 2008-10-27 + * + * Copyright 2008, Jue Ruan <ruanjue@gmail.com>, Heng Li <lh3@sanger.ac.uk> + * + * All rights reserved. + * + * Redistribution and use in source and binary forms, with or without + * modification, are permitted provided that the following conditions + * are met: + * 1. Redistributions of source code must retain the above copyright + * notice, this list of conditions and the following disclaimer. + * 2. Redistributions in binary form must reproduce the above copyright + * notice, this list of conditions and the following disclaimer in the + * documentation and/or other materials provided with the distribution. + * + * THIS SOFTWARE IS PROVIDED BY THE AUTHOR AND CONTRIBUTORS ``AS IS'' AND + * ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE + * IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE + * ARE DISCLAIMED. IN NO EVENT SHALL THE AUTHOR OR CONTRIBUTORS BE LIABLE + * FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL + * DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS + * OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION) + * HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT + * LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY + * OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF + * SUCH DAMAGE. + */ + + +#ifndef __RAZF_RJ_H +#define __RAZF_RJ_H + +#include <stdint.h> +#include <stdio.h> +#include "zlib.h" + +#if ZLIB_VERNUM < 0x1221 +#define _RZ_READONLY +struct _gz_header_s; +typedef struct _gz_header_s _gz_header; +#define gz_header _gz_header +#endif + +#define WINDOW_BITS 15 + +#ifndef RZ_BLOCK_SIZE +#define RZ_BLOCK_SIZE (1<<WINDOW_BITS) +#endif + +#ifndef RZ_BUFFER_SIZE +#define RZ_BUFFER_SIZE 4096 +#endif + +#ifndef RZ_COMPRESS_LEVEL +#define RZ_COMPRESS_LEVEL 6 +#endif + +#define RZ_BIN_SIZE ((1LLU << 32) / RZ_BLOCK_SIZE) + +typedef struct { + uint32_t *cell_offsets; // i + int64_t *bin_offsets; // i / BIN_SIZE + int size; + int cap; +} ZBlockIndex; +/* When storing index, output bytes in Big-Endian everywhere */ + +#define FILE_TYPE_RZ 1 +#define FILE_TYPE_PLAIN 2 +#define FILE_TYPE_GZ 3 + +typedef struct RandomAccessZFile { + char mode; /* 'w' : write mode; 'r' : read mode */ + int file_type; + /* plain file or rz file, razf_read support plain file as input too, in this case, razf_read work as buffered fread */ + int filedes; /* the file descriptor */ + z_stream *stream; + ZBlockIndex *index; + int64_t in, out, end, src_end; + /* in: n bytes total in; out: n bytes total out; */ + /* end: the end of all data blocks, while the start of index; src_end: the true end position in uncompressed file */ + int buf_flush; // buffer should be flush, suspend inflate util buffer is empty + int64_t block_pos, block_off, next_block_pos; + /* block_pos: the start postiion of current block in compressed file */ + /* block_off: tell how many bytes have been read from current block */ + void *inbuf, *outbuf; + int header_size; + gz_header *header; + /* header is used to transfer inflate_state->mode from HEAD to TYPE after call inflateReset */ + int buf_off, buf_len; + int z_err, z_eof; + int seekable; + /* Indice where the source is seekable */ + int load_index; + /* set has_index to 0 in mode 'w', then index will be discarded */ +} RAZF; + +#ifdef __cplusplus +extern "C" { +#endif + + RAZF* razf_dopen(int data_fd, const char *mode); + RAZF *razf_open(const char *fn, const char *mode); + int razf_write(RAZF* rz, const void *data, int size); + int razf_read(RAZF* rz, void *data, int size); + int64_t razf_seek(RAZF* rz, int64_t pos, int where); + void razf_close(RAZF* rz); + +#define razf_tell(rz) ((rz)->out) + + RAZF* razf_open2(const char *filename, const char *mode); + RAZF* razf_dopen2(int fd, const char *mode); + uint64_t razf_tell2(RAZF *rz); + int64_t razf_seek2(RAZF *rz, uint64_t voffset, int where); + +#ifdef __cplusplus +} +#endif + +#endif
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/SNV/SNVMix2_source/SNVMix2-v0.12.1-rc1/samtools-0.1.6/razip.c Wed Oct 12 19:50:38 2011 -0400 @@ -0,0 +1,141 @@ +#include <stdio.h> +#include <fcntl.h> +#include <unistd.h> +#include <errno.h> +#include <stdlib.h> +#include <string.h> +#include "razf.h" + +#define WINDOW_SIZE 4096 + +static int razf_main_usage() +{ + printf("\n"); + printf("Usage: razip [options] [file] ...\n\n"); + printf("Options: -c write on standard output, keep original files unchanged\n"); + printf(" -d decompress\n"); + printf(" -l list compressed file contents\n"); + printf(" -b INT decompress at INT position in the uncompressed file\n"); + printf(" -s INT decompress INT bytes in the uncompressed file\n"); + printf(" -h give this help\n"); + printf("\n"); + return 0; +} + +static int write_open(const char *fn, int is_forced) +{ + int fd = -1; + char c; + if (!is_forced) { + if ((fd = open(fn, O_WRONLY | O_CREAT | O_TRUNC | O_EXCL, 0644)) < 0 && errno == EEXIST) { + printf("razip: %s already exists; do you wish to overwrite (y or n)? ", fn); + scanf("%c", &c); + if (c != 'Y' && c != 'y') { + printf("razip: not overwritten\n"); + exit(1); + } + } + } + if (fd < 0) { + if ((fd = open(fn, O_WRONLY | O_CREAT | O_TRUNC, 0644)) < 0) { + fprintf(stderr, "razip: %s: Fail to write\n", fn); + exit(1); + } + } + return fd; +} + +int main(int argc, char **argv) +{ + int c, compress, pstdout, is_forced; + RAZF *rz; + void *buffer; + long start, end, size; + + compress = 1; pstdout = 0; start = 0; size = -1; end = -1; is_forced = 0; + while((c = getopt(argc, argv, "cdlhfb:s:")) >= 0){ + switch(c){ + case 'h': return razf_main_usage(); + case 'd': compress = 0; break; + case 'c': pstdout = 1; break; + case 'l': compress = 2; break; + case 'b': start = atol(optarg); break; + case 's': size = atol(optarg); break; + case 'f': is_forced = 1; break; + } + } + if (size >= 0) end = start + size; + if(end >= 0 && end < start){ + fprintf(stderr, " -- Illegal region: [%ld, %ld] --\n", start, end); + return 1; + } + if(compress == 1){ + int f_src, f_dst = -1; + if(argc > optind){ + if((f_src = open(argv[optind], O_RDONLY)) < 0){ + fprintf(stderr, " -- Cannot open file: %s --\n", argv[optind]); + return 1; + } + if(pstdout){ + f_dst = fileno(stdout); + } else { + char *name = malloc(sizeof(strlen(argv[optind]) + 5)); + strcpy(name, argv[optind]); + strcat(name, ".rz"); + f_dst = write_open(name, is_forced); + if (f_dst < 0) return 1; + free(name); + } + } else if(pstdout){ + f_src = fileno(stdin); + f_dst = fileno(stdout); + } else return razf_main_usage(); + rz = razf_dopen(f_dst, "w"); + buffer = malloc(WINDOW_SIZE); + while((c = read(f_src, buffer, WINDOW_SIZE)) > 0) razf_write(rz, buffer, c); + razf_close(rz); // f_dst will be closed here + if (argc > optind) unlink(argv[optind]); + free(buffer); + close(f_src); + return 0; + } else { + if(argc <= optind) return razf_main_usage(); + if(compress == 2){ + rz = razf_open(argv[optind], "r"); + if(rz->file_type == FILE_TYPE_RZ) { + printf("%20s%20s%7s %s\n", "compressed", "uncompressed", "ratio", "name"); + printf("%20lld%20lld%6.1f%% %s\n", (long long)rz->end, (long long)rz->src_end, rz->end * 100.0f / rz->src_end, + argv[optind]); + } else fprintf(stdout, "%s is not a regular rz file\n", argv[optind]); + } else { + int f_dst; + if (argc > optind && !pstdout) { + char *name; + if (strstr(argv[optind], ".rz") - argv[optind] != strlen(argv[optind]) - 3) { + printf("razip: %s: unknown suffix -- ignored\n", argv[optind]); + return 1; + } + name = strdup(argv[optind]); + name[strlen(name) - 3] = '\0'; + f_dst = write_open(name, is_forced); + free(name); + } else f_dst = fileno(stdout); + rz = razf_open(argv[optind], "r"); + buffer = malloc(WINDOW_SIZE); + razf_seek(rz, start, SEEK_SET); + while(1){ + if(end < 0) c = razf_read(rz, buffer, WINDOW_SIZE); + else c = razf_read(rz, buffer, (end - start > WINDOW_SIZE)? WINDOW_SIZE:(end - start)); + if(c <= 0) break; + start += c; + write(f_dst, buffer, c); + if(end >= 0 && start >= end) break; + } + free(buffer); + if (!pstdout) unlink(argv[optind]); + } + razf_close(rz); + return 0; + } +} +
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/SNV/SNVMix2_source/SNVMix2-v0.12.1-rc1/samtools-0.1.6/sam.c Wed Oct 12 19:50:38 2011 -0400 @@ -0,0 +1,176 @@ +#include <string.h> +#include <unistd.h> +#include "faidx.h" +#include "sam.h" + +#define TYPE_BAM 1 +#define TYPE_READ 2 + +bam_header_t *bam_header_dup(const bam_header_t *h0) +{ + bam_header_t *h; + int i; + h = bam_header_init(); + *h = *h0; + h->hash = 0; + h->text = (char*)calloc(h->l_text + 1, 1); + memcpy(h->text, h0->text, h->l_text); + h->target_len = (uint32_t*)calloc(h->n_targets, 4); + h->target_name = (char**)calloc(h->n_targets, sizeof(void*)); + for (i = 0; i < h->n_targets; ++i) { + h->target_len[i] = h0->target_len[i]; + h->target_name[i] = strdup(h0->target_name[i]); + } + if (h0->rg2lib) h->rg2lib = bam_strmap_dup(h0->rg2lib); + return h; +} +static void append_header_text(bam_header_t *header, char* text, int len) +{ + int x = header->l_text + 1; + int y = header->l_text + len + 1; // 1 byte null + if (text == 0) return; + kroundup32(x); + kroundup32(y); + if (x < y) header->text = (char*)realloc(header->text, y); + strncpy(header->text + header->l_text, text, len); // we cannot use strcpy() here. + header->l_text += len; + header->text[header->l_text] = 0; +} + +samfile_t *samopen(const char *fn, const char *mode, const void *aux) +{ + samfile_t *fp; + fp = (samfile_t*)calloc(1, sizeof(samfile_t)); + if (mode[0] == 'r') { // read + fp->type |= TYPE_READ; + if (mode[1] == 'b') { // binary + fp->type |= TYPE_BAM; + fp->x.bam = strcmp(fn, "-")? bam_open(fn, "r") : bam_dopen(fileno(stdin), "r"); + if (fp->x.bam == 0) goto open_err_ret; + fp->header = bam_header_read(fp->x.bam); + } else { // text + fp->x.tamr = sam_open(fn); + if (fp->x.tamr == 0) goto open_err_ret; + fp->header = sam_header_read(fp->x.tamr); + if (fp->header->n_targets == 0) { // no @SQ fields + if (aux) { // check if aux is present + bam_header_t *textheader = fp->header; + fp->header = sam_header_read2((const char*)aux); + append_header_text(fp->header, textheader->text, textheader->l_text); + bam_header_destroy(textheader); + } + if (fp->header->n_targets == 0) + fprintf(stderr, "[samopen] no @SQ lines in the header.\n"); + } else fprintf(stderr, "[samopen] SAM header is present: %d sequences.\n", fp->header->n_targets); + } + sam_header_parse_rg(fp->header); + } else if (mode[0] == 'w') { // write + fp->header = bam_header_dup((const bam_header_t*)aux); + if (mode[1] == 'b') { // binary + char bmode[3]; + bmode[0] = 'w'; bmode[1] = strstr(mode, "u")? 'u' : 0; bmode[2] = 0; + fp->type |= TYPE_BAM; + fp->x.bam = strcmp(fn, "-")? bam_open(fn, bmode) : bam_dopen(fileno(stdout), bmode); + if (fp->x.bam == 0) goto open_err_ret; + bam_header_write(fp->x.bam, fp->header); + } else { // text + // open file + fp->x.tamw = strcmp(fn, "-")? fopen(fn, "w") : stdout; + if (fp->x.tamr == 0) goto open_err_ret; + if (strstr(mode, "X")) fp->type |= BAM_OFSTR<<2; + else if (strstr(mode, "x")) fp->type |= BAM_OFHEX<<2; + else fp->type |= BAM_OFDEC<<2; + // write header + if (strstr(mode, "h")) { + int i; + bam_header_t *alt; + // parse the header text + alt = bam_header_init(); + alt->l_text = fp->header->l_text; alt->text = fp->header->text; + sam_header_parse(alt); + alt->l_text = 0; alt->text = 0; + // check if there are @SQ lines in the header + fwrite(fp->header->text, 1, fp->header->l_text, fp->x.tamw); + if (alt->n_targets) { // then write the header text without dumping ->target_{name,len} + if (alt->n_targets != fp->header->n_targets) + fprintf(stderr, "[samopen] inconsistent number of target sequences.\n"); + } else { // then dump ->target_{name,len} + for (i = 0; i < fp->header->n_targets; ++i) + fprintf(fp->x.tamw, "@SQ\tSN:%s\tLN:%d\n", fp->header->target_name[i], fp->header->target_len[i]); + } + bam_header_destroy(alt); + } + } + } + return fp; + +open_err_ret: + free(fp); + return 0; +} + +void samclose(samfile_t *fp) +{ + if (fp == 0) return; + if (fp->header) bam_header_destroy(fp->header); + if (fp->type & TYPE_BAM) bam_close(fp->x.bam); + else if (fp->type & TYPE_READ) sam_close(fp->x.tamr); + else fclose(fp->x.tamw); + free(fp); +} + +int samread(samfile_t *fp, bam1_t *b) +{ + if (fp == 0 || !(fp->type & TYPE_READ)) return -1; // not open for reading + if (fp->type & TYPE_BAM) return bam_read1(fp->x.bam, b); + else return sam_read1(fp->x.tamr, fp->header, b); +} + +int samwrite(samfile_t *fp, const bam1_t *b) +{ + if (fp == 0 || (fp->type & TYPE_READ)) return -1; // not open for writing + if (fp->type & TYPE_BAM) return bam_write1(fp->x.bam, b); + else { + char *s = bam_format1_core(fp->header, b, fp->type>>2&3); + int l = strlen(s); + fputs(s, fp->x.tamw); fputc('\n', fp->x.tamw); + free(s); + return l + 1; + } +} + +int sampileup(samfile_t *fp, int mask, bam_pileup_f func, void *func_data) +{ + bam_plbuf_t *buf; + int ret; + bam1_t *b; + b = bam_init1(); + buf = bam_plbuf_init(func, func_data); + bam_plbuf_set_mask(buf, mask); + while ((ret = samread(fp, b)) >= 0) + bam_plbuf_push(b, buf); + bam_plbuf_push(0, buf); + bam_plbuf_destroy(buf); + bam_destroy1(b); + return 0; +} + +char *samfaipath(const char *fn_ref) +{ + char *fn_list = 0; + if (fn_ref == 0) return 0; + fn_list = calloc(strlen(fn_ref) + 5, 1); + strcat(strcpy(fn_list, fn_ref), ".fai"); + if (access(fn_list, R_OK) == -1) { // fn_list is unreadable + if (access(fn_ref, R_OK) == -1) { + fprintf(stderr, "[samfaipath] fail to read file %s.\n", fn_ref); + } else { + fprintf(stderr, "[samfaipath] build FASTA index...\n"); + if (fai_build(fn_ref) == -1) { + fprintf(stderr, "[samfaipath] fail to build FASTA index.\n"); + free(fn_list); fn_list = 0; + } + } + } + return fn_list; +}
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/SNV/SNVMix2_source/SNVMix2-v0.12.1-rc1/samtools-0.1.6/sam.h Wed Oct 12 19:50:38 2011 -0400 @@ -0,0 +1,98 @@ +#ifndef BAM_SAM_H +#define BAM_SAM_H + +#include "bam.h" + +/*! + @header + + This file provides higher level of I/O routines and unifies the APIs + for SAM and BAM formats. These APIs are more convenient and + recommended. + + @copyright Genome Research Ltd. + */ + +/*! @typedef + @abstract SAM/BAM file handler + @field type type of the handler; bit 1 for BAM, 2 for reading and bit 3-4 for flag format + @field bam BAM file handler; valid if (type&1) == 1 + @field tamr SAM file handler for reading; valid if type == 2 + @field tamw SAM file handler for writing; valid if type == 0 + @field header header struct + */ +typedef struct { + int type; + union { + tamFile tamr; + bamFile bam; + FILE *tamw; + } x; + bam_header_t *header; +} samfile_t; + +#ifdef __cplusplus +extern "C" { +#endif + + /*! + @abstract Open a SAM/BAM file + + @param fn SAM/BAM file name; "-" is recognized as stdin (for + reading) or stdout (for writing). + + @param mode open mode /[rw](b?)(u?)(h?)([xX]?)/: 'r' for reading, + 'w' for writing, 'b' for BAM I/O, 'u' for uncompressed BAM output, + 'h' for outputing header in SAM, 'x' for HEX flag and 'X' for + string flag. If 'b' present, it must immediately follow 'r' or + 'w'. Valid modes are "r", "w", "wh", "wx", "whx", "wX", "whX", + "rb", "wb" and "wbu" exclusively. + + @param aux auxiliary data; if mode[0]=='w', aux points to + bam_header_t; if strcmp(mode, "rb")!=0 and @SQ header lines in SAM + are absent, aux points the file name of the list of the reference; + aux is not used otherwise. If @SQ header lines are present in SAM, + aux is not used, either. + + @return SAM/BAM file handler + */ + samfile_t *samopen(const char *fn, const char *mode, const void *aux); + + /*! + @abstract Close a SAM/BAM handler + @param fp file handler to be closed + */ + void samclose(samfile_t *fp); + + /*! + @abstract Read one alignment + @param fp file handler + @param b alignment + @return bytes read + */ + int samread(samfile_t *fp, bam1_t *b); + + /*! + @abstract Write one alignment + @param fp file handler + @param b alignment + @return bytes written + */ + int samwrite(samfile_t *fp, const bam1_t *b); + + /*! + @abstract Get the pileup for a whole alignment file + @param fp file handler + @param mask mask transferred to bam_plbuf_set_mask() + @param func user defined function called in the pileup process + #param data user provided data for func() + */ + int sampileup(samfile_t *fp, int mask, bam_pileup_f func, void *data); + + char *samfaipath(const char *fn_ref); + +#ifdef __cplusplus +} +#endif + +#endif
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/SNV/SNVMix2_source/SNVMix2-v0.12.1-rc1/samtools-0.1.6/sam_view.c Wed Oct 12 19:50:38 2011 -0400 @@ -0,0 +1,201 @@ +#include <stdlib.h> +#include <string.h> +#include <stdio.h> +#include <unistd.h> +#include "sam.h" +#include "faidx.h" + +static int g_min_mapQ = 0, g_flag_on = 0, g_flag_off = 0; +static char *g_library, *g_rg; + +static inline int __g_skip_aln(const bam_header_t *h, const bam1_t *b) +{ + if (b->core.qual < g_min_mapQ || ((b->core.flag & g_flag_on) != g_flag_on) || (b->core.flag & g_flag_off)) + return 1; + if (g_library || g_rg) { + uint8_t *s = bam_aux_get(b, "RG"); + if (s) { + if (g_rg && strcmp(g_rg, (char*)(s + 1)) == 0) return 0; + if (g_library) { + const char *p = bam_strmap_get(h->rg2lib, (char*)(s + 1)); + return (p && strcmp(p, g_library) == 0)? 0 : 1; + } return 1; + } else return 1; + } else return 0; +} + +// callback function for bam_fetch() +static int view_func(const bam1_t *b, void *data) +{ + if (!__g_skip_aln(((samfile_t*)data)->header, b)) + samwrite((samfile_t*)data, b); + return 0; +} + +static int usage(int is_long_help); + +int main_samview(int argc, char *argv[]) +{ + int c, is_header = 0, is_header_only = 0, is_bamin = 1, ret = 0, is_uncompressed = 0, is_bamout = 0; + int of_type = BAM_OFDEC, is_long_help = 0; + samfile_t *in = 0, *out = 0; + char in_mode[5], out_mode[5], *fn_out = 0, *fn_list = 0, *fn_ref = 0; + + /* parse command-line options */ + strcpy(in_mode, "r"); strcpy(out_mode, "w"); + while ((c = getopt(argc, argv, "Sbt:hHo:q:f:F:ul:r:xX?T:")) >= 0) { + switch (c) { + case 'S': is_bamin = 0; break; + case 'b': is_bamout = 1; break; + case 't': fn_list = strdup(optarg); is_bamin = 0; break; + case 'h': is_header = 1; break; + case 'H': is_header_only = 1; break; + case 'o': fn_out = strdup(optarg); break; + case 'f': g_flag_on = strtol(optarg, 0, 0); break; + case 'F': g_flag_off = strtol(optarg, 0, 0); break; + case 'q': g_min_mapQ = atoi(optarg); break; + case 'u': is_uncompressed = 1; break; + case 'l': g_library = strdup(optarg); break; + case 'r': g_rg = strdup(optarg); break; + case 'x': of_type = BAM_OFHEX; break; + case 'X': of_type = BAM_OFSTR; break; + case '?': is_long_help = 1; break; + case 'T': fn_ref = strdup(optarg); is_bamin = 0; break; + default: return usage(is_long_help); + } + } + if (is_uncompressed) is_bamout = 1; + if (is_header_only) is_header = 1; + if (is_bamout) strcat(out_mode, "b"); + else { + if (of_type == BAM_OFHEX) strcat(out_mode, "x"); + else if (of_type == BAM_OFSTR) strcat(out_mode, "X"); + } + if (is_bamin) strcat(in_mode, "b"); + if (is_header) strcat(out_mode, "h"); + if (is_uncompressed) strcat(out_mode, "u"); + if (argc == optind) return usage(is_long_help); + + // generate the fn_list if necessary + if (fn_list == 0 && fn_ref) fn_list = samfaipath(fn_ref); + // open file handlers + if ((in = samopen(argv[optind], in_mode, fn_list)) == 0) { + fprintf(stderr, "[main_samview] fail to open file for reading.\n"); + goto view_end; + } + if (in->header == 0) { + fprintf(stderr, "[main_samview] fail to read the header.\n"); + goto view_end; + } + if ((out = samopen(fn_out? fn_out : "-", out_mode, in->header)) == 0) { + fprintf(stderr, "[main_samview] fail to open file for writing.\n"); + goto view_end; + } + if (is_header_only) goto view_end; // no need to print alignments + + if (argc == optind + 1) { // convert/print the entire file + bam1_t *b = bam_init1(); + int r; + while ((r = samread(in, b)) >= 0) // read one alignment from `in' + if (!__g_skip_aln(in->header, b)) + samwrite(out, b); // write the alignment to `out' + if (r < -1) fprintf(stderr, "[main_samview] truncated file.\n"); + bam_destroy1(b); + } else { // retrieve alignments in specified regions + int i; + bam_index_t *idx = 0; + if (is_bamin) idx = bam_index_load(argv[optind]); // load BAM index + if (idx == 0) { // index is unavailable + fprintf(stderr, "[main_samview] random alignment retrieval only works for indexed BAM files.\n"); + ret = 1; + goto view_end; + } + for (i = optind + 1; i < argc; ++i) { + int tid, beg, end; + bam_parse_region(in->header, argv[i], &tid, &beg, &end); // parse a region in the format like `chr2:100-200' + if (tid < 0) { // reference name is not found + fprintf(stderr, "[main_samview] fail to get the reference name. Continue anyway.\n"); + continue; + } + bam_fetch(in->x.bam, idx, tid, beg, end, out, view_func); // fetch alignments + } + bam_index_destroy(idx); // destroy the BAM index + } + +view_end: + // close files, free and return + free(fn_list); free(fn_ref); free(fn_out); free(g_library); free(g_rg); + samclose(in); + samclose(out); + return ret; +} + +static int usage(int is_long_help) +{ + fprintf(stderr, "\n"); + fprintf(stderr, "Usage: samtools view [options] <in.bam>|<in.sam> [region1 [...]]\n\n"); + fprintf(stderr, "Options: -b output BAM\n"); + fprintf(stderr, " -h print header for the SAM output\n"); + fprintf(stderr, " -H print header only (no alignments)\n"); + fprintf(stderr, " -S input is SAM\n"); + fprintf(stderr, " -u uncompressed BAM output (force -b)\n"); + fprintf(stderr, " -x output FLAG in HEX (samtools-C specific)\n"); + fprintf(stderr, " -X output FLAG in string (samtools-C specific)\n"); + fprintf(stderr, " -t FILE list of reference names and lengths (force -S) [null]\n"); + fprintf(stderr, " -T FILE reference sequence file (force -S) [null]\n"); + fprintf(stderr, " -o FILE output file name [stdout]\n"); + fprintf(stderr, " -f INT required flag, 0 for unset [0]\n"); + fprintf(stderr, " -F INT filtering flag, 0 for unset [0]\n"); + fprintf(stderr, " -q INT minimum mapping quality [0]\n"); + fprintf(stderr, " -l STR only output reads in library STR [null]\n"); + fprintf(stderr, " -r STR only output reads in read group STR [null]\n"); + fprintf(stderr, " -? longer help\n"); + fprintf(stderr, "\n"); + if (is_long_help) + fprintf(stderr, "Notes:\n\ +\n\ + 1. By default, this command assumes the file on the command line is in\n\ + the BAM format and it prints the alignments in SAM. If `-t' is\n\ + applied, the input file is assumed to be in the SAM format. The\n\ + file supplied with `-t' is SPACE/TAB delimited with the first two\n\ + fields of each line consisting of the reference name and the\n\ + corresponding sequence length. The `.fai' file generated by `faidx'\n\ + can be used here. This file may be empty if reads are unaligned.\n\ +\n\ + 2. SAM->BAM conversion: `samtools view -bT ref.fa in.sam.gz'.\n\ +\n\ + 3. BAM->SAM conversion: `samtools view in.bam'.\n\ +\n\ + 4. A region should be presented in one of the following formats:\n\ + `chr1', `chr2:1,000' and `chr3:1000-2,000'. When a region is\n\ + specified, the input alignment file must be an indexed BAM file.\n\ +\n\ + 5. Option `-u' is preferred over `-b' when the output is piped to\n\ + another samtools command.\n\ +\n\ + 6. In a string FLAG, each character represents one bit with\n\ + p=0x1 (paired), P=0x2 (properly paired), u=0x4 (unmapped),\n\ + U=0x8 (mate unmapped), r=0x10 (reverse), R=0x20 (mate reverse)\n\ + 1=0x40 (first), 2=0x80 (second), s=0x100 (not primary), \n\ + f=0x200 (failure) and d=0x400 (duplicate). Note that `-x' and\n\ + `-X' are samtools-C specific. Picard and older samtools do not\n\ + support HEX or string flags.\n\ +\n"); + return 1; +} + +int main_import(int argc, char *argv[]) +{ + int argc2, ret; + char **argv2; + if (argc != 4) { + fprintf(stderr, "Usage: bamtk import <in.ref_list> <in.sam> <out.bam>\n"); + return 1; + } + argc2 = 6; + argv2 = calloc(6, sizeof(char*)); + argv2[0] = "import", argv2[1] = "-o", argv2[2] = argv[3], argv2[3] = "-bt", argv2[4] = argv[1], argv2[5] = argv[2]; + ret = main_samview(argc2, argv2); + free(argv2); + return ret; +}
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/SNV/SNVMix2_source/SNVMix2-v0.12.1-rc1/samtools-0.1.6/samtools.1 Wed Oct 12 19:50:38 2011 -0400 @@ -0,0 +1,445 @@ +.TH samtools 1 "2 September 2009" "samtools-0.1.6" "Bioinformatics tools" +.SH NAME +.PP +samtools - Utilities for the Sequence Alignment/Map (SAM) format +.SH SYNOPSIS +.PP +samtools view -bt ref_list.txt -o aln.bam aln.sam.gz +.PP +samtools sort aln.bam aln.sorted +.PP +samtools index aln.sorted.bam +.PP +samtools view aln.sorted.bam chr2:20,100,000-20,200,000 +.PP +samtools merge out.bam in1.bam in2.bam in3.bam +.PP +samtools faidx ref.fasta +.PP +samtools pileup -f ref.fasta aln.sorted.bam +.PP +samtools tview aln.sorted.bam ref.fasta + +.SH DESCRIPTION +.PP +Samtools is a set of utilities that manipulate alignments in the BAM +format. It imports from and exports to the SAM (Sequence Alignment/Map) +format, does sorting, merging and indexing, and allows to retrieve reads +in any regions swiftly. + +Samtools is designed to work on a stream. It regards an input file `-' +as the standard input (stdin) and an output file `-' as the standard +output (stdout). Several commands can thus be combined with Unix +pipes. Samtools always output warning and error messages to the standard +error output (stderr). + +Samtools is also able to open a BAM (not SAM) file on a remote FTP or +HTTP server if the BAM file name starts with `ftp://' or `http://'. +Samtools checks the current working directory for the index file and +will download the index upon absence. Samtools does not retrieve the +entire alignment file unless it is asked to do so. + +.SH COMMANDS AND OPTIONS + +.TP 10 +.B import +samtools import <in.ref_list> <in.sam> <out.bam> + +Since 0.1.4, this command is an alias of: + +samtools view -bt <in.ref_list> -o <out.bam> <in.sam> + +.TP +.B sort +samtools sort [-n] [-m maxMem] <in.bam> <out.prefix> + +Sort alignments by leftmost coordinates. File +.I <out.prefix>.bam +will be created. This command may also create temporary files +.I <out.prefix>.%d.bam +when the whole alignment cannot be fitted into memory (controlled by +option -m). + +.B OPTIONS: +.RS +.TP 8 +.B -n +Sort by read names rather than by chromosomal coordinates +.TP +.B -m INT +Approximately the maximum required memory. [500000000] +.RE + +.TP +.B merge +samtools merge [-h inh.sam] [-n] <out.bam> <in1.bam> <in2.bam> [...] + +Merge multiple sorted alignments. +The header reference lists of all the input BAM files, and the @SQ headers of +.IR inh.sam , +if any, must all refer to the same set of reference sequences. +The header reference list and (unless overridden by +.BR -h ) +`@' headers of +.I in1.bam +will be copied to +.IR out.bam , +and the headers of other files will be ignored. + +.B OPTIONS: +.RS +.TP 8 +.B -h FILE +Use the lines of +.I FILE +as `@' headers to be copied to +.IR out.bam , +replacing any header lines that would otherwise be copied from +.IR in1.bam . +.RI ( FILE +is actually in SAM format, though any alignment records it may contain +are ignored.) +.TP +.B -n +The input alignments are sorted by read names rather than by chromosomal +coordinates +.RE + +.TP +.B index +samtools index <aln.bam> + +Index sorted alignment for fast random access. Index file +.I <aln.bam>.bai +will be created. + +.TP +.B view +samtools view [-bhuHS] [-t in.refList] [-o output] [-f reqFlag] [-F +skipFlag] [-q minMapQ] [-l library] [-r readGroup] <in.bam>|<in.sam> [region1 [...]] + +Extract/print all or sub alignments in SAM or BAM format. If no region +is specified, all the alignments will be printed; otherwise only +alignments overlapping the specified regions will be output. An +alignment may be given multiple times if it is overlapping several +regions. A region can be presented, for example, in the following +format: `chr2', `chr2:1000000' or `chr2:1,000,000-2,000,000'. The +coordinate is 1-based. + +.B OPTIONS: +.RS +.TP 8 +.B -b +Output in the BAM format. +.TP +.B -u +Output uncompressed BAM. This option saves time spent on +compression/decomprssion and is thus preferred when the output is piped +to another samtools command. +.TP +.B -h +Include the header in the output. +.TP +.B -H +Output the header only. +.TP +.B -S +Input is in SAM. If @SQ header lines are absent, the +.B `-t' +option is required. +.TP +.B -t FILE +This file is TAB-delimited. Each line must contain the reference name +and the length of the reference, one line for each distinct reference; +additional fields are ignored. This file also defines the order of the +reference sequences in sorting. If you run `samtools faidx <ref.fa>', +the resultant index file +.I <ref.fa>.fai +can be used as this +.I <in.ref_list> +file. +.TP +.B -o FILE +Output file [stdout] +.TP +.B -f INT +Only output alignments with all bits in INT present in the FLAG +field. INT can be in hex in the format of /^0x[0-9A-F]+/ [0] +.TP +.B -F INT +Skip alignments with bits present in INT [0] +.TP +.B -q INT +Skip alignments with MAPQ smaller than INT [0] +.TP +.B -l STR +Only output reads in library STR [null] +.TP +.B -r STR +Only output reads in read group STR [null] +.RE + +.TP +.B faidx +samtools faidx <ref.fasta> [region1 [...]] + +Index reference sequence in the FASTA format or extract subsequence from +indexed reference sequence. If no region is specified, +.B faidx +will index the file and create +.I <ref.fasta>.fai +on the disk. If regions are speficified, the subsequences will be +retrieved and printed to stdout in the FASTA format. The input file can +be compressed in the +.B RAZF +format. + +.TP +.B pileup +samtools pileup [-f in.ref.fasta] [-t in.ref_list] [-l in.site_list] +[-iscgS2] [-T theta] [-N nHap] [-r pairDiffRate] <in.bam>|<in.sam> + +Print the alignment in the pileup format. In the pileup format, each +line represents a genomic position, consisting of chromosome name, +coordinate, reference base, read bases, read qualities and alignment +mapping qualities. Information on match, mismatch, indel, strand, +mapping quality and start and end of a read are all encoded at the read +base column. At this column, a dot stands for a match to the reference +base on the forward strand, a comma for a match on the reverse strand, +`ACGTN' for a mismatch on the forward strand and `acgtn' for a mismatch +on the reverse strand. A pattern `\\+[0-9]+[ACGTNacgtn]+' indicates +there is an insertion between this reference position and the next +reference position. The length of the insertion is given by the integer +in the pattern, followed by the inserted sequence. Similarly, a pattern +`-[0-9]+[ACGTNacgtn]+' represents a deletion from the reference. The +deleted bases will be presented as `*' in the following lines. Also at +the read base column, a symbol `^' marks the start of a read segment +which is a contiguous subsequence on the read separated by `N/S/H' CIGAR +operations. The ASCII of the character following `^' minus 33 gives the +mapping quality. A symbol `$' marks the end of a read segment. + +If option +.B -c +is applied, the consensus base, consensus quality, SNP quality and RMS +mapping quality of the reads covering the site will be inserted between +the `reference base' and the `read bases' columns. An indel occupies an +additional line. Each indel line consists of chromosome name, +coordinate, a star, the genotype, consensus quality, SNP quality, RMS +mapping quality, # covering reads, the first alllele, the second allele, +# reads supporting the first allele, # reads supporting the second +allele and # reads containing indels different from the top two alleles. + +.B OPTIONS: +.RS + +.TP 10 +.B -s +Print the mapping quality as the last column. This option makes the +output easier to parse, although this format is not space efficient. + +.TP +.B -S +The input file is in SAM. + +.TP +.B -i +Only output pileup lines containing indels. + +.TP +.B -f FILE +The reference sequence in the FASTA format. Index file +.I FILE.fai +will be created if +absent. + +.TP +.B -M INT +Cap mapping quality at INT [60] + +.TP +.B -t FILE +List of reference names ane sequence lengths, in the format described +for the +.B import +command. If this option is present, samtools assumes the input +.I <in.alignment> +is in SAM format; otherwise it assumes in BAM format. + +.TP +.B -l FILE +List of sites at which pileup is output. This file is space +delimited. The first two columns are required to be chromosome and +1-based coordinate. Additional columns are ignored. It is +recommended to use option +.B -s +together with +.B -l +as in the default format we may not know the mapping quality. + +.TP +.B -c +Call the consensus sequence using MAQ consensus model. Options +.B -T, +.B -N, +.B -I +and +.B -r +are only effective when +.B -c +or +.B -g +is in use. + +.TP +.B -g +Generate genotype likelihood in the binary GLFv3 format. This option +suppresses -c, -i and -s. + +.TP +.B -T FLOAT +The theta parameter (error dependency coefficient) in the maq consensus +calling model [0.85] + +.TP +.B -N INT +Number of haplotypes in the sample (>=2) [2] + +.TP +.B -r FLOAT +Expected fraction of differences between a pair of haplotypes [0.001] + +.TP +.B -I INT +Phred probability of an indel in sequencing/prep. [40] + +.RE + +.TP +.B tview +samtools tview <in.sorted.bam> [ref.fasta] + +Text alignment viewer (based on the ncurses library). In the viewer, +press `?' for help and press `g' to check the alignment start from a +region in the format like `chr10:10,000,000'. + +.RE + +.TP +.B fixmate +samtools fixmate <in.nameSrt.bam> <out.bam> + +Fill in mate coordinates, ISIZE and mate related flags from a +name-sorted alignment. + +.TP +.B rmdup +samtools rmdup <input.srt.bam> <out.bam> + +Remove potential PCR duplicates: if multiple read pairs have identical +external coordinates, only retain the pair with highest mapping quality. +This command +.B ONLY +works with FR orientation and requires ISIZE is correctly set. + +.RE + +.TP +.B rmdupse +samtools rmdupse <input.srt.bam> <out.bam> + +Remove potential duplicates for single-ended reads. This command will +treat all reads as single-ended even if they are paired in fact. + +.RE + +.TP +.B fillmd +samtools fillmd [-e] <aln.bam> <ref.fasta> + +Generate the MD tag. If the MD tag is already present, this command will +give a warning if the MD tag generated is different from the existing +tag. + +.B OPTIONS: +.RS +.TP 8 +.B -e +Convert a the read base to = if it is identical to the aligned reference +base. Indel caller does not support the = bases at the moment. + +.RE + +.SH SAM FORMAT + +SAM is TAB-delimited. Apart from the header lines, which are started +with the `@' symbol, each alignment line consists of: + +.TS +center box; +cb | cb | cb +n | l | l . +Col Field Description +_ +1 QNAME Query (pair) NAME +2 FLAG bitwise FLAG +3 RNAME Reference sequence NAME +4 POS 1-based leftmost POSition/coordinate of clipped sequence +5 MAPQ MAPping Quality (Phred-scaled) +6 CIAGR extended CIGAR string +7 MRNM Mate Reference sequence NaMe (`=' if same as RNAME) +8 MPOS 1-based Mate POSistion +9 ISIZE Inferred insert SIZE +10 SEQ query SEQuence on the same strand as the reference +11 QUAL query QUALity (ASCII-33 gives the Phred base quality) +12 OPT variable OPTional fields in the format TAG:VTYPE:VALUE +.TE + +.PP +Each bit in the FLAG field is defined as: + +.TS +center box; +cb | cb +l | l . +Flag Description +_ +0x0001 the read is paired in sequencing +0x0002 the read is mapped in a proper pair +0x0004 the query sequence itself is unmapped +0x0008 the mate is unmapped +0x0010 strand of the query (1 for reverse) +0x0020 strand of the mate +0x0040 the read is the first read in a pair +0x0080 the read is the second read in a pair +0x0100 the alignment is not primary +0x0200 the read fails platform/vendor quality checks +0x0400 the read is either a PCR or an optical duplicate +.TE + +.SH LIMITATIONS +.PP +.IP o 2 +Unaligned words used in bam_import.c, bam_endian.h, bam.c and bam_aux.c. +.IP o 2 +CIGAR operation P is not properly handled at the moment. +.IP o 2 +In merging, the input files are required to have the same number of +reference sequences. The requirement can be relaxed. In addition, +merging does not reconstruct the header dictionaries +automatically. Endusers have to provide the correct header. Picard is +better at merging. +.IP o 2 +Samtools' rmdup does not work for single-end data and does not remove +duplicates across chromosomes. Picard is better. + +.SH AUTHOR +.PP +Heng Li from the Sanger Institute wrote the C version of samtools. Bob +Handsaker from the Broad Institute implemented the BGZF library and Jue +Ruan from Beijing Genomics Institute wrote the RAZF library. Various +people in the 1000Genomes Project contributed to the SAM format +specification. + +.SH SEE ALSO +.PP +Samtools website: <http://samtools.sourceforge.net>
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/SNV/SNVMix2_source/SNVMix2-v0.12.1-rc1/samtools-0.1.6/samtools.txt Wed Oct 12 19:50:38 2011 -0400 @@ -0,0 +1,373 @@ +samtools(1) Bioinformatics tools samtools(1) + + + +NAME + samtools - Utilities for the Sequence Alignment/Map (SAM) format + +SYNOPSIS + samtools view -bt ref_list.txt -o aln.bam aln.sam.gz + + samtools sort aln.bam aln.sorted + + samtools index aln.sorted.bam + + samtools view aln.sorted.bam chr2:20,100,000-20,200,000 + + samtools merge out.bam in1.bam in2.bam in3.bam + + samtools faidx ref.fasta + + samtools pileup -f ref.fasta aln.sorted.bam + + samtools tview aln.sorted.bam ref.fasta + + +DESCRIPTION + Samtools is a set of utilities that manipulate alignments in the BAM + format. It imports from and exports to the SAM (Sequence Alignment/Map) + format, does sorting, merging and indexing, and allows to retrieve + reads in any regions swiftly. + + Samtools is designed to work on a stream. It regards an input file `-' + as the standard input (stdin) and an output file `-' as the standard + output (stdout). Several commands can thus be combined with Unix pipes. + Samtools always output warning and error messages to the standard error + output (stderr). + + Samtools is also able to open a BAM (not SAM) file on a remote FTP or + HTTP server if the BAM file name starts with `ftp://' or `http://'. + Samtools checks the current working directory for the index file and + will download the index upon absence. Samtools does not retrieve the + entire alignment file unless it is asked to do so. + + +COMMANDS AND OPTIONS + import samtools import <in.ref_list> <in.sam> <out.bam> + + Since 0.1.4, this command is an alias of: + + samtools view -bt <in.ref_list> -o <out.bam> <in.sam> + + + sort samtools sort [-n] [-m maxMem] <in.bam> <out.prefix> + + Sort alignments by leftmost coordinates. File <out.pre- + fix>.bam will be created. This command may also create tempo- + rary files <out.prefix>.%d.bam when the whole alignment can- + not be fitted into memory (controlled by option -m). + + OPTIONS: + + -n Sort by read names rather than by chromosomal coordi- + nates + + -m INT Approximately the maximum required memory. + [500000000] + + + merge samtools merge [-h inh.sam] [-n] <out.bam> <in1.bam> + <in2.bam> [...] + + Merge multiple sorted alignments. The header reference lists + of all the input BAM files, and the @SQ headers of inh.sam, + if any, must all refer to the same set of reference + sequences. The header reference list and (unless overridden + by -h) `@' headers of in1.bam will be copied to out.bam, and + the headers of other files will be ignored. + + OPTIONS: + + -h FILE Use the lines of FILE as `@' headers to be copied to + out.bam, replacing any header lines that would other- + wise be copied from in1.bam. (FILE is actually in + SAM format, though any alignment records it may con- + tain are ignored.) + + -n The input alignments are sorted by read names rather + than by chromosomal coordinates + + + index samtools index <aln.bam> + + Index sorted alignment for fast random access. Index file + <aln.bam>.bai will be created. + + + view samtools view [-bhuHS] [-t in.refList] [-o output] [-f + reqFlag] [-F skipFlag] [-q minMapQ] [-l library] [-r read- + Group] <in.bam>|<in.sam> [region1 [...]] + + Extract/print all or sub alignments in SAM or BAM format. If + no region is specified, all the alignments will be printed; + otherwise only alignments overlapping the specified regions + will be output. An alignment may be given multiple times if + it is overlapping several regions. A region can be presented, + for example, in the following format: `chr2', `chr2:1000000' + or `chr2:1,000,000-2,000,000'. The coordinate is 1-based. + + OPTIONS: + + -b Output in the BAM format. + + -u Output uncompressed BAM. This option saves time spent + on compression/decomprssion and is thus preferred + when the output is piped to another samtools command. + + -h Include the header in the output. + + -H Output the header only. + + -S Input is in SAM. If @SQ header lines are absent, the + `-t' option is required. + + -t FILE This file is TAB-delimited. Each line must contain + the reference name and the length of the reference, + one line for each distinct reference; additional + fields are ignored. This file also defines the order + of the reference sequences in sorting. If you run + `samtools faidx <ref.fa>', the resultant index file + <ref.fa>.fai can be used as this <in.ref_list> file. + + -o FILE Output file [stdout] + + -f INT Only output alignments with all bits in INT present + in the FLAG field. INT can be in hex in the format of + /^0x[0-9A-F]+/ [0] + + -F INT Skip alignments with bits present in INT [0] + + -q INT Skip alignments with MAPQ smaller than INT [0] + + -l STR Only output reads in library STR [null] + + -r STR Only output reads in read group STR [null] + + + faidx samtools faidx <ref.fasta> [region1 [...]] + + Index reference sequence in the FASTA format or extract sub- + sequence from indexed reference sequence. If no region is + specified, faidx will index the file and create + <ref.fasta>.fai on the disk. If regions are speficified, the + subsequences will be retrieved and printed to stdout in the + FASTA format. The input file can be compressed in the RAZF + format. + + + pileup samtools pileup [-f in.ref.fasta] [-t in.ref_list] [-l + in.site_list] [-iscgS2] [-T theta] [-N nHap] [-r + pairDiffRate] <in.bam>|<in.sam> + + Print the alignment in the pileup format. In the pileup for- + mat, each line represents a genomic position, consisting of + chromosome name, coordinate, reference base, read bases, read + qualities and alignment mapping qualities. Information on + match, mismatch, indel, strand, mapping quality and start and + end of a read are all encoded at the read base column. At + this column, a dot stands for a match to the reference base + on the forward strand, a comma for a match on the reverse + strand, `ACGTN' for a mismatch on the forward strand and + `acgtn' for a mismatch on the reverse strand. A pattern + `\+[0-9]+[ACGTNacgtn]+' indicates there is an insertion + between this reference position and the next reference posi- + tion. The length of the insertion is given by the integer in + the pattern, followed by the inserted sequence. Similarly, a + pattern `-[0-9]+[ACGTNacgtn]+' represents a deletion from the + reference. The deleted bases will be presented as `*' in the + following lines. Also at the read base column, a symbol `^' + marks the start of a read segment which is a contiguous sub- + sequence on the read separated by `N/S/H' CIGAR operations. + The ASCII of the character following `^' minus 33 gives the + mapping quality. A symbol `$' marks the end of a read seg- + ment. + + If option -c is applied, the consensus base, consensus qual- + ity, SNP quality and RMS mapping quality of the reads cover- + ing the site will be inserted between the `reference base' + and the `read bases' columns. An indel occupies an additional + line. Each indel line consists of chromosome name, coordi- + nate, a star, the genotype, consensus quality, SNP quality, + RMS mapping quality, # covering reads, the first alllele, the + second allele, # reads supporting the first allele, # reads + supporting the second allele and # reads containing indels + different from the top two alleles. + + OPTIONS: + + + -s Print the mapping quality as the last column. This + option makes the output easier to parse, although + this format is not space efficient. + + + -S The input file is in SAM. + + + -i Only output pileup lines containing indels. + + + -f FILE The reference sequence in the FASTA format. Index + file FILE.fai will be created if absent. + + + -M INT Cap mapping quality at INT [60] + + + -t FILE List of reference names ane sequence lengths, in + the format described for the import command. If + this option is present, samtools assumes the input + <in.alignment> is in SAM format; otherwise it + assumes in BAM format. + + + -l FILE List of sites at which pileup is output. This file + is space delimited. The first two columns are + required to be chromosome and 1-based coordinate. + Additional columns are ignored. It is recommended + to use option -s together with -l as in the default + format we may not know the mapping quality. + + + -c Call the consensus sequence using MAQ consensus + model. Options -T, -N, -I and -r are only effective + when -c or -g is in use. + + + -g Generate genotype likelihood in the binary GLFv3 + format. This option suppresses -c, -i and -s. + + + -T FLOAT The theta parameter (error dependency coefficient) + in the maq consensus calling model [0.85] + + + -N INT Number of haplotypes in the sample (>=2) [2] + + + -r FLOAT Expected fraction of differences between a pair of + haplotypes [0.001] + + + -I INT Phred probability of an indel in sequencing/prep. + [40] + + + + tview samtools tview <in.sorted.bam> [ref.fasta] + + Text alignment viewer (based on the ncurses library). In the + viewer, press `?' for help and press `g' to check the align- + ment start from a region in the format like + `chr10:10,000,000'. + + + + fixmate samtools fixmate <in.nameSrt.bam> <out.bam> + + Fill in mate coordinates, ISIZE and mate related flags from a + name-sorted alignment. + + + rmdup samtools rmdup <input.srt.bam> <out.bam> + + Remove potential PCR duplicates: if multiple read pairs have + identical external coordinates, only retain the pair with + highest mapping quality. This command ONLY works with FR + orientation and requires ISIZE is correctly set. + + + + rmdupse samtools rmdupse <input.srt.bam> <out.bam> + + Remove potential duplicates for single-ended reads. This com- + mand will treat all reads as single-ended even if they are + paired in fact. + + + + fillmd samtools fillmd [-e] <aln.bam> <ref.fasta> + + Generate the MD tag. If the MD tag is already present, this + command will give a warning if the MD tag generated is dif- + ferent from the existing tag. + + OPTIONS: + + -e Convert a the read base to = if it is identical to + the aligned reference base. Indel caller does not + support the = bases at the moment. + + + +SAM FORMAT + SAM is TAB-delimited. Apart from the header lines, which are started + with the `@' symbol, each alignment line consists of: + + + +----+-------+----------------------------------------------------------+ + |Col | Field | Description | + +----+-------+----------------------------------------------------------+ + | 1 | QNAME | Query (pair) NAME | + | 2 | FLAG | bitwise FLAG | + | 3 | RNAME | Reference sequence NAME | + | 4 | POS | 1-based leftmost POSition/coordinate of clipped sequence | + | 5 | MAPQ | MAPping Quality (Phred-scaled) | + | 6 | CIAGR | extended CIGAR string | + | 7 | MRNM | Mate Reference sequence NaMe (`=' if same as RNAME) | + | 8 | MPOS | 1-based Mate POSistion | + | 9 | ISIZE | Inferred insert SIZE | + |10 | SEQ | query SEQuence on the same strand as the reference | + |11 | QUAL | query QUALity (ASCII-33 gives the Phred base quality) | + |12 | OPT | variable OPTional fields in the format TAG:VTYPE:VALUE | + +----+-------+----------------------------------------------------------+ + + Each bit in the FLAG field is defined as: + + + +-------+--------------------------------------------------+ + | Flag | Description | + +-------+--------------------------------------------------+ + |0x0001 | the read is paired in sequencing | + |0x0002 | the read is mapped in a proper pair | + |0x0004 | the query sequence itself is unmapped | + |0x0008 | the mate is unmapped | + |0x0010 | strand of the query (1 for reverse) | + |0x0020 | strand of the mate | + |0x0040 | the read is the first read in a pair | + |0x0080 | the read is the second read in a pair | + |0x0100 | the alignment is not primary | + |0x0200 | the read fails platform/vendor quality checks | + |0x0400 | the read is either a PCR or an optical duplicate | + +-------+--------------------------------------------------+ + +LIMITATIONS + o Unaligned words used in bam_import.c, bam_endian.h, bam.c and + bam_aux.c. + + o CIGAR operation P is not properly handled at the moment. + + o In merging, the input files are required to have the same number of + reference sequences. The requirement can be relaxed. In addition, + merging does not reconstruct the header dictionaries automatically. + Endusers have to provide the correct header. Picard is better at + merging. + + o Samtools' rmdup does not work for single-end data and does not remove + duplicates across chromosomes. Picard is better. + + +AUTHOR + Heng Li from the Sanger Institute wrote the C version of samtools. Bob + Handsaker from the Broad Institute implemented the BGZF library and Jue + Ruan from Beijing Genomics Institute wrote the RAZF library. Various + people in the 1000Genomes Project contributed to the SAM format speci- + fication. + + +SEE ALSO + Samtools website: <http://samtools.sourceforge.net> + + + +samtools-0.1.6 2 September 2009 samtools(1)
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/SNV/SNVMix2_source/SNVMix2-v0.12.1-rc1/samtools-0.1.6/win32/xcurses.h Wed Oct 12 19:50:38 2011 -0400 @@ -0,0 +1,1377 @@ +/* Public Domain Curses */ + +/* $Id: curses.h,v 1.295 2008/07/15 17:13:25 wmcbrine Exp $ */ + +/*----------------------------------------------------------------------* + * PDCurses * + *----------------------------------------------------------------------*/ + +#ifndef __PDCURSES__ +#define __PDCURSES__ 1 + +/*man-start************************************************************** + +PDCurses definitions list: (Only define those needed) + + XCURSES True if compiling for X11. + PDC_RGB True if you want to use RGB color definitions + (Red = 1, Green = 2, Blue = 4) instead of BGR. + PDC_WIDE True if building wide-character support. + PDC_DLL_BUILD True if building a Win32 DLL. + NCURSES_MOUSE_VERSION Use the ncurses mouse API instead + of PDCurses' traditional mouse API. + +PDCurses portable platform definitions list: + + PDC_BUILD Defines API build version. + PDCURSES Enables access to PDCurses-only routines. + XOPEN Always true. + SYSVcurses True if you are compiling for SYSV portability. + BSDcurses True if you are compiling for BSD portability. + +**man-end****************************************************************/ + +#define PDC_BUILD 3401 +#define PDCURSES 1 /* PDCurses-only routines */ +#define XOPEN 1 /* X/Open Curses routines */ +#define SYSVcurses 1 /* System V Curses routines */ +#define BSDcurses 1 /* BSD Curses routines */ +#define CHTYPE_LONG 1 /* size of chtype; long */ + +/*----------------------------------------------------------------------*/ + +#include <stdarg.h> +#include <stddef.h> +#include <stdio.h> /* Required by X/Open usage below */ + +#ifdef PDC_WIDE +# include <wchar.h> +#endif + +#if defined(__cplusplus) || defined(__cplusplus__) || defined(__CPLUSPLUS) +extern "C" +{ +# define bool _bool +#endif + +/*---------------------------------------------------------------------- + * + * PDCurses Manifest Constants + * + */ + +#ifndef FALSE +# define FALSE 0 +#endif +#ifndef TRUE +# define TRUE 1 +#endif +#ifndef NULL +# define NULL (void *)0 +#endif +#ifndef ERR +# define ERR (-1) +#endif +#ifndef OK +# define OK 0 +#endif + +/*---------------------------------------------------------------------- + * + * PDCurses Type Declarations + * + */ + +typedef unsigned char bool; /* PDCurses Boolean type */ + +#ifdef CHTYPE_LONG +# if _LP64 +typedef unsigned int chtype; +# else +typedef unsigned long chtype; /* 16-bit attr + 16-bit char */ +# endif +#else +typedef unsigned short chtype; /* 8-bit attr + 8-bit char */ +#endif + +#ifdef PDC_WIDE +typedef chtype cchar_t; +#endif + +typedef chtype attr_t; + +/*---------------------------------------------------------------------- + * + * PDCurses Mouse Interface -- SYSVR4, with extensions + * + */ + +typedef struct +{ + int x; /* absolute column, 0 based, measured in characters */ + int y; /* absolute row, 0 based, measured in characters */ + short button[3]; /* state of each button */ + int changes; /* flags indicating what has changed with the mouse */ +} MOUSE_STATUS; + +#define BUTTON_RELEASED 0x0000 +#define BUTTON_PRESSED 0x0001 +#define BUTTON_CLICKED 0x0002 +#define BUTTON_DOUBLE_CLICKED 0x0003 +#define BUTTON_TRIPLE_CLICKED 0x0004 +#define BUTTON_MOVED 0x0005 /* PDCurses */ +#define WHEEL_SCROLLED 0x0006 /* PDCurses */ +#define BUTTON_ACTION_MASK 0x0007 /* PDCurses */ + +#define PDC_BUTTON_SHIFT 0x0008 /* PDCurses */ +#define PDC_BUTTON_CONTROL 0x0010 /* PDCurses */ +#define PDC_BUTTON_ALT 0x0020 /* PDCurses */ +#define BUTTON_MODIFIER_MASK 0x0038 /* PDCurses */ + +#define MOUSE_X_POS (Mouse_status.x) +#define MOUSE_Y_POS (Mouse_status.y) + +/* + * Bits associated with the .changes field: + * 3 2 1 0 + * 210987654321098765432109876543210 + * 1 <- button 1 has changed + * 10 <- button 2 has changed + * 100 <- button 3 has changed + * 1000 <- mouse has moved + * 10000 <- mouse position report + * 100000 <- mouse wheel up + * 1000000 <- mouse wheel down + */ + +#define PDC_MOUSE_MOVED 0x0008 +#define PDC_MOUSE_POSITION 0x0010 +#define PDC_MOUSE_WHEEL_UP 0x0020 +#define PDC_MOUSE_WHEEL_DOWN 0x0040 + +#define A_BUTTON_CHANGED (Mouse_status.changes & 7) +#define MOUSE_MOVED (Mouse_status.changes & PDC_MOUSE_MOVED) +#define MOUSE_POS_REPORT (Mouse_status.changes & PDC_MOUSE_POSITION) +#define BUTTON_CHANGED(x) (Mouse_status.changes & (1 << ((x) - 1))) +#define BUTTON_STATUS(x) (Mouse_status.button[(x) - 1]) +#define MOUSE_WHEEL_UP (Mouse_status.changes & PDC_MOUSE_WHEEL_UP) +#define MOUSE_WHEEL_DOWN (Mouse_status.changes & PDC_MOUSE_WHEEL_DOWN) + +/* mouse bit-masks */ + +#define BUTTON1_RELEASED 0x00000001L +#define BUTTON1_PRESSED 0x00000002L +#define BUTTON1_CLICKED 0x00000004L +#define BUTTON1_DOUBLE_CLICKED 0x00000008L +#define BUTTON1_TRIPLE_CLICKED 0x00000010L +#define BUTTON1_MOVED 0x00000010L /* PDCurses */ + +#define BUTTON2_RELEASED 0x00000020L +#define BUTTON2_PRESSED 0x00000040L +#define BUTTON2_CLICKED 0x00000080L +#define BUTTON2_DOUBLE_CLICKED 0x00000100L +#define BUTTON2_TRIPLE_CLICKED 0x00000200L +#define BUTTON2_MOVED 0x00000200L /* PDCurses */ + +#define BUTTON3_RELEASED 0x00000400L +#define BUTTON3_PRESSED 0x00000800L +#define BUTTON3_CLICKED 0x00001000L +#define BUTTON3_DOUBLE_CLICKED 0x00002000L +#define BUTTON3_TRIPLE_CLICKED 0x00004000L +#define BUTTON3_MOVED 0x00004000L /* PDCurses */ + +/* For the ncurses-compatible functions only, BUTTON4_PRESSED and + BUTTON5_PRESSED are returned for mouse scroll wheel up and down; + otherwise PDCurses doesn't support buttons 4 and 5 */ + +#define BUTTON4_RELEASED 0x00008000L +#define BUTTON4_PRESSED 0x00010000L +#define BUTTON4_CLICKED 0x00020000L +#define BUTTON4_DOUBLE_CLICKED 0x00040000L +#define BUTTON4_TRIPLE_CLICKED 0x00080000L + +#define BUTTON5_RELEASED 0x00100000L +#define BUTTON5_PRESSED 0x00200000L +#define BUTTON5_CLICKED 0x00400000L +#define BUTTON5_DOUBLE_CLICKED 0x00800000L +#define BUTTON5_TRIPLE_CLICKED 0x01000000L + +#define MOUSE_WHEEL_SCROLL 0x02000000L /* PDCurses */ +#define BUTTON_MODIFIER_SHIFT 0x04000000L /* PDCurses */ +#define BUTTON_MODIFIER_CONTROL 0x08000000L /* PDCurses */ +#define BUTTON_MODIFIER_ALT 0x10000000L /* PDCurses */ + +#define ALL_MOUSE_EVENTS 0x1fffffffL +#define REPORT_MOUSE_POSITION 0x20000000L + +/* ncurses mouse interface */ + +typedef unsigned long mmask_t; + +typedef struct +{ + short id; /* unused, always 0 */ + int x, y, z; /* x, y same as MOUSE_STATUS; z unused */ + mmask_t bstate; /* equivalent to changes + button[], but + in the same format as used for mousemask() */ +} MEVENT; + +#ifdef NCURSES_MOUSE_VERSION +# define BUTTON_SHIFT BUTTON_MODIFIER_SHIFT +# define BUTTON_CONTROL BUTTON_MODIFIER_CONTROL +# define BUTTON_CTRL BUTTON_MODIFIER_CONTROL +# define BUTTON_ALT BUTTON_MODIFIER_ALT +#else +# define BUTTON_SHIFT PDC_BUTTON_SHIFT +# define BUTTON_CONTROL PDC_BUTTON_CONTROL +# define BUTTON_ALT PDC_BUTTON_ALT +#endif + +/*---------------------------------------------------------------------- + * + * PDCurses Structure Definitions + * + */ + +typedef struct _win /* definition of a window */ +{ + int _cury; /* current pseudo-cursor */ + int _curx; + int _maxy; /* max window coordinates */ + int _maxx; + int _begy; /* origin on screen */ + int _begx; + int _flags; /* window properties */ + chtype _attrs; /* standard attributes and colors */ + chtype _bkgd; /* background, normally blank */ + bool _clear; /* causes clear at next refresh */ + bool _leaveit; /* leaves cursor where it is */ + bool _scroll; /* allows window scrolling */ + bool _nodelay; /* input character wait flag */ + bool _immed; /* immediate update flag */ + bool _sync; /* synchronise window ancestors */ + bool _use_keypad; /* flags keypad key mode active */ + chtype **_y; /* pointer to line pointer array */ + int *_firstch; /* first changed character in line */ + int *_lastch; /* last changed character in line */ + int _tmarg; /* top of scrolling region */ + int _bmarg; /* bottom of scrolling region */ + int _delayms; /* milliseconds of delay for getch() */ + int _parx, _pary; /* coords relative to parent (0,0) */ + struct _win *_parent; /* subwin's pointer to parent win */ +} WINDOW; + +/* Avoid using the SCREEN struct directly -- use the corresponding + functions if possible. This struct may eventually be made private. */ + +typedef struct +{ + bool alive; /* if initscr() called, and not endwin() */ + bool autocr; /* if cr -> lf */ + bool cbreak; /* if terminal unbuffered */ + bool echo; /* if terminal echo */ + bool raw_inp; /* raw input mode (v. cooked input) */ + bool raw_out; /* raw output mode (7 v. 8 bits) */ + bool audible; /* FALSE if the bell is visual */ + bool mono; /* TRUE if current screen is mono */ + bool resized; /* TRUE if TERM has been resized */ + bool orig_attr; /* TRUE if we have the original colors */ + short orig_fore; /* original screen foreground color */ + short orig_back; /* original screen foreground color */ + int cursrow; /* position of physical cursor */ + int curscol; /* position of physical cursor */ + int visibility; /* visibility of cursor */ + int orig_cursor; /* original cursor size */ + int lines; /* new value for LINES */ + int cols; /* new value for COLS */ + unsigned long _trap_mbe; /* trap these mouse button events */ + unsigned long _map_mbe_to_key; /* map mouse buttons to slk */ + int mouse_wait; /* time to wait (in ms) for a + button release after a press, in + order to count it as a click */ + int slklines; /* lines in use by slk_init() */ + WINDOW *slk_winptr; /* window for slk */ + int linesrippedoff; /* lines ripped off via ripoffline() */ + int linesrippedoffontop; /* lines ripped off on + top via ripoffline() */ + int delaytenths; /* 1/10ths second to wait block + getch() for */ + bool _preserve; /* TRUE if screen background + to be preserved */ + int _restore; /* specifies if screen background + to be restored, and how */ + bool save_key_modifiers; /* TRUE if each key modifiers saved + with each key press */ + bool return_key_modifiers; /* TRUE if modifier keys are + returned as "real" keys */ + bool key_code; /* TRUE if last key is a special key; + used internally by get_wch() */ +#ifdef XCURSES + int XcurscrSize; /* size of Xcurscr shared memory block */ + bool sb_on; + int sb_viewport_y; + int sb_viewport_x; + int sb_total_y; + int sb_total_x; + int sb_cur_y; + int sb_cur_x; +#endif + short line_color; /* color of line attributes - default -1 */ +} SCREEN; + +/*---------------------------------------------------------------------- + * + * PDCurses External Variables + * + */ + +#ifdef PDC_DLL_BUILD +# ifdef CURSES_LIBRARY +# define PDCEX __declspec(dllexport) extern +# else +# define PDCEX __declspec(dllimport) +# endif +#else +# define PDCEX extern +#endif + +PDCEX int LINES; /* terminal height */ +PDCEX int COLS; /* terminal width */ +PDCEX WINDOW *stdscr; /* the default screen window */ +PDCEX WINDOW *curscr; /* the current screen image */ +PDCEX SCREEN *SP; /* curses variables */ +PDCEX MOUSE_STATUS Mouse_status; +PDCEX int COLORS; +PDCEX int COLOR_PAIRS; +PDCEX int TABSIZE; +PDCEX chtype acs_map[]; /* alternate character set map */ +PDCEX char ttytype[]; /* terminal name/description */ + +/*man-start************************************************************** + +PDCurses Text Attributes +======================== + +Originally, PDCurses used a short (16 bits) for its chtype. To include +color, a number of things had to be sacrificed from the strict Unix and +System V support. The main problem was fitting all character attributes +and color into an unsigned char (all 8 bits!). + +Today, PDCurses by default uses a long (32 bits) for its chtype, as in +System V. The short chtype is still available, by undefining CHTYPE_LONG +and rebuilding the library. + +The following is the structure of a win->_attrs chtype: + +short form: + +------------------------------------------------- +|15|14|13|12|11|10| 9| 8| 7| 6| 5| 4| 3| 2| 1| 0| +------------------------------------------------- + color number | attrs | character eg 'a' + +The available non-color attributes are bold, reverse and blink. Others +have no effect. The high order char is an index into an array of +physical colors (defined in color.c) -- 32 foreground/background color +pairs (5 bits) plus 3 bits for other attributes. + +long form: + +---------------------------------------------------------------------------- +|31|30|29|28|27|26|25|24|23|22|21|20|19|18|17|16|15|14|13|12|..| 3| 2| 1| 0| +---------------------------------------------------------------------------- + color number | modifiers | character eg 'a' + +The available non-color attributes are bold, underline, invisible, +right-line, left-line, protect, reverse and blink. 256 color pairs (8 +bits), 8 bits for other attributes, and 16 bits for character data. + +**man-end****************************************************************/ + +/*** Video attribute macros ***/ + +#define A_NORMAL (chtype)0 + +#ifdef CHTYPE_LONG +# define A_ALTCHARSET (chtype)0x00010000 +# define A_RIGHTLINE (chtype)0x00020000 +# define A_LEFTLINE (chtype)0x00040000 +# define A_INVIS (chtype)0x00080000 +# define A_UNDERLINE (chtype)0x00100000 +# define A_REVERSE (chtype)0x00200000 +# define A_BLINK (chtype)0x00400000 +# define A_BOLD (chtype)0x00800000 + +# define A_ATTRIBUTES (chtype)0xffff0000 +# define A_CHARTEXT (chtype)0x0000ffff +# define A_COLOR (chtype)0xff000000 + +# define A_ITALIC A_INVIS +# define A_PROTECT (A_UNDERLINE | A_LEFTLINE | A_RIGHTLINE) + +# define PDC_ATTR_SHIFT 19 +# define PDC_COLOR_SHIFT 24 +#else +# define A_BOLD (chtype)0x0100 /* X/Open */ +# define A_REVERSE (chtype)0x0200 /* X/Open */ +# define A_BLINK (chtype)0x0400 /* X/Open */ + +# define A_ATTRIBUTES (chtype)0xff00 /* X/Open */ +# define A_CHARTEXT (chtype)0x00ff /* X/Open */ +# define A_COLOR (chtype)0xf800 /* System V */ + +# define A_ALTCHARSET A_NORMAL /* X/Open */ +# define A_PROTECT A_NORMAL /* X/Open */ +# define A_UNDERLINE A_NORMAL /* X/Open */ + +# define A_LEFTLINE A_NORMAL +# define A_RIGHTLINE A_NORMAL +# define A_ITALIC A_NORMAL +# define A_INVIS A_NORMAL + +# define PDC_ATTR_SHIFT 8 +# define PDC_COLOR_SHIFT 11 +#endif + +#define A_STANDOUT (A_REVERSE | A_BOLD) /* X/Open */ +#define A_DIM A_NORMAL + +#define CHR_MSK A_CHARTEXT /* Obsolete */ +#define ATR_MSK A_ATTRIBUTES /* Obsolete */ +#define ATR_NRM A_NORMAL /* Obsolete */ + +/* For use with attr_t -- X/Open says, "these shall be distinct", so + this is a non-conforming implementation. */ + +#define WA_ALTCHARSET A_ALTCHARSET +#define WA_BLINK A_BLINK +#define WA_BOLD A_BOLD +#define WA_DIM A_DIM +#define WA_INVIS A_INVIS +#define WA_LEFT A_LEFTLINE +#define WA_PROTECT A_PROTECT +#define WA_REVERSE A_REVERSE +#define WA_RIGHT A_RIGHTLINE +#define WA_STANDOUT A_STANDOUT +#define WA_UNDERLINE A_UNDERLINE + +#define WA_HORIZONTAL A_NORMAL +#define WA_LOW A_NORMAL +#define WA_TOP A_NORMAL +#define WA_VERTICAL A_NORMAL + +/*** Alternate character set macros ***/ + +/* 'w' = 32-bit chtype; acs_map[] index | A_ALTCHARSET + 'n' = 16-bit chtype; it gets the fallback set because no bit is + available for A_ALTCHARSET */ + +#ifdef CHTYPE_LONG +# define ACS_PICK(w, n) ((chtype)w | A_ALTCHARSET) +#else +# define ACS_PICK(w, n) ((chtype)n) +#endif + +/* VT100-compatible symbols -- box chars */ + +#define ACS_ULCORNER ACS_PICK('l', '+') +#define ACS_LLCORNER ACS_PICK('m', '+') +#define ACS_URCORNER ACS_PICK('k', '+') +#define ACS_LRCORNER ACS_PICK('j', '+') +#define ACS_RTEE ACS_PICK('u', '+') +#define ACS_LTEE ACS_PICK('t', '+') +#define ACS_BTEE ACS_PICK('v', '+') +#define ACS_TTEE ACS_PICK('w', '+') +#define ACS_HLINE ACS_PICK('q', '-') +#define ACS_VLINE ACS_PICK('x', '|') +#define ACS_PLUS ACS_PICK('n', '+') + +/* VT100-compatible symbols -- other */ + +#define ACS_S1 ACS_PICK('o', '-') +#define ACS_S9 ACS_PICK('s', '_') +#define ACS_DIAMOND ACS_PICK('`', '+') +#define ACS_CKBOARD ACS_PICK('a', ':') +#define ACS_DEGREE ACS_PICK('f', '\'') +#define ACS_PLMINUS ACS_PICK('g', '#') +#define ACS_BULLET ACS_PICK('~', 'o') + +/* Teletype 5410v1 symbols -- these are defined in SysV curses, but + are not well-supported by most terminals. Stick to VT100 characters + for optimum portability. */ + +#define ACS_LARROW ACS_PICK(',', '<') +#define ACS_RARROW ACS_PICK('+', '>') +#define ACS_DARROW ACS_PICK('.', 'v') +#define ACS_UARROW ACS_PICK('-', '^') +#define ACS_BOARD ACS_PICK('h', '#') +#define ACS_LANTERN ACS_PICK('i', '*') +#define ACS_BLOCK ACS_PICK('0', '#') + +/* That goes double for these -- undocumented SysV symbols. Don't use + them. */ + +#define ACS_S3 ACS_PICK('p', '-') +#define ACS_S7 ACS_PICK('r', '-') +#define ACS_LEQUAL ACS_PICK('y', '<') +#define ACS_GEQUAL ACS_PICK('z', '>') +#define ACS_PI ACS_PICK('{', 'n') +#define ACS_NEQUAL ACS_PICK('|', '+') +#define ACS_STERLING ACS_PICK('}', 'L') + +/* Box char aliases */ + +#define ACS_BSSB ACS_ULCORNER +#define ACS_SSBB ACS_LLCORNER +#define ACS_BBSS ACS_URCORNER +#define ACS_SBBS ACS_LRCORNER +#define ACS_SBSS ACS_RTEE +#define ACS_SSSB ACS_LTEE +#define ACS_SSBS ACS_BTEE +#define ACS_BSSS ACS_TTEE +#define ACS_BSBS ACS_HLINE +#define ACS_SBSB ACS_VLINE +#define ACS_SSSS ACS_PLUS + +/* cchar_t aliases */ + +#ifdef PDC_WIDE +# define WACS_ULCORNER (&(acs_map['l'])) +# define WACS_LLCORNER (&(acs_map['m'])) +# define WACS_URCORNER (&(acs_map['k'])) +# define WACS_LRCORNER (&(acs_map['j'])) +# define WACS_RTEE (&(acs_map['u'])) +# define WACS_LTEE (&(acs_map['t'])) +# define WACS_BTEE (&(acs_map['v'])) +# define WACS_TTEE (&(acs_map['w'])) +# define WACS_HLINE (&(acs_map['q'])) +# define WACS_VLINE (&(acs_map['x'])) +# define WACS_PLUS (&(acs_map['n'])) + +# define WACS_S1 (&(acs_map['o'])) +# define WACS_S9 (&(acs_map['s'])) +# define WACS_DIAMOND (&(acs_map['`'])) +# define WACS_CKBOARD (&(acs_map['a'])) +# define WACS_DEGREE (&(acs_map['f'])) +# define WACS_PLMINUS (&(acs_map['g'])) +# define WACS_BULLET (&(acs_map['~'])) + +# define WACS_LARROW (&(acs_map[','])) +# define WACS_RARROW (&(acs_map['+'])) +# define WACS_DARROW (&(acs_map['.'])) +# define WACS_UARROW (&(acs_map['-'])) +# define WACS_BOARD (&(acs_map['h'])) +# define WACS_LANTERN (&(acs_map['i'])) +# define WACS_BLOCK (&(acs_map['0'])) + +# define WACS_S3 (&(acs_map['p'])) +# define WACS_S7 (&(acs_map['r'])) +# define WACS_LEQUAL (&(acs_map['y'])) +# define WACS_GEQUAL (&(acs_map['z'])) +# define WACS_PI (&(acs_map['{'])) +# define WACS_NEQUAL (&(acs_map['|'])) +# define WACS_STERLING (&(acs_map['}'])) + +# define WACS_BSSB WACS_ULCORNER +# define WACS_SSBB WACS_LLCORNER +# define WACS_BBSS WACS_URCORNER +# define WACS_SBBS WACS_LRCORNER +# define WACS_SBSS WACS_RTEE +# define WACS_SSSB WACS_LTEE +# define WACS_SSBS WACS_BTEE +# define WACS_BSSS WACS_TTEE +# define WACS_BSBS WACS_HLINE +# define WACS_SBSB WACS_VLINE +# define WACS_SSSS WACS_PLUS +#endif + +/*** Color macros ***/ + +#define COLOR_BLACK 0 + +#ifdef PDC_RGB /* RGB */ +# define COLOR_RED 1 +# define COLOR_GREEN 2 +# define COLOR_BLUE 4 +#else /* BGR */ +# define COLOR_BLUE 1 +# define COLOR_GREEN 2 +# define COLOR_RED 4 +#endif + +#define COLOR_CYAN (COLOR_BLUE | COLOR_GREEN) +#define COLOR_MAGENTA (COLOR_RED | COLOR_BLUE) +#define COLOR_YELLOW (COLOR_RED | COLOR_GREEN) + +#define COLOR_WHITE 7 + +/*---------------------------------------------------------------------- + * + * Function and Keypad Key Definitions. + * Many are just for compatibility. + * + */ + +#define KEY_CODE_YES 0x100 /* If get_wch() gives a key code */ + +#define KEY_BREAK 0x101 /* Not on PC KBD */ +#define KEY_DOWN 0x102 /* Down arrow key */ +#define KEY_UP 0x103 /* Up arrow key */ +#define KEY_LEFT 0x104 /* Left arrow key */ +#define KEY_RIGHT 0x105 /* Right arrow key */ +#define KEY_HOME 0x106 /* home key */ +#define KEY_BACKSPACE 0x107 /* not on pc */ +#define KEY_F0 0x108 /* function keys; 64 reserved */ + +#define KEY_DL 0x148 /* delete line */ +#define KEY_IL 0x149 /* insert line */ +#define KEY_DC 0x14a /* delete character */ +#define KEY_IC 0x14b /* insert char or enter ins mode */ +#define KEY_EIC 0x14c /* exit insert char mode */ +#define KEY_CLEAR 0x14d /* clear screen */ +#define KEY_EOS 0x14e /* clear to end of screen */ +#define KEY_EOL 0x14f /* clear to end of line */ +#define KEY_SF 0x150 /* scroll 1 line forward */ +#define KEY_SR 0x151 /* scroll 1 line back (reverse) */ +#define KEY_NPAGE 0x152 /* next page */ +#define KEY_PPAGE 0x153 /* previous page */ +#define KEY_STAB 0x154 /* set tab */ +#define KEY_CTAB 0x155 /* clear tab */ +#define KEY_CATAB 0x156 /* clear all tabs */ +#define KEY_ENTER 0x157 /* enter or send (unreliable) */ +#define KEY_SRESET 0x158 /* soft/reset (partial/unreliable) */ +#define KEY_RESET 0x159 /* reset/hard reset (unreliable) */ +#define KEY_PRINT 0x15a /* print/copy */ +#define KEY_LL 0x15b /* home down/bottom (lower left) */ +#define KEY_ABORT 0x15c /* abort/terminate key (any) */ +#define KEY_SHELP 0x15d /* short help */ +#define KEY_LHELP 0x15e /* long help */ +#define KEY_BTAB 0x15f /* Back tab key */ +#define KEY_BEG 0x160 /* beg(inning) key */ +#define KEY_CANCEL 0x161 /* cancel key */ +#define KEY_CLOSE 0x162 /* close key */ +#define KEY_COMMAND 0x163 /* cmd (command) key */ +#define KEY_COPY 0x164 /* copy key */ +#define KEY_CREATE 0x165 /* create key */ +#define KEY_END 0x166 /* end key */ +#define KEY_EXIT 0x167 /* exit key */ +#define KEY_FIND 0x168 /* find key */ +#define KEY_HELP 0x169 /* help key */ +#define KEY_MARK 0x16a /* mark key */ +#define KEY_MESSAGE 0x16b /* message key */ +#define KEY_MOVE 0x16c /* move key */ +#define KEY_NEXT 0x16d /* next object key */ +#define KEY_OPEN 0x16e /* open key */ +#define KEY_OPTIONS 0x16f /* options key */ +#define KEY_PREVIOUS 0x170 /* previous object key */ +#define KEY_REDO 0x171 /* redo key */ +#define KEY_REFERENCE 0x172 /* ref(erence) key */ +#define KEY_REFRESH 0x173 /* refresh key */ +#define KEY_REPLACE 0x174 /* replace key */ +#define KEY_RESTART 0x175 /* restart key */ +#define KEY_RESUME 0x176 /* resume key */ +#define KEY_SAVE 0x177 /* save key */ +#define KEY_SBEG 0x178 /* shifted beginning key */ +#define KEY_SCANCEL 0x179 /* shifted cancel key */ +#define KEY_SCOMMAND 0x17a /* shifted command key */ +#define KEY_SCOPY 0x17b /* shifted copy key */ +#define KEY_SCREATE 0x17c /* shifted create key */ +#define KEY_SDC 0x17d /* shifted delete char key */ +#define KEY_SDL 0x17e /* shifted delete line key */ +#define KEY_SELECT 0x17f /* select key */ +#define KEY_SEND 0x180 /* shifted end key */ +#define KEY_SEOL 0x181 /* shifted clear line key */ +#define KEY_SEXIT 0x182 /* shifted exit key */ +#define KEY_SFIND 0x183 /* shifted find key */ +#define KEY_SHOME 0x184 /* shifted home key */ +#define KEY_SIC 0x185 /* shifted input key */ + +#define KEY_SLEFT 0x187 /* shifted left arrow key */ +#define KEY_SMESSAGE 0x188 /* shifted message key */ +#define KEY_SMOVE 0x189 /* shifted move key */ +#define KEY_SNEXT 0x18a /* shifted next key */ +#define KEY_SOPTIONS 0x18b /* shifted options key */ +#define KEY_SPREVIOUS 0x18c /* shifted prev key */ +#define KEY_SPRINT 0x18d /* shifted print key */ +#define KEY_SREDO 0x18e /* shifted redo key */ +#define KEY_SREPLACE 0x18f /* shifted replace key */ +#define KEY_SRIGHT 0x190 /* shifted right arrow */ +#define KEY_SRSUME 0x191 /* shifted resume key */ +#define KEY_SSAVE 0x192 /* shifted save key */ +#define KEY_SSUSPEND 0x193 /* shifted suspend key */ +#define KEY_SUNDO 0x194 /* shifted undo key */ +#define KEY_SUSPEND 0x195 /* suspend key */ +#define KEY_UNDO 0x196 /* undo key */ + +/* PDCurses-specific key definitions -- PC only */ + +#define ALT_0 0x197 +#define ALT_1 0x198 +#define ALT_2 0x199 +#define ALT_3 0x19a +#define ALT_4 0x19b +#define ALT_5 0x19c +#define ALT_6 0x19d +#define ALT_7 0x19e +#define ALT_8 0x19f +#define ALT_9 0x1a0 +#define ALT_A 0x1a1 +#define ALT_B 0x1a2 +#define ALT_C 0x1a3 +#define ALT_D 0x1a4 +#define ALT_E 0x1a5 +#define ALT_F 0x1a6 +#define ALT_G 0x1a7 +#define ALT_H 0x1a8 +#define ALT_I 0x1a9 +#define ALT_J 0x1aa +#define ALT_K 0x1ab +#define ALT_L 0x1ac +#define ALT_M 0x1ad +#define ALT_N 0x1ae +#define ALT_O 0x1af +#define ALT_P 0x1b0 +#define ALT_Q 0x1b1 +#define ALT_R 0x1b2 +#define ALT_S 0x1b3 +#define ALT_T 0x1b4 +#define ALT_U 0x1b5 +#define ALT_V 0x1b6 +#define ALT_W 0x1b7 +#define ALT_X 0x1b8 +#define ALT_Y 0x1b9 +#define ALT_Z 0x1ba + +#define CTL_LEFT 0x1bb /* Control-Left-Arrow */ +#define CTL_RIGHT 0x1bc +#define CTL_PGUP 0x1bd +#define CTL_PGDN 0x1be +#define CTL_HOME 0x1bf +#define CTL_END 0x1c0 + +#define KEY_A1 0x1c1 /* upper left on Virtual keypad */ +#define KEY_A2 0x1c2 /* upper middle on Virt. keypad */ +#define KEY_A3 0x1c3 /* upper right on Vir. keypad */ +#define KEY_B1 0x1c4 /* middle left on Virt. keypad */ +#define KEY_B2 0x1c5 /* center on Virt. keypad */ +#define KEY_B3 0x1c6 /* middle right on Vir. keypad */ +#define KEY_C1 0x1c7 /* lower left on Virt. keypad */ +#define KEY_C2 0x1c8 /* lower middle on Virt. keypad */ +#define KEY_C3 0x1c9 /* lower right on Vir. keypad */ + +#define PADSLASH 0x1ca /* slash on keypad */ +#define PADENTER 0x1cb /* enter on keypad */ +#define CTL_PADENTER 0x1cc /* ctl-enter on keypad */ +#define ALT_PADENTER 0x1cd /* alt-enter on keypad */ +#define PADSTOP 0x1ce /* stop on keypad */ +#define PADSTAR 0x1cf /* star on keypad */ +#define PADMINUS 0x1d0 /* minus on keypad */ +#define PADPLUS 0x1d1 /* plus on keypad */ +#define CTL_PADSTOP 0x1d2 /* ctl-stop on keypad */ +#define CTL_PADCENTER 0x1d3 /* ctl-enter on keypad */ +#define CTL_PADPLUS 0x1d4 /* ctl-plus on keypad */ +#define CTL_PADMINUS 0x1d5 /* ctl-minus on keypad */ +#define CTL_PADSLASH 0x1d6 /* ctl-slash on keypad */ +#define CTL_PADSTAR 0x1d7 /* ctl-star on keypad */ +#define ALT_PADPLUS 0x1d8 /* alt-plus on keypad */ +#define ALT_PADMINUS 0x1d9 /* alt-minus on keypad */ +#define ALT_PADSLASH 0x1da /* alt-slash on keypad */ +#define ALT_PADSTAR 0x1db /* alt-star on keypad */ +#define ALT_PADSTOP 0x1dc /* alt-stop on keypad */ +#define CTL_INS 0x1dd /* ctl-insert */ +#define ALT_DEL 0x1de /* alt-delete */ +#define ALT_INS 0x1df /* alt-insert */ +#define CTL_UP 0x1e0 /* ctl-up arrow */ +#define CTL_DOWN 0x1e1 /* ctl-down arrow */ +#define CTL_TAB 0x1e2 /* ctl-tab */ +#define ALT_TAB 0x1e3 +#define ALT_MINUS 0x1e4 +#define ALT_EQUAL 0x1e5 +#define ALT_HOME 0x1e6 +#define ALT_PGUP 0x1e7 +#define ALT_PGDN 0x1e8 +#define ALT_END 0x1e9 +#define ALT_UP 0x1ea /* alt-up arrow */ +#define ALT_DOWN 0x1eb /* alt-down arrow */ +#define ALT_RIGHT 0x1ec /* alt-right arrow */ +#define ALT_LEFT 0x1ed /* alt-left arrow */ +#define ALT_ENTER 0x1ee /* alt-enter */ +#define ALT_ESC 0x1ef /* alt-escape */ +#define ALT_BQUOTE 0x1f0 /* alt-back quote */ +#define ALT_LBRACKET 0x1f1 /* alt-left bracket */ +#define ALT_RBRACKET 0x1f2 /* alt-right bracket */ +#define ALT_SEMICOLON 0x1f3 /* alt-semi-colon */ +#define ALT_FQUOTE 0x1f4 /* alt-forward quote */ +#define ALT_COMMA 0x1f5 /* alt-comma */ +#define ALT_STOP 0x1f6 /* alt-stop */ +#define ALT_FSLASH 0x1f7 /* alt-forward slash */ +#define ALT_BKSP 0x1f8 /* alt-backspace */ +#define CTL_BKSP 0x1f9 /* ctl-backspace */ +#define PAD0 0x1fa /* keypad 0 */ + +#define CTL_PAD0 0x1fb /* ctl-keypad 0 */ +#define CTL_PAD1 0x1fc +#define CTL_PAD2 0x1fd +#define CTL_PAD3 0x1fe +#define CTL_PAD4 0x1ff +#define CTL_PAD5 0x200 +#define CTL_PAD6 0x201 +#define CTL_PAD7 0x202 +#define CTL_PAD8 0x203 +#define CTL_PAD9 0x204 + +#define ALT_PAD0 0x205 /* alt-keypad 0 */ +#define ALT_PAD1 0x206 +#define ALT_PAD2 0x207 +#define ALT_PAD3 0x208 +#define ALT_PAD4 0x209 +#define ALT_PAD5 0x20a +#define ALT_PAD6 0x20b +#define ALT_PAD7 0x20c +#define ALT_PAD8 0x20d +#define ALT_PAD9 0x20e + +#define CTL_DEL 0x20f /* clt-delete */ +#define ALT_BSLASH 0x210 /* alt-back slash */ +#define CTL_ENTER 0x211 /* ctl-enter */ + +#define SHF_PADENTER 0x212 /* shift-enter on keypad */ +#define SHF_PADSLASH 0x213 /* shift-slash on keypad */ +#define SHF_PADSTAR 0x214 /* shift-star on keypad */ +#define SHF_PADPLUS 0x215 /* shift-plus on keypad */ +#define SHF_PADMINUS 0x216 /* shift-minus on keypad */ +#define SHF_UP 0x217 /* shift-up on keypad */ +#define SHF_DOWN 0x218 /* shift-down on keypad */ +#define SHF_IC 0x219 /* shift-insert on keypad */ +#define SHF_DC 0x21a /* shift-delete on keypad */ + +#define KEY_MOUSE 0x21b /* "mouse" key */ +#define KEY_SHIFT_L 0x21c /* Left-shift */ +#define KEY_SHIFT_R 0x21d /* Right-shift */ +#define KEY_CONTROL_L 0x21e /* Left-control */ +#define KEY_CONTROL_R 0x21f /* Right-control */ +#define KEY_ALT_L 0x220 /* Left-alt */ +#define KEY_ALT_R 0x221 /* Right-alt */ +#define KEY_RESIZE 0x222 /* Window resize */ +#define KEY_SUP 0x223 /* Shifted up arrow */ +#define KEY_SDOWN 0x224 /* Shifted down arrow */ + +#define KEY_MIN KEY_BREAK /* Minimum curses key value */ +#define KEY_MAX KEY_SDOWN /* Maximum curses key */ + +#define KEY_F(n) (KEY_F0 + (n)) + +/*---------------------------------------------------------------------- + * + * PDCurses Function Declarations + * + */ + +/* Standard */ + +int addch(const chtype); +int addchnstr(const chtype *, int); +int addchstr(const chtype *); +int addnstr(const char *, int); +int addstr(const char *); +int attroff(chtype); +int attron(chtype); +int attrset(chtype); +int attr_get(attr_t *, short *, void *); +int attr_off(attr_t, void *); +int attr_on(attr_t, void *); +int attr_set(attr_t, short, void *); +int baudrate(void); +int beep(void); +int bkgd(chtype); +void bkgdset(chtype); +int border(chtype, chtype, chtype, chtype, chtype, chtype, chtype, chtype); +int box(WINDOW *, chtype, chtype); +bool can_change_color(void); +int cbreak(void); +int chgat(int, attr_t, short, const void *); +int clearok(WINDOW *, bool); +int clear(void); +int clrtobot(void); +int clrtoeol(void); +int color_content(short, short *, short *, short *); +int color_set(short, void *); +int copywin(const WINDOW *, WINDOW *, int, int, int, int, int, int, int); +int curs_set(int); +int def_prog_mode(void); +int def_shell_mode(void); +int delay_output(int); +int delch(void); +int deleteln(void); +void delscreen(SCREEN *); +int delwin(WINDOW *); +WINDOW *derwin(WINDOW *, int, int, int, int); +int doupdate(void); +WINDOW *dupwin(WINDOW *); +int echochar(const chtype); +int echo(void); +int endwin(void); +char erasechar(void); +int erase(void); +void filter(void); +int flash(void); +int flushinp(void); +chtype getbkgd(WINDOW *); +int getnstr(char *, int); +int getstr(char *); +WINDOW *getwin(FILE *); +int halfdelay(int); +bool has_colors(void); +bool has_ic(void); +bool has_il(void); +int hline(chtype, int); +void idcok(WINDOW *, bool); +int idlok(WINDOW *, bool); +void immedok(WINDOW *, bool); +int inchnstr(chtype *, int); +int inchstr(chtype *); +chtype inch(void); +int init_color(short, short, short, short); +int init_pair(short, short, short); +WINDOW *initscr(void); +int innstr(char *, int); +int insch(chtype); +int insdelln(int); +int insertln(void); +int insnstr(const char *, int); +int insstr(const char *); +int instr(char *); +int intrflush(WINDOW *, bool); +bool isendwin(void); +bool is_linetouched(WINDOW *, int); +bool is_wintouched(WINDOW *); +char *keyname(int); +int keypad(WINDOW *, bool); +char killchar(void); +int leaveok(WINDOW *, bool); +char *longname(void); +int meta(WINDOW *, bool); +int move(int, int); +int mvaddch(int, int, const chtype); +int mvaddchnstr(int, int, const chtype *, int); +int mvaddchstr(int, int, const chtype *); +int mvaddnstr(int, int, const char *, int); +int mvaddstr(int, int, const char *); +int mvchgat(int, int, int, attr_t, short, const void *); +int mvcur(int, int, int, int); +int mvdelch(int, int); +int mvderwin(WINDOW *, int, int); +int mvgetch(int, int); +int mvgetnstr(int, int, char *, int); +int mvgetstr(int, int, char *); +int mvhline(int, int, chtype, int); +chtype mvinch(int, int); +int mvinchnstr(int, int, chtype *, int); +int mvinchstr(int, int, chtype *); +int mvinnstr(int, int, char *, int); +int mvinsch(int, int, chtype); +int mvinsnstr(int, int, const char *, int); +int mvinsstr(int, int, const char *); +int mvinstr(int, int, char *); +int mvprintw(int, int, const char *, ...); +int mvscanw(int, int, const char *, ...); +int mvvline(int, int, chtype, int); +int mvwaddchnstr(WINDOW *, int, int, const chtype *, int); +int mvwaddchstr(WINDOW *, int, int, const chtype *); +int mvwaddch(WINDOW *, int, int, const chtype); +int mvwaddnstr(WINDOW *, int, int, const char *, int); +int mvwaddstr(WINDOW *, int, int, const char *); +int mvwchgat(WINDOW *, int, int, int, attr_t, short, const void *); +int mvwdelch(WINDOW *, int, int); +int mvwgetch(WINDOW *, int, int); +int mvwgetnstr(WINDOW *, int, int, char *, int); +int mvwgetstr(WINDOW *, int, int, char *); +int mvwhline(WINDOW *, int, int, chtype, int); +int mvwinchnstr(WINDOW *, int, int, chtype *, int); +int mvwinchstr(WINDOW *, int, int, chtype *); +chtype mvwinch(WINDOW *, int, int); +int mvwinnstr(WINDOW *, int, int, char *, int); +int mvwinsch(WINDOW *, int, int, chtype); +int mvwinsnstr(WINDOW *, int, int, const char *, int); +int mvwinsstr(WINDOW *, int, int, const char *); +int mvwinstr(WINDOW *, int, int, char *); +int mvwin(WINDOW *, int, int); +int mvwprintw(WINDOW *, int, int, const char *, ...); +int mvwscanw(WINDOW *, int, int, const char *, ...); +int mvwvline(WINDOW *, int, int, chtype, int); +int napms(int); +WINDOW *newpad(int, int); +SCREEN *newterm(const char *, FILE *, FILE *); +WINDOW *newwin(int, int, int, int); +int nl(void); +int nocbreak(void); +int nodelay(WINDOW *, bool); +int noecho(void); +int nonl(void); +void noqiflush(void); +int noraw(void); +int notimeout(WINDOW *, bool); +int overlay(const WINDOW *, WINDOW *); +int overwrite(const WINDOW *, WINDOW *); +int pair_content(short, short *, short *); +int pechochar(WINDOW *, chtype); +int pnoutrefresh(WINDOW *, int, int, int, int, int, int); +int prefresh(WINDOW *, int, int, int, int, int, int); +int printw(const char *, ...); +int putwin(WINDOW *, FILE *); +void qiflush(void); +int raw(void); +int redrawwin(WINDOW *); +int refresh(void); +int reset_prog_mode(void); +int reset_shell_mode(void); +int resetty(void); +int ripoffline(int, int (*)(WINDOW *, int)); +int savetty(void); +int scanw(const char *, ...); +int scr_dump(const char *); +int scr_init(const char *); +int scr_restore(const char *); +int scr_set(const char *); +int scrl(int); +int scroll(WINDOW *); +int scrollok(WINDOW *, bool); +SCREEN *set_term(SCREEN *); +int setscrreg(int, int); +int slk_attroff(const chtype); +int slk_attr_off(const attr_t, void *); +int slk_attron(const chtype); +int slk_attr_on(const attr_t, void *); +int slk_attrset(const chtype); +int slk_attr_set(const attr_t, short, void *); +int slk_clear(void); +int slk_color(short); +int slk_init(int); +char *slk_label(int); +int slk_noutrefresh(void); +int slk_refresh(void); +int slk_restore(void); +int slk_set(int, const char *, int); +int slk_touch(void); +int standend(void); +int standout(void); +int start_color(void); +WINDOW *subpad(WINDOW *, int, int, int, int); +WINDOW *subwin(WINDOW *, int, int, int, int); +int syncok(WINDOW *, bool); +chtype termattrs(void); +attr_t term_attrs(void); +char *termname(void); +void timeout(int); +int touchline(WINDOW *, int, int); +int touchwin(WINDOW *); +int typeahead(int); +int untouchwin(WINDOW *); +void use_env(bool); +int vidattr(chtype); +int vid_attr(attr_t, short, void *); +int vidputs(chtype, int (*)(int)); +int vid_puts(attr_t, short, void *, int (*)(int)); +int vline(chtype, int); +int vw_printw(WINDOW *, const char *, va_list); +int vwprintw(WINDOW *, const char *, va_list); +int vw_scanw(WINDOW *, const char *, va_list); +int vwscanw(WINDOW *, const char *, va_list); +int waddchnstr(WINDOW *, const chtype *, int); +int waddchstr(WINDOW *, const chtype *); +int waddch(WINDOW *, const chtype); +int waddnstr(WINDOW *, const char *, int); +int waddstr(WINDOW *, const char *); +int wattroff(WINDOW *, chtype); +int wattron(WINDOW *, chtype); +int wattrset(WINDOW *, chtype); +int wattr_get(WINDOW *, attr_t *, short *, void *); +int wattr_off(WINDOW *, attr_t, void *); +int wattr_on(WINDOW *, attr_t, void *); +int wattr_set(WINDOW *, attr_t, short, void *); +void wbkgdset(WINDOW *, chtype); +int wbkgd(WINDOW *, chtype); +int wborder(WINDOW *, chtype, chtype, chtype, chtype, + chtype, chtype, chtype, chtype); +int wchgat(WINDOW *, int, attr_t, short, const void *); +int wclear(WINDOW *); +int wclrtobot(WINDOW *); +int wclrtoeol(WINDOW *); +int wcolor_set(WINDOW *, short, void *); +void wcursyncup(WINDOW *); +int wdelch(WINDOW *); +int wdeleteln(WINDOW *); +int wechochar(WINDOW *, const chtype); +int werase(WINDOW *); +int wgetch(WINDOW *); +int wgetnstr(WINDOW *, char *, int); +int wgetstr(WINDOW *, char *); +int whline(WINDOW *, chtype, int); +int winchnstr(WINDOW *, chtype *, int); +int winchstr(WINDOW *, chtype *); +chtype winch(WINDOW *); +int winnstr(WINDOW *, char *, int); +int winsch(WINDOW *, chtype); +int winsdelln(WINDOW *, int); +int winsertln(WINDOW *); +int winsnstr(WINDOW *, const char *, int); +int winsstr(WINDOW *, const char *); +int winstr(WINDOW *, char *); +int wmove(WINDOW *, int, int); +int wnoutrefresh(WINDOW *); +int wprintw(WINDOW *, const char *, ...); +int wredrawln(WINDOW *, int, int); +int wrefresh(WINDOW *); +int wscanw(WINDOW *, const char *, ...); +int wscrl(WINDOW *, int); +int wsetscrreg(WINDOW *, int, int); +int wstandend(WINDOW *); +int wstandout(WINDOW *); +void wsyncdown(WINDOW *); +void wsyncup(WINDOW *); +void wtimeout(WINDOW *, int); +int wtouchln(WINDOW *, int, int, int); +int wvline(WINDOW *, chtype, int); + +/* Wide-character functions */ + +#ifdef PDC_WIDE +int addnwstr(const wchar_t *, int); +int addwstr(const wchar_t *); +int add_wch(const cchar_t *); +int add_wchnstr(const cchar_t *, int); +int add_wchstr(const cchar_t *); +int border_set(const cchar_t *, const cchar_t *, const cchar_t *, + const cchar_t *, const cchar_t *, const cchar_t *, + const cchar_t *, const cchar_t *); +int box_set(WINDOW *, const cchar_t *, const cchar_t *); +int echo_wchar(const cchar_t *); +int erasewchar(wchar_t *); +int getbkgrnd(cchar_t *); +int getcchar(const cchar_t *, wchar_t *, attr_t *, short *, void *); +int getn_wstr(wint_t *, int); +int get_wch(wint_t *); +int get_wstr(wint_t *); +int hline_set(const cchar_t *, int); +int innwstr(wchar_t *, int); +int ins_nwstr(const wchar_t *, int); +int ins_wch(const cchar_t *); +int ins_wstr(const wchar_t *); +int inwstr(wchar_t *); +int in_wch(cchar_t *); +int in_wchnstr(cchar_t *, int); +int in_wchstr(cchar_t *); +char *key_name(wchar_t); +int killwchar(wchar_t *); +int mvaddnwstr(int, int, const wchar_t *, int); +int mvaddwstr(int, int, const wchar_t *); +int mvadd_wch(int, int, const cchar_t *); +int mvadd_wchnstr(int, int, const cchar_t *, int); +int mvadd_wchstr(int, int, const cchar_t *); +int mvgetn_wstr(int, int, wint_t *, int); +int mvget_wch(int, int, wint_t *); +int mvget_wstr(int, int, wint_t *); +int mvhline_set(int, int, const cchar_t *, int); +int mvinnwstr(int, int, wchar_t *, int); +int mvins_nwstr(int, int, const wchar_t *, int); +int mvins_wch(int, int, const cchar_t *); +int mvins_wstr(int, int, const wchar_t *); +int mvinwstr(int, int, wchar_t *); +int mvin_wch(int, int, cchar_t *); +int mvin_wchnstr(int, int, cchar_t *, int); +int mvin_wchstr(int, int, cchar_t *); +int mvvline_set(int, int, const cchar_t *, int); +int mvwaddnwstr(WINDOW *, int, int, const wchar_t *, int); +int mvwaddwstr(WINDOW *, int, int, const wchar_t *); +int mvwadd_wch(WINDOW *, int, int, const cchar_t *); +int mvwadd_wchnstr(WINDOW *, int, int, const cchar_t *, int); +int mvwadd_wchstr(WINDOW *, int, int, const cchar_t *); +int mvwgetn_wstr(WINDOW *, int, int, wint_t *, int); +int mvwget_wch(WINDOW *, int, int, wint_t *); +int mvwget_wstr(WINDOW *, int, int, wint_t *); +int mvwhline_set(WINDOW *, int, int, const cchar_t *, int); +int mvwinnwstr(WINDOW *, int, int, wchar_t *, int); +int mvwins_nwstr(WINDOW *, int, int, const wchar_t *, int); +int mvwins_wch(WINDOW *, int, int, const cchar_t *); +int mvwins_wstr(WINDOW *, int, int, const wchar_t *); +int mvwin_wch(WINDOW *, int, int, cchar_t *); +int mvwin_wchnstr(WINDOW *, int, int, cchar_t *, int); +int mvwin_wchstr(WINDOW *, int, int, cchar_t *); +int mvwinwstr(WINDOW *, int, int, wchar_t *); +int mvwvline_set(WINDOW *, int, int, const cchar_t *, int); +int pecho_wchar(WINDOW *, const cchar_t*); +int setcchar(cchar_t*, const wchar_t*, const attr_t, short, const void*); +int slk_wset(int, const wchar_t *, int); +int unget_wch(const wchar_t); +int vline_set(const cchar_t *, int); +int waddnwstr(WINDOW *, const wchar_t *, int); +int waddwstr(WINDOW *, const wchar_t *); +int wadd_wch(WINDOW *, const cchar_t *); +int wadd_wchnstr(WINDOW *, const cchar_t *, int); +int wadd_wchstr(WINDOW *, const cchar_t *); +int wbkgrnd(WINDOW *, const cchar_t *); +void wbkgrndset(WINDOW *, const cchar_t *); +int wborder_set(WINDOW *, const cchar_t *, const cchar_t *, + const cchar_t *, const cchar_t *, const cchar_t *, + const cchar_t *, const cchar_t *, const cchar_t *); +int wecho_wchar(WINDOW *, const cchar_t *); +int wgetbkgrnd(WINDOW *, cchar_t *); +int wgetn_wstr(WINDOW *, wint_t *, int); +int wget_wch(WINDOW *, wint_t *); +int wget_wstr(WINDOW *, wint_t *); +int whline_set(WINDOW *, const cchar_t *, int); +int winnwstr(WINDOW *, wchar_t *, int); +int wins_nwstr(WINDOW *, const wchar_t *, int); +int wins_wch(WINDOW *, const cchar_t *); +int wins_wstr(WINDOW *, const wchar_t *); +int winwstr(WINDOW *, wchar_t *); +int win_wch(WINDOW *, cchar_t *); +int win_wchnstr(WINDOW *, cchar_t *, int); +int win_wchstr(WINDOW *, cchar_t *); +wchar_t *wunctrl(cchar_t *); +int wvline_set(WINDOW *, const cchar_t *, int); +#endif + +/* Quasi-standard */ + +chtype getattrs(WINDOW *); +int getbegx(WINDOW *); +int getbegy(WINDOW *); +int getmaxx(WINDOW *); +int getmaxy(WINDOW *); +int getparx(WINDOW *); +int getpary(WINDOW *); +int getcurx(WINDOW *); +int getcury(WINDOW *); +void traceoff(void); +void traceon(void); +char *unctrl(chtype); + +int crmode(void); +int nocrmode(void); +int draino(int); +int resetterm(void); +int fixterm(void); +int saveterm(void); +int setsyx(int, int); + +int mouse_set(unsigned long); +int mouse_on(unsigned long); +int mouse_off(unsigned long); +int request_mouse_pos(void); +int map_button(unsigned long); +void wmouse_position(WINDOW *, int *, int *); +unsigned long getmouse(void); +unsigned long getbmap(void); + +/* ncurses */ + +int assume_default_colors(int, int); +const char *curses_version(void); +bool has_key(int); +int use_default_colors(void); +int wresize(WINDOW *, int, int); + +int mouseinterval(int); +mmask_t mousemask(mmask_t, mmask_t *); +bool mouse_trafo(int *, int *, bool); +int nc_getmouse(MEVENT *); +int ungetmouse(MEVENT *); +bool wenclose(const WINDOW *, int, int); +bool wmouse_trafo(const WINDOW *, int *, int *, bool); + +/* PDCurses */ + +int addrawch(chtype); +int insrawch(chtype); +bool is_termresized(void); +int mvaddrawch(int, int, chtype); +int mvdeleteln(int, int); +int mvinsertln(int, int); +int mvinsrawch(int, int, chtype); +int mvwaddrawch(WINDOW *, int, int, chtype); +int mvwdeleteln(WINDOW *, int, int); +int mvwinsertln(WINDOW *, int, int); +int mvwinsrawch(WINDOW *, int, int, chtype); +int raw_output(bool); +int resize_term(int, int); +WINDOW *resize_window(WINDOW *, int, int); +int waddrawch(WINDOW *, chtype); +int winsrawch(WINDOW *, chtype); +char wordchar(void); + +#ifdef PDC_WIDE +wchar_t *slk_wlabel(int); +#endif + +void PDC_debug(const char *, ...); +int PDC_ungetch(int); +int PDC_set_blink(bool); +int PDC_set_line_color(short); +void PDC_set_title(const char *); + +int PDC_clearclipboard(void); +int PDC_freeclipboard(char *); +int PDC_getclipboard(char **, long *); +int PDC_setclipboard(const char *, long); + +unsigned long PDC_get_input_fd(void); +unsigned long PDC_get_key_modifiers(void); +int PDC_return_key_modifiers(bool); +int PDC_save_key_modifiers(bool); + +#ifdef XCURSES +WINDOW *Xinitscr(int, char **); +void XCursesExit(void); +int sb_init(void); +int sb_set_horz(int, int, int); +int sb_set_vert(int, int, int); +int sb_get_horz(int *, int *, int *); +int sb_get_vert(int *, int *, int *); +int sb_refresh(void); +#endif + +/*** Functions defined as macros ***/ + +/* getch() and ungetch() conflict with some DOS libraries */ + +#define getch() wgetch(stdscr) +#define ungetch(ch) PDC_ungetch(ch) + +#define COLOR_PAIR(n) (((chtype)(n) << PDC_COLOR_SHIFT) & A_COLOR) +#define PAIR_NUMBER(n) (((n) & A_COLOR) >> PDC_COLOR_SHIFT) + +/* These will _only_ work as macros */ + +#define getbegyx(w, y, x) (y = getbegy(w), x = getbegx(w)) +#define getmaxyx(w, y, x) (y = getmaxy(w), x = getmaxx(w)) +#define getparyx(w, y, x) (y = getpary(w), x = getparx(w)) +#define getyx(w, y, x) (y = getcury(w), x = getcurx(w)) + +#define getsyx(y, x) { if (curscr->_leaveit) (y)=(x)=-1; \ + else getyx(curscr,(y),(x)); } + +#ifdef NCURSES_MOUSE_VERSION +# define getmouse(x) nc_getmouse(x) +#endif + +/* return codes from PDC_getclipboard() and PDC_setclipboard() calls */ + +#define PDC_CLIP_SUCCESS 0 +#define PDC_CLIP_ACCESS_ERROR 1 +#define PDC_CLIP_EMPTY 2 +#define PDC_CLIP_MEMORY_ERROR 3 + +/* PDCurses key modifier masks */ + +#define PDC_KEY_MODIFIER_SHIFT 1 +#define PDC_KEY_MODIFIER_CONTROL 2 +#define PDC_KEY_MODIFIER_ALT 4 +#define PDC_KEY_MODIFIER_NUMLOCK 8 + +#if defined(__cplusplus) || defined(__cplusplus__) || defined(__CPLUSPLUS) +# undef bool +} +#endif + +#endif /* __PDCURSES__ */
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/SNV/SNVMix2_source/SNVMix2-v0.12.1-rc1/samtools-0.1.6/win32/zconf.h Wed Oct 12 19:50:38 2011 -0400 @@ -0,0 +1,332 @@ +/* zconf.h -- configuration of the zlib compression library + * Copyright (C) 1995-2005 Jean-loup Gailly. + * For conditions of distribution and use, see copyright notice in zlib.h + */ + +/* @(#) $Id$ */ + +#ifndef ZCONF_H +#define ZCONF_H + +/* + * If you *really* need a unique prefix for all types and library functions, + * compile with -DZ_PREFIX. The "standard" zlib should be compiled without it. + */ +#ifdef Z_PREFIX +# define deflateInit_ z_deflateInit_ +# define deflate z_deflate +# define deflateEnd z_deflateEnd +# define inflateInit_ z_inflateInit_ +# define inflate z_inflate +# define inflateEnd z_inflateEnd +# define deflateInit2_ z_deflateInit2_ +# define deflateSetDictionary z_deflateSetDictionary +# define deflateCopy z_deflateCopy +# define deflateReset z_deflateReset +# define deflateParams z_deflateParams +# define deflateBound z_deflateBound +# define deflatePrime z_deflatePrime +# define inflateInit2_ z_inflateInit2_ +# define inflateSetDictionary z_inflateSetDictionary +# define inflateSync z_inflateSync +# define inflateSyncPoint z_inflateSyncPoint +# define inflateCopy z_inflateCopy +# define inflateReset z_inflateReset +# define inflateBack z_inflateBack +# define inflateBackEnd z_inflateBackEnd +# define compress z_compress +# define compress2 z_compress2 +# define compressBound z_compressBound +# define uncompress z_uncompress +# define adler32 z_adler32 +# define crc32 z_crc32 +# define get_crc_table z_get_crc_table +# define zError z_zError + +# define alloc_func z_alloc_func +# define free_func z_free_func +# define in_func z_in_func +# define out_func z_out_func +# define Byte z_Byte +# define uInt z_uInt +# define uLong z_uLong +# define Bytef z_Bytef +# define charf z_charf +# define intf z_intf +# define uIntf z_uIntf +# define uLongf z_uLongf +# define voidpf z_voidpf +# define voidp z_voidp +#endif + +#if defined(__MSDOS__) && !defined(MSDOS) +# define MSDOS +#endif +#if (defined(OS_2) || defined(__OS2__)) && !defined(OS2) +# define OS2 +#endif +#if defined(_WINDOWS) && !defined(WINDOWS) +# define WINDOWS +#endif +#if defined(_WIN32) || defined(_WIN32_WCE) || defined(__WIN32__) +# ifndef WIN32 +# define WIN32 +# endif +#endif +#if (defined(MSDOS) || defined(OS2) || defined(WINDOWS)) && !defined(WIN32) +# if !defined(__GNUC__) && !defined(__FLAT__) && !defined(__386__) +# ifndef SYS16BIT +# define SYS16BIT +# endif +# endif +#endif + +/* + * Compile with -DMAXSEG_64K if the alloc function cannot allocate more + * than 64k bytes at a time (needed on systems with 16-bit int). + */ +#ifdef SYS16BIT +# define MAXSEG_64K +#endif +#ifdef MSDOS +# define UNALIGNED_OK +#endif + +#ifdef __STDC_VERSION__ +# ifndef STDC +# define STDC +# endif +# if __STDC_VERSION__ >= 199901L +# ifndef STDC99 +# define STDC99 +# endif +# endif +#endif +#if !defined(STDC) && (defined(__STDC__) || defined(__cplusplus)) +# define STDC +#endif +#if !defined(STDC) && (defined(__GNUC__) || defined(__BORLANDC__)) +# define STDC +#endif +#if !defined(STDC) && (defined(MSDOS) || defined(WINDOWS) || defined(WIN32)) +# define STDC +#endif +#if !defined(STDC) && (defined(OS2) || defined(__HOS_AIX__)) +# define STDC +#endif + +#if defined(__OS400__) && !defined(STDC) /* iSeries (formerly AS/400). */ +# define STDC +#endif + +#ifndef STDC +# ifndef const /* cannot use !defined(STDC) && !defined(const) on Mac */ +# define const /* note: need a more gentle solution here */ +# endif +#endif + +/* Some Mac compilers merge all .h files incorrectly: */ +#if defined(__MWERKS__)||defined(applec)||defined(THINK_C)||defined(__SC__) +# define NO_DUMMY_DECL +#endif + +/* Maximum value for memLevel in deflateInit2 */ +#ifndef MAX_MEM_LEVEL +# ifdef MAXSEG_64K +# define MAX_MEM_LEVEL 8 +# else +# define MAX_MEM_LEVEL 9 +# endif +#endif + +/* Maximum value for windowBits in deflateInit2 and inflateInit2. + * WARNING: reducing MAX_WBITS makes minigzip unable to extract .gz files + * created by gzip. (Files created by minigzip can still be extracted by + * gzip.) + */ +#ifndef MAX_WBITS +# define MAX_WBITS 15 /* 32K LZ77 window */ +#endif + +/* The memory requirements for deflate are (in bytes): + (1 << (windowBits+2)) + (1 << (memLevel+9)) + that is: 128K for windowBits=15 + 128K for memLevel = 8 (default values) + plus a few kilobytes for small objects. For example, if you want to reduce + the default memory requirements from 256K to 128K, compile with + make CFLAGS="-O -DMAX_WBITS=14 -DMAX_MEM_LEVEL=7" + Of course this will generally degrade compression (there's no free lunch). + + The memory requirements for inflate are (in bytes) 1 << windowBits + that is, 32K for windowBits=15 (default value) plus a few kilobytes + for small objects. +*/ + + /* Type declarations */ + +#ifndef OF /* function prototypes */ +# ifdef STDC +# define OF(args) args +# else +# define OF(args) () +# endif +#endif + +/* The following definitions for FAR are needed only for MSDOS mixed + * model programming (small or medium model with some far allocations). + * This was tested only with MSC; for other MSDOS compilers you may have + * to define NO_MEMCPY in zutil.h. If you don't need the mixed model, + * just define FAR to be empty. + */ +#ifdef SYS16BIT +# if defined(M_I86SM) || defined(M_I86MM) + /* MSC small or medium model */ +# define SMALL_MEDIUM +# ifdef _MSC_VER +# define FAR _far +# else +# define FAR far +# endif +# endif +# if (defined(__SMALL__) || defined(__MEDIUM__)) + /* Turbo C small or medium model */ +# define SMALL_MEDIUM +# ifdef __BORLANDC__ +# define FAR _far +# else +# define FAR far +# endif +# endif +#endif + +#if defined(WINDOWS) || defined(WIN32) + /* If building or using zlib as a DLL, define ZLIB_DLL. + * This is not mandatory, but it offers a little performance increase. + */ +# ifdef ZLIB_DLL +# if defined(WIN32) && (!defined(__BORLANDC__) || (__BORLANDC__ >= 0x500)) +# ifdef ZLIB_INTERNAL +# define ZEXTERN extern __declspec(dllexport) +# else +# define ZEXTERN extern __declspec(dllimport) +# endif +# endif +# endif /* ZLIB_DLL */ + /* If building or using zlib with the WINAPI/WINAPIV calling convention, + * define ZLIB_WINAPI. + * Caution: the standard ZLIB1.DLL is NOT compiled using ZLIB_WINAPI. + */ +# ifdef ZLIB_WINAPI +# ifdef FAR +# undef FAR +# endif +# include <windows.h> + /* No need for _export, use ZLIB.DEF instead. */ + /* For complete Windows compatibility, use WINAPI, not __stdcall. */ +# define ZEXPORT WINAPI +# ifdef WIN32 +# define ZEXPORTVA WINAPIV +# else +# define ZEXPORTVA FAR CDECL +# endif +# endif +#endif + +#if defined (__BEOS__) +# ifdef ZLIB_DLL +# ifdef ZLIB_INTERNAL +# define ZEXPORT __declspec(dllexport) +# define ZEXPORTVA __declspec(dllexport) +# else +# define ZEXPORT __declspec(dllimport) +# define ZEXPORTVA __declspec(dllimport) +# endif +# endif +#endif + +#ifndef ZEXTERN +# define ZEXTERN extern +#endif +#ifndef ZEXPORT +# define ZEXPORT +#endif +#ifndef ZEXPORTVA +# define ZEXPORTVA +#endif + +#ifndef FAR +# define FAR +#endif + +#if !defined(__MACTYPES__) +typedef unsigned char Byte; /* 8 bits */ +#endif +typedef unsigned int uInt; /* 16 bits or more */ +typedef unsigned long uLong; /* 32 bits or more */ + +#ifdef SMALL_MEDIUM + /* Borland C/C++ and some old MSC versions ignore FAR inside typedef */ +# define Bytef Byte FAR +#else + typedef Byte FAR Bytef; +#endif +typedef char FAR charf; +typedef int FAR intf; +typedef uInt FAR uIntf; +typedef uLong FAR uLongf; + +#ifdef STDC + typedef void const *voidpc; + typedef void FAR *voidpf; + typedef void *voidp; +#else + typedef Byte const *voidpc; + typedef Byte FAR *voidpf; + typedef Byte *voidp; +#endif + +#if 0 /* HAVE_UNISTD_H -- this line is updated by ./configure */ +# include <sys/types.h> /* for off_t */ +# include <unistd.h> /* for SEEK_* and off_t */ +# ifdef VMS +# include <unixio.h> /* for off_t */ +# endif +# define z_off_t off_t +#endif +#ifndef SEEK_SET +# define SEEK_SET 0 /* Seek from beginning of file. */ +# define SEEK_CUR 1 /* Seek from current position. */ +# define SEEK_END 2 /* Set file pointer to EOF plus "offset" */ +#endif +#ifndef z_off_t +# define z_off_t long +#endif + +#if defined(__OS400__) +# define NO_vsnprintf +#endif + +#if defined(__MVS__) +# define NO_vsnprintf +# ifdef FAR +# undef FAR +# endif +#endif + +/* MVS linker does not support external names larger than 8 bytes */ +#if defined(__MVS__) +# pragma map(deflateInit_,"DEIN") +# pragma map(deflateInit2_,"DEIN2") +# pragma map(deflateEnd,"DEEND") +# pragma map(deflateBound,"DEBND") +# pragma map(inflateInit_,"ININ") +# pragma map(inflateInit2_,"ININ2") +# pragma map(inflateEnd,"INEND") +# pragma map(inflateSync,"INSY") +# pragma map(inflateSetDictionary,"INSEDI") +# pragma map(compressBound,"CMBND") +# pragma map(inflate_table,"INTABL") +# pragma map(inflate_fast,"INFA") +# pragma map(inflate_copyright,"INCOPY") +#endif + +#endif /* ZCONF_H */
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/SNV/SNVMix2_source/SNVMix2-v0.12.1-rc1/samtools-0.1.6/win32/zlib.h Wed Oct 12 19:50:38 2011 -0400 @@ -0,0 +1,1357 @@ +/* zlib.h -- interface of the 'zlib' general purpose compression library + version 1.2.3, July 18th, 2005 + + Copyright (C) 1995-2005 Jean-loup Gailly and Mark Adler + + This software is provided 'as-is', without any express or implied + warranty. In no event will the authors be held liable for any damages + arising from the use of this software. + + Permission is granted to anyone to use this software for any purpose, + including commercial applications, and to alter it and redistribute it + freely, subject to the following restrictions: + + 1. The origin of this software must not be misrepresented; you must not + claim that you wrote the original software. If you use this software + in a product, an acknowledgment in the product documentation would be + appreciated but is not required. + 2. Altered source versions must be plainly marked as such, and must not be + misrepresented as being the original software. + 3. This notice may not be removed or altered from any source distribution. + + Jean-loup Gailly Mark Adler + jloup@gzip.org madler@alumni.caltech.edu + + + The data format used by the zlib library is described by RFCs (Request for + Comments) 1950 to 1952 in the files http://www.ietf.org/rfc/rfc1950.txt + (zlib format), rfc1951.txt (deflate format) and rfc1952.txt (gzip format). +*/ + +#ifndef ZLIB_H +#define ZLIB_H + +#include "zconf.h" + +#ifdef __cplusplus +extern "C" { +#endif + +#define ZLIB_VERSION "1.2.3" +#define ZLIB_VERNUM 0x1230 + +/* + The 'zlib' compression library provides in-memory compression and + decompression functions, including integrity checks of the uncompressed + data. This version of the library supports only one compression method + (deflation) but other algorithms will be added later and will have the same + stream interface. + + Compression can be done in a single step if the buffers are large + enough (for example if an input file is mmap'ed), or can be done by + repeated calls of the compression function. In the latter case, the + application must provide more input and/or consume the output + (providing more output space) before each call. + + The compressed data format used by default by the in-memory functions is + the zlib format, which is a zlib wrapper documented in RFC 1950, wrapped + around a deflate stream, which is itself documented in RFC 1951. + + The library also supports reading and writing files in gzip (.gz) format + with an interface similar to that of stdio using the functions that start + with "gz". The gzip format is different from the zlib format. gzip is a + gzip wrapper, documented in RFC 1952, wrapped around a deflate stream. + + This library can optionally read and write gzip streams in memory as well. + + The zlib format was designed to be compact and fast for use in memory + and on communications channels. The gzip format was designed for single- + file compression on file systems, has a larger header than zlib to maintain + directory information, and uses a different, slower check method than zlib. + + The library does not install any signal handler. The decoder checks + the consistency of the compressed data, so the library should never + crash even in case of corrupted input. +*/ + +typedef voidpf (*alloc_func) OF((voidpf opaque, uInt items, uInt size)); +typedef void (*free_func) OF((voidpf opaque, voidpf address)); + +struct internal_state; + +typedef struct z_stream_s { + Bytef *next_in; /* next input byte */ + uInt avail_in; /* number of bytes available at next_in */ + uLong total_in; /* total nb of input bytes read so far */ + + Bytef *next_out; /* next output byte should be put there */ + uInt avail_out; /* remaining free space at next_out */ + uLong total_out; /* total nb of bytes output so far */ + + char *msg; /* last error message, NULL if no error */ + struct internal_state FAR *state; /* not visible by applications */ + + alloc_func zalloc; /* used to allocate the internal state */ + free_func zfree; /* used to free the internal state */ + voidpf opaque; /* private data object passed to zalloc and zfree */ + + int data_type; /* best guess about the data type: binary or text */ + uLong adler; /* adler32 value of the uncompressed data */ + uLong reserved; /* reserved for future use */ +} z_stream; + +typedef z_stream FAR *z_streamp; + +/* + gzip header information passed to and from zlib routines. See RFC 1952 + for more details on the meanings of these fields. +*/ +typedef struct gz_header_s { + int text; /* true if compressed data believed to be text */ + uLong time; /* modification time */ + int xflags; /* extra flags (not used when writing a gzip file) */ + int os; /* operating system */ + Bytef *extra; /* pointer to extra field or Z_NULL if none */ + uInt extra_len; /* extra field length (valid if extra != Z_NULL) */ + uInt extra_max; /* space at extra (only when reading header) */ + Bytef *name; /* pointer to zero-terminated file name or Z_NULL */ + uInt name_max; /* space at name (only when reading header) */ + Bytef *comment; /* pointer to zero-terminated comment or Z_NULL */ + uInt comm_max; /* space at comment (only when reading header) */ + int hcrc; /* true if there was or will be a header crc */ + int done; /* true when done reading gzip header (not used + when writing a gzip file) */ +} gz_header; + +typedef gz_header FAR *gz_headerp; + +/* + The application must update next_in and avail_in when avail_in has + dropped to zero. It must update next_out and avail_out when avail_out + has dropped to zero. The application must initialize zalloc, zfree and + opaque before calling the init function. All other fields are set by the + compression library and must not be updated by the application. + + The opaque value provided by the application will be passed as the first + parameter for calls of zalloc and zfree. This can be useful for custom + memory management. The compression library attaches no meaning to the + opaque value. + + zalloc must return Z_NULL if there is not enough memory for the object. + If zlib is used in a multi-threaded application, zalloc and zfree must be + thread safe. + + On 16-bit systems, the functions zalloc and zfree must be able to allocate + exactly 65536 bytes, but will not be required to allocate more than this + if the symbol MAXSEG_64K is defined (see zconf.h). WARNING: On MSDOS, + pointers returned by zalloc for objects of exactly 65536 bytes *must* + have their offset normalized to zero. The default allocation function + provided by this library ensures this (see zutil.c). To reduce memory + requirements and avoid any allocation of 64K objects, at the expense of + compression ratio, compile the library with -DMAX_WBITS=14 (see zconf.h). + + The fields total_in and total_out can be used for statistics or + progress reports. After compression, total_in holds the total size of + the uncompressed data and may be saved for use in the decompressor + (particularly if the decompressor wants to decompress everything in + a single step). +*/ + + /* constants */ + +#define Z_NO_FLUSH 0 +#define Z_PARTIAL_FLUSH 1 /* will be removed, use Z_SYNC_FLUSH instead */ +#define Z_SYNC_FLUSH 2 +#define Z_FULL_FLUSH 3 +#define Z_FINISH 4 +#define Z_BLOCK 5 +/* Allowed flush values; see deflate() and inflate() below for details */ + +#define Z_OK 0 +#define Z_STREAM_END 1 +#define Z_NEED_DICT 2 +#define Z_ERRNO (-1) +#define Z_STREAM_ERROR (-2) +#define Z_DATA_ERROR (-3) +#define Z_MEM_ERROR (-4) +#define Z_BUF_ERROR (-5) +#define Z_VERSION_ERROR (-6) +/* Return codes for the compression/decompression functions. Negative + * values are errors, positive values are used for special but normal events. + */ + +#define Z_NO_COMPRESSION 0 +#define Z_BEST_SPEED 1 +#define Z_BEST_COMPRESSION 9 +#define Z_DEFAULT_COMPRESSION (-1) +/* compression levels */ + +#define Z_FILTERED 1 +#define Z_HUFFMAN_ONLY 2 +#define Z_RLE 3 +#define Z_FIXED 4 +#define Z_DEFAULT_STRATEGY 0 +/* compression strategy; see deflateInit2() below for details */ + +#define Z_BINARY 0 +#define Z_TEXT 1 +#define Z_ASCII Z_TEXT /* for compatibility with 1.2.2 and earlier */ +#define Z_UNKNOWN 2 +/* Possible values of the data_type field (though see inflate()) */ + +#define Z_DEFLATED 8 +/* The deflate compression method (the only one supported in this version) */ + +#define Z_NULL 0 /* for initializing zalloc, zfree, opaque */ + +#define zlib_version zlibVersion() +/* for compatibility with versions < 1.0.2 */ + + /* basic functions */ + +ZEXTERN const char * ZEXPORT zlibVersion OF((void)); +/* The application can compare zlibVersion and ZLIB_VERSION for consistency. + If the first character differs, the library code actually used is + not compatible with the zlib.h header file used by the application. + This check is automatically made by deflateInit and inflateInit. + */ + +/* +ZEXTERN int ZEXPORT deflateInit OF((z_streamp strm, int level)); + + Initializes the internal stream state for compression. The fields + zalloc, zfree and opaque must be initialized before by the caller. + If zalloc and zfree are set to Z_NULL, deflateInit updates them to + use default allocation functions. + + The compression level must be Z_DEFAULT_COMPRESSION, or between 0 and 9: + 1 gives best speed, 9 gives best compression, 0 gives no compression at + all (the input data is simply copied a block at a time). + Z_DEFAULT_COMPRESSION requests a default compromise between speed and + compression (currently equivalent to level 6). + + deflateInit returns Z_OK if success, Z_MEM_ERROR if there was not + enough memory, Z_STREAM_ERROR if level is not a valid compression level, + Z_VERSION_ERROR if the zlib library version (zlib_version) is incompatible + with the version assumed by the caller (ZLIB_VERSION). + msg is set to null if there is no error message. deflateInit does not + perform any compression: this will be done by deflate(). +*/ + + +ZEXTERN int ZEXPORT deflate OF((z_streamp strm, int flush)); +/* + deflate compresses as much data as possible, and stops when the input + buffer becomes empty or the output buffer becomes full. It may introduce some + output latency (reading input without producing any output) except when + forced to flush. + + The detailed semantics are as follows. deflate performs one or both of the + following actions: + + - Compress more input starting at next_in and update next_in and avail_in + accordingly. If not all input can be processed (because there is not + enough room in the output buffer), next_in and avail_in are updated and + processing will resume at this point for the next call of deflate(). + + - Provide more output starting at next_out and update next_out and avail_out + accordingly. This action is forced if the parameter flush is non zero. + Forcing flush frequently degrades the compression ratio, so this parameter + should be set only when necessary (in interactive applications). + Some output may be provided even if flush is not set. + + Before the call of deflate(), the application should ensure that at least + one of the actions is possible, by providing more input and/or consuming + more output, and updating avail_in or avail_out accordingly; avail_out + should never be zero before the call. The application can consume the + compressed output when it wants, for example when the output buffer is full + (avail_out == 0), or after each call of deflate(). If deflate returns Z_OK + and with zero avail_out, it must be called again after making room in the + output buffer because there might be more output pending. + + Normally the parameter flush is set to Z_NO_FLUSH, which allows deflate to + decide how much data to accumualte before producing output, in order to + maximize compression. + + If the parameter flush is set to Z_SYNC_FLUSH, all pending output is + flushed to the output buffer and the output is aligned on a byte boundary, so + that the decompressor can get all input data available so far. (In particular + avail_in is zero after the call if enough output space has been provided + before the call.) Flushing may degrade compression for some compression + algorithms and so it should be used only when necessary. + + If flush is set to Z_FULL_FLUSH, all output is flushed as with + Z_SYNC_FLUSH, and the compression state is reset so that decompression can + restart from this point if previous compressed data has been damaged or if + random access is desired. Using Z_FULL_FLUSH too often can seriously degrade + compression. + + If deflate returns with avail_out == 0, this function must be called again + with the same value of the flush parameter and more output space (updated + avail_out), until the flush is complete (deflate returns with non-zero + avail_out). In the case of a Z_FULL_FLUSH or Z_SYNC_FLUSH, make sure that + avail_out is greater than six to avoid repeated flush markers due to + avail_out == 0 on return. + + If the parameter flush is set to Z_FINISH, pending input is processed, + pending output is flushed and deflate returns with Z_STREAM_END if there + was enough output space; if deflate returns with Z_OK, this function must be + called again with Z_FINISH and more output space (updated avail_out) but no + more input data, until it returns with Z_STREAM_END or an error. After + deflate has returned Z_STREAM_END, the only possible operations on the + stream are deflateReset or deflateEnd. + + Z_FINISH can be used immediately after deflateInit if all the compression + is to be done in a single step. In this case, avail_out must be at least + the value returned by deflateBound (see below). If deflate does not return + Z_STREAM_END, then it must be called again as described above. + + deflate() sets strm->adler to the adler32 checksum of all input read + so far (that is, total_in bytes). + + deflate() may update strm->data_type if it can make a good guess about + the input data type (Z_BINARY or Z_TEXT). In doubt, the data is considered + binary. This field is only for information purposes and does not affect + the compression algorithm in any manner. + + deflate() returns Z_OK if some progress has been made (more input + processed or more output produced), Z_STREAM_END if all input has been + consumed and all output has been produced (only when flush is set to + Z_FINISH), Z_STREAM_ERROR if the stream state was inconsistent (for example + if next_in or next_out was NULL), Z_BUF_ERROR if no progress is possible + (for example avail_in or avail_out was zero). Note that Z_BUF_ERROR is not + fatal, and deflate() can be called again with more input and more output + space to continue compressing. +*/ + + +ZEXTERN int ZEXPORT deflateEnd OF((z_streamp strm)); +/* + All dynamically allocated data structures for this stream are freed. + This function discards any unprocessed input and does not flush any + pending output. + + deflateEnd returns Z_OK if success, Z_STREAM_ERROR if the + stream state was inconsistent, Z_DATA_ERROR if the stream was freed + prematurely (some input or output was discarded). In the error case, + msg may be set but then points to a static string (which must not be + deallocated). +*/ + + +/* +ZEXTERN int ZEXPORT inflateInit OF((z_streamp strm)); + + Initializes the internal stream state for decompression. The fields + next_in, avail_in, zalloc, zfree and opaque must be initialized before by + the caller. If next_in is not Z_NULL and avail_in is large enough (the exact + value depends on the compression method), inflateInit determines the + compression method from the zlib header and allocates all data structures + accordingly; otherwise the allocation will be deferred to the first call of + inflate. If zalloc and zfree are set to Z_NULL, inflateInit updates them to + use default allocation functions. + + inflateInit returns Z_OK if success, Z_MEM_ERROR if there was not enough + memory, Z_VERSION_ERROR if the zlib library version is incompatible with the + version assumed by the caller. msg is set to null if there is no error + message. inflateInit does not perform any decompression apart from reading + the zlib header if present: this will be done by inflate(). (So next_in and + avail_in may be modified, but next_out and avail_out are unchanged.) +*/ + + +ZEXTERN int ZEXPORT inflate OF((z_streamp strm, int flush)); +/* + inflate decompresses as much data as possible, and stops when the input + buffer becomes empty or the output buffer becomes full. It may introduce + some output latency (reading input without producing any output) except when + forced to flush. + + The detailed semantics are as follows. inflate performs one or both of the + following actions: + + - Decompress more input starting at next_in and update next_in and avail_in + accordingly. If not all input can be processed (because there is not + enough room in the output buffer), next_in is updated and processing + will resume at this point for the next call of inflate(). + + - Provide more output starting at next_out and update next_out and avail_out + accordingly. inflate() provides as much output as possible, until there + is no more input data or no more space in the output buffer (see below + about the flush parameter). + + Before the call of inflate(), the application should ensure that at least + one of the actions is possible, by providing more input and/or consuming + more output, and updating the next_* and avail_* values accordingly. + The application can consume the uncompressed output when it wants, for + example when the output buffer is full (avail_out == 0), or after each + call of inflate(). If inflate returns Z_OK and with zero avail_out, it + must be called again after making room in the output buffer because there + might be more output pending. + + The flush parameter of inflate() can be Z_NO_FLUSH, Z_SYNC_FLUSH, + Z_FINISH, or Z_BLOCK. Z_SYNC_FLUSH requests that inflate() flush as much + output as possible to the output buffer. Z_BLOCK requests that inflate() stop + if and when it gets to the next deflate block boundary. When decoding the + zlib or gzip format, this will cause inflate() to return immediately after + the header and before the first block. When doing a raw inflate, inflate() + will go ahead and process the first block, and will return when it gets to + the end of that block, or when it runs out of data. + + The Z_BLOCK option assists in appending to or combining deflate streams. + Also to assist in this, on return inflate() will set strm->data_type to the + number of unused bits in the last byte taken from strm->next_in, plus 64 + if inflate() is currently decoding the last block in the deflate stream, + plus 128 if inflate() returned immediately after decoding an end-of-block + code or decoding the complete header up to just before the first byte of the + deflate stream. The end-of-block will not be indicated until all of the + uncompressed data from that block has been written to strm->next_out. The + number of unused bits may in general be greater than seven, except when + bit 7 of data_type is set, in which case the number of unused bits will be + less than eight. + + inflate() should normally be called until it returns Z_STREAM_END or an + error. However if all decompression is to be performed in a single step + (a single call of inflate), the parameter flush should be set to + Z_FINISH. In this case all pending input is processed and all pending + output is flushed; avail_out must be large enough to hold all the + uncompressed data. (The size of the uncompressed data may have been saved + by the compressor for this purpose.) The next operation on this stream must + be inflateEnd to deallocate the decompression state. The use of Z_FINISH + is never required, but can be used to inform inflate that a faster approach + may be used for the single inflate() call. + + In this implementation, inflate() always flushes as much output as + possible to the output buffer, and always uses the faster approach on the + first call. So the only effect of the flush parameter in this implementation + is on the return value of inflate(), as noted below, or when it returns early + because Z_BLOCK is used. + + If a preset dictionary is needed after this call (see inflateSetDictionary + below), inflate sets strm->adler to the adler32 checksum of the dictionary + chosen by the compressor and returns Z_NEED_DICT; otherwise it sets + strm->adler to the adler32 checksum of all output produced so far (that is, + total_out bytes) and returns Z_OK, Z_STREAM_END or an error code as described + below. At the end of the stream, inflate() checks that its computed adler32 + checksum is equal to that saved by the compressor and returns Z_STREAM_END + only if the checksum is correct. + + inflate() will decompress and check either zlib-wrapped or gzip-wrapped + deflate data. The header type is detected automatically. Any information + contained in the gzip header is not retained, so applications that need that + information should instead use raw inflate, see inflateInit2() below, or + inflateBack() and perform their own processing of the gzip header and + trailer. + + inflate() returns Z_OK if some progress has been made (more input processed + or more output produced), Z_STREAM_END if the end of the compressed data has + been reached and all uncompressed output has been produced, Z_NEED_DICT if a + preset dictionary is needed at this point, Z_DATA_ERROR if the input data was + corrupted (input stream not conforming to the zlib format or incorrect check + value), Z_STREAM_ERROR if the stream structure was inconsistent (for example + if next_in or next_out was NULL), Z_MEM_ERROR if there was not enough memory, + Z_BUF_ERROR if no progress is possible or if there was not enough room in the + output buffer when Z_FINISH is used. Note that Z_BUF_ERROR is not fatal, and + inflate() can be called again with more input and more output space to + continue decompressing. If Z_DATA_ERROR is returned, the application may then + call inflateSync() to look for a good compression block if a partial recovery + of the data is desired. +*/ + + +ZEXTERN int ZEXPORT inflateEnd OF((z_streamp strm)); +/* + All dynamically allocated data structures for this stream are freed. + This function discards any unprocessed input and does not flush any + pending output. + + inflateEnd returns Z_OK if success, Z_STREAM_ERROR if the stream state + was inconsistent. In the error case, msg may be set but then points to a + static string (which must not be deallocated). +*/ + + /* Advanced functions */ + +/* + The following functions are needed only in some special applications. +*/ + +/* +ZEXTERN int ZEXPORT deflateInit2 OF((z_streamp strm, + int level, + int method, + int windowBits, + int memLevel, + int strategy)); + + This is another version of deflateInit with more compression options. The + fields next_in, zalloc, zfree and opaque must be initialized before by + the caller. + + The method parameter is the compression method. It must be Z_DEFLATED in + this version of the library. + + The windowBits parameter is the base two logarithm of the window size + (the size of the history buffer). It should be in the range 8..15 for this + version of the library. Larger values of this parameter result in better + compression at the expense of memory usage. The default value is 15 if + deflateInit is used instead. + + windowBits can also be -8..-15 for raw deflate. In this case, -windowBits + determines the window size. deflate() will then generate raw deflate data + with no zlib header or trailer, and will not compute an adler32 check value. + + windowBits can also be greater than 15 for optional gzip encoding. Add + 16 to windowBits to write a simple gzip header and trailer around the + compressed data instead of a zlib wrapper. The gzip header will have no + file name, no extra data, no comment, no modification time (set to zero), + no header crc, and the operating system will be set to 255 (unknown). If a + gzip stream is being written, strm->adler is a crc32 instead of an adler32. + + The memLevel parameter specifies how much memory should be allocated + for the internal compression state. memLevel=1 uses minimum memory but + is slow and reduces compression ratio; memLevel=9 uses maximum memory + for optimal speed. The default value is 8. See zconf.h for total memory + usage as a function of windowBits and memLevel. + + The strategy parameter is used to tune the compression algorithm. Use the + value Z_DEFAULT_STRATEGY for normal data, Z_FILTERED for data produced by a + filter (or predictor), Z_HUFFMAN_ONLY to force Huffman encoding only (no + string match), or Z_RLE to limit match distances to one (run-length + encoding). Filtered data consists mostly of small values with a somewhat + random distribution. In this case, the compression algorithm is tuned to + compress them better. The effect of Z_FILTERED is to force more Huffman + coding and less string matching; it is somewhat intermediate between + Z_DEFAULT and Z_HUFFMAN_ONLY. Z_RLE is designed to be almost as fast as + Z_HUFFMAN_ONLY, but give better compression for PNG image data. The strategy + parameter only affects the compression ratio but not the correctness of the + compressed output even if it is not set appropriately. Z_FIXED prevents the + use of dynamic Huffman codes, allowing for a simpler decoder for special + applications. + + deflateInit2 returns Z_OK if success, Z_MEM_ERROR if there was not enough + memory, Z_STREAM_ERROR if a parameter is invalid (such as an invalid + method). msg is set to null if there is no error message. deflateInit2 does + not perform any compression: this will be done by deflate(). +*/ + +ZEXTERN int ZEXPORT deflateSetDictionary OF((z_streamp strm, + const Bytef *dictionary, + uInt dictLength)); +/* + Initializes the compression dictionary from the given byte sequence + without producing any compressed output. This function must be called + immediately after deflateInit, deflateInit2 or deflateReset, before any + call of deflate. The compressor and decompressor must use exactly the same + dictionary (see inflateSetDictionary). + + The dictionary should consist of strings (byte sequences) that are likely + to be encountered later in the data to be compressed, with the most commonly + used strings preferably put towards the end of the dictionary. Using a + dictionary is most useful when the data to be compressed is short and can be + predicted with good accuracy; the data can then be compressed better than + with the default empty dictionary. + + Depending on the size of the compression data structures selected by + deflateInit or deflateInit2, a part of the dictionary may in effect be + discarded, for example if the dictionary is larger than the window size in + deflate or deflate2. Thus the strings most likely to be useful should be + put at the end of the dictionary, not at the front. In addition, the + current implementation of deflate will use at most the window size minus + 262 bytes of the provided dictionary. + + Upon return of this function, strm->adler is set to the adler32 value + of the dictionary; the decompressor may later use this value to determine + which dictionary has been used by the compressor. (The adler32 value + applies to the whole dictionary even if only a subset of the dictionary is + actually used by the compressor.) If a raw deflate was requested, then the + adler32 value is not computed and strm->adler is not set. + + deflateSetDictionary returns Z_OK if success, or Z_STREAM_ERROR if a + parameter is invalid (such as NULL dictionary) or the stream state is + inconsistent (for example if deflate has already been called for this stream + or if the compression method is bsort). deflateSetDictionary does not + perform any compression: this will be done by deflate(). +*/ + +ZEXTERN int ZEXPORT deflateCopy OF((z_streamp dest, + z_streamp source)); +/* + Sets the destination stream as a complete copy of the source stream. + + This function can be useful when several compression strategies will be + tried, for example when there are several ways of pre-processing the input + data with a filter. The streams that will be discarded should then be freed + by calling deflateEnd. Note that deflateCopy duplicates the internal + compression state which can be quite large, so this strategy is slow and + can consume lots of memory. + + deflateCopy returns Z_OK if success, Z_MEM_ERROR if there was not + enough memory, Z_STREAM_ERROR if the source stream state was inconsistent + (such as zalloc being NULL). msg is left unchanged in both source and + destination. +*/ + +ZEXTERN int ZEXPORT deflateReset OF((z_streamp strm)); +/* + This function is equivalent to deflateEnd followed by deflateInit, + but does not free and reallocate all the internal compression state. + The stream will keep the same compression level and any other attributes + that may have been set by deflateInit2. + + deflateReset returns Z_OK if success, or Z_STREAM_ERROR if the source + stream state was inconsistent (such as zalloc or state being NULL). +*/ + +ZEXTERN int ZEXPORT deflateParams OF((z_streamp strm, + int level, + int strategy)); +/* + Dynamically update the compression level and compression strategy. The + interpretation of level and strategy is as in deflateInit2. This can be + used to switch between compression and straight copy of the input data, or + to switch to a different kind of input data requiring a different + strategy. If the compression level is changed, the input available so far + is compressed with the old level (and may be flushed); the new level will + take effect only at the next call of deflate(). + + Before the call of deflateParams, the stream state must be set as for + a call of deflate(), since the currently available input may have to + be compressed and flushed. In particular, strm->avail_out must be non-zero. + + deflateParams returns Z_OK if success, Z_STREAM_ERROR if the source + stream state was inconsistent or if a parameter was invalid, Z_BUF_ERROR + if strm->avail_out was zero. +*/ + +ZEXTERN int ZEXPORT deflateTune OF((z_streamp strm, + int good_length, + int max_lazy, + int nice_length, + int max_chain)); +/* + Fine tune deflate's internal compression parameters. This should only be + used by someone who understands the algorithm used by zlib's deflate for + searching for the best matching string, and even then only by the most + fanatic optimizer trying to squeeze out the last compressed bit for their + specific input data. Read the deflate.c source code for the meaning of the + max_lazy, good_length, nice_length, and max_chain parameters. + + deflateTune() can be called after deflateInit() or deflateInit2(), and + returns Z_OK on success, or Z_STREAM_ERROR for an invalid deflate stream. + */ + +ZEXTERN uLong ZEXPORT deflateBound OF((z_streamp strm, + uLong sourceLen)); +/* + deflateBound() returns an upper bound on the compressed size after + deflation of sourceLen bytes. It must be called after deflateInit() + or deflateInit2(). This would be used to allocate an output buffer + for deflation in a single pass, and so would be called before deflate(). +*/ + +ZEXTERN int ZEXPORT deflatePrime OF((z_streamp strm, + int bits, + int value)); +/* + deflatePrime() inserts bits in the deflate output stream. The intent + is that this function is used to start off the deflate output with the + bits leftover from a previous deflate stream when appending to it. As such, + this function can only be used for raw deflate, and must be used before the + first deflate() call after a deflateInit2() or deflateReset(). bits must be + less than or equal to 16, and that many of the least significant bits of + value will be inserted in the output. + + deflatePrime returns Z_OK if success, or Z_STREAM_ERROR if the source + stream state was inconsistent. +*/ + +ZEXTERN int ZEXPORT deflateSetHeader OF((z_streamp strm, + gz_headerp head)); +/* + deflateSetHeader() provides gzip header information for when a gzip + stream is requested by deflateInit2(). deflateSetHeader() may be called + after deflateInit2() or deflateReset() and before the first call of + deflate(). The text, time, os, extra field, name, and comment information + in the provided gz_header structure are written to the gzip header (xflag is + ignored -- the extra flags are set according to the compression level). The + caller must assure that, if not Z_NULL, name and comment are terminated with + a zero byte, and that if extra is not Z_NULL, that extra_len bytes are + available there. If hcrc is true, a gzip header crc is included. Note that + the current versions of the command-line version of gzip (up through version + 1.3.x) do not support header crc's, and will report that it is a "multi-part + gzip file" and give up. + + If deflateSetHeader is not used, the default gzip header has text false, + the time set to zero, and os set to 255, with no extra, name, or comment + fields. The gzip header is returned to the default state by deflateReset(). + + deflateSetHeader returns Z_OK if success, or Z_STREAM_ERROR if the source + stream state was inconsistent. +*/ + +/* +ZEXTERN int ZEXPORT inflateInit2 OF((z_streamp strm, + int windowBits)); + + This is another version of inflateInit with an extra parameter. The + fields next_in, avail_in, zalloc, zfree and opaque must be initialized + before by the caller. + + The windowBits parameter is the base two logarithm of the maximum window + size (the size of the history buffer). It should be in the range 8..15 for + this version of the library. The default value is 15 if inflateInit is used + instead. windowBits must be greater than or equal to the windowBits value + provided to deflateInit2() while compressing, or it must be equal to 15 if + deflateInit2() was not used. If a compressed stream with a larger window + size is given as input, inflate() will return with the error code + Z_DATA_ERROR instead of trying to allocate a larger window. + + windowBits can also be -8..-15 for raw inflate. In this case, -windowBits + determines the window size. inflate() will then process raw deflate data, + not looking for a zlib or gzip header, not generating a check value, and not + looking for any check values for comparison at the end of the stream. This + is for use with other formats that use the deflate compressed data format + such as zip. Those formats provide their own check values. If a custom + format is developed using the raw deflate format for compressed data, it is + recommended that a check value such as an adler32 or a crc32 be applied to + the uncompressed data as is done in the zlib, gzip, and zip formats. For + most applications, the zlib format should be used as is. Note that comments + above on the use in deflateInit2() applies to the magnitude of windowBits. + + windowBits can also be greater than 15 for optional gzip decoding. Add + 32 to windowBits to enable zlib and gzip decoding with automatic header + detection, or add 16 to decode only the gzip format (the zlib format will + return a Z_DATA_ERROR). If a gzip stream is being decoded, strm->adler is + a crc32 instead of an adler32. + + inflateInit2 returns Z_OK if success, Z_MEM_ERROR if there was not enough + memory, Z_STREAM_ERROR if a parameter is invalid (such as a null strm). msg + is set to null if there is no error message. inflateInit2 does not perform + any decompression apart from reading the zlib header if present: this will + be done by inflate(). (So next_in and avail_in may be modified, but next_out + and avail_out are unchanged.) +*/ + +ZEXTERN int ZEXPORT inflateSetDictionary OF((z_streamp strm, + const Bytef *dictionary, + uInt dictLength)); +/* + Initializes the decompression dictionary from the given uncompressed byte + sequence. This function must be called immediately after a call of inflate, + if that call returned Z_NEED_DICT. The dictionary chosen by the compressor + can be determined from the adler32 value returned by that call of inflate. + The compressor and decompressor must use exactly the same dictionary (see + deflateSetDictionary). For raw inflate, this function can be called + immediately after inflateInit2() or inflateReset() and before any call of + inflate() to set the dictionary. The application must insure that the + dictionary that was used for compression is provided. + + inflateSetDictionary returns Z_OK if success, Z_STREAM_ERROR if a + parameter is invalid (such as NULL dictionary) or the stream state is + inconsistent, Z_DATA_ERROR if the given dictionary doesn't match the + expected one (incorrect adler32 value). inflateSetDictionary does not + perform any decompression: this will be done by subsequent calls of + inflate(). +*/ + +ZEXTERN int ZEXPORT inflateSync OF((z_streamp strm)); +/* + Skips invalid compressed data until a full flush point (see above the + description of deflate with Z_FULL_FLUSH) can be found, or until all + available input is skipped. No output is provided. + + inflateSync returns Z_OK if a full flush point has been found, Z_BUF_ERROR + if no more input was provided, Z_DATA_ERROR if no flush point has been found, + or Z_STREAM_ERROR if the stream structure was inconsistent. In the success + case, the application may save the current current value of total_in which + indicates where valid compressed data was found. In the error case, the + application may repeatedly call inflateSync, providing more input each time, + until success or end of the input data. +*/ + +ZEXTERN int ZEXPORT inflateCopy OF((z_streamp dest, + z_streamp source)); +/* + Sets the destination stream as a complete copy of the source stream. + + This function can be useful when randomly accessing a large stream. The + first pass through the stream can periodically record the inflate state, + allowing restarting inflate at those points when randomly accessing the + stream. + + inflateCopy returns Z_OK if success, Z_MEM_ERROR if there was not + enough memory, Z_STREAM_ERROR if the source stream state was inconsistent + (such as zalloc being NULL). msg is left unchanged in both source and + destination. +*/ + +ZEXTERN int ZEXPORT inflateReset OF((z_streamp strm)); +/* + This function is equivalent to inflateEnd followed by inflateInit, + but does not free and reallocate all the internal decompression state. + The stream will keep attributes that may have been set by inflateInit2. + + inflateReset returns Z_OK if success, or Z_STREAM_ERROR if the source + stream state was inconsistent (such as zalloc or state being NULL). +*/ + +ZEXTERN int ZEXPORT inflatePrime OF((z_streamp strm, + int bits, + int value)); +/* + This function inserts bits in the inflate input stream. The intent is + that this function is used to start inflating at a bit position in the + middle of a byte. The provided bits will be used before any bytes are used + from next_in. This function should only be used with raw inflate, and + should be used before the first inflate() call after inflateInit2() or + inflateReset(). bits must be less than or equal to 16, and that many of the + least significant bits of value will be inserted in the input. + + inflatePrime returns Z_OK if success, or Z_STREAM_ERROR if the source + stream state was inconsistent. +*/ + +ZEXTERN int ZEXPORT inflateGetHeader OF((z_streamp strm, + gz_headerp head)); +/* + inflateGetHeader() requests that gzip header information be stored in the + provided gz_header structure. inflateGetHeader() may be called after + inflateInit2() or inflateReset(), and before the first call of inflate(). + As inflate() processes the gzip stream, head->done is zero until the header + is completed, at which time head->done is set to one. If a zlib stream is + being decoded, then head->done is set to -1 to indicate that there will be + no gzip header information forthcoming. Note that Z_BLOCK can be used to + force inflate() to return immediately after header processing is complete + and before any actual data is decompressed. + + The text, time, xflags, and os fields are filled in with the gzip header + contents. hcrc is set to true if there is a header CRC. (The header CRC + was valid if done is set to one.) If extra is not Z_NULL, then extra_max + contains the maximum number of bytes to write to extra. Once done is true, + extra_len contains the actual extra field length, and extra contains the + extra field, or that field truncated if extra_max is less than extra_len. + If name is not Z_NULL, then up to name_max characters are written there, + terminated with a zero unless the length is greater than name_max. If + comment is not Z_NULL, then up to comm_max characters are written there, + terminated with a zero unless the length is greater than comm_max. When + any of extra, name, or comment are not Z_NULL and the respective field is + not present in the header, then that field is set to Z_NULL to signal its + absence. This allows the use of deflateSetHeader() with the returned + structure to duplicate the header. However if those fields are set to + allocated memory, then the application will need to save those pointers + elsewhere so that they can be eventually freed. + + If inflateGetHeader is not used, then the header information is simply + discarded. The header is always checked for validity, including the header + CRC if present. inflateReset() will reset the process to discard the header + information. The application would need to call inflateGetHeader() again to + retrieve the header from the next gzip stream. + + inflateGetHeader returns Z_OK if success, or Z_STREAM_ERROR if the source + stream state was inconsistent. +*/ + +/* +ZEXTERN int ZEXPORT inflateBackInit OF((z_streamp strm, int windowBits, + unsigned char FAR *window)); + + Initialize the internal stream state for decompression using inflateBack() + calls. The fields zalloc, zfree and opaque in strm must be initialized + before the call. If zalloc and zfree are Z_NULL, then the default library- + derived memory allocation routines are used. windowBits is the base two + logarithm of the window size, in the range 8..15. window is a caller + supplied buffer of that size. Except for special applications where it is + assured that deflate was used with small window sizes, windowBits must be 15 + and a 32K byte window must be supplied to be able to decompress general + deflate streams. + + See inflateBack() for the usage of these routines. + + inflateBackInit will return Z_OK on success, Z_STREAM_ERROR if any of + the paramaters are invalid, Z_MEM_ERROR if the internal state could not + be allocated, or Z_VERSION_ERROR if the version of the library does not + match the version of the header file. +*/ + +typedef unsigned (*in_func) OF((void FAR *, unsigned char FAR * FAR *)); +typedef int (*out_func) OF((void FAR *, unsigned char FAR *, unsigned)); + +ZEXTERN int ZEXPORT inflateBack OF((z_streamp strm, + in_func in, void FAR *in_desc, + out_func out, void FAR *out_desc)); +/* + inflateBack() does a raw inflate with a single call using a call-back + interface for input and output. This is more efficient than inflate() for + file i/o applications in that it avoids copying between the output and the + sliding window by simply making the window itself the output buffer. This + function trusts the application to not change the output buffer passed by + the output function, at least until inflateBack() returns. + + inflateBackInit() must be called first to allocate the internal state + and to initialize the state with the user-provided window buffer. + inflateBack() may then be used multiple times to inflate a complete, raw + deflate stream with each call. inflateBackEnd() is then called to free + the allocated state. + + A raw deflate stream is one with no zlib or gzip header or trailer. + This routine would normally be used in a utility that reads zip or gzip + files and writes out uncompressed files. The utility would decode the + header and process the trailer on its own, hence this routine expects + only the raw deflate stream to decompress. This is different from the + normal behavior of inflate(), which expects either a zlib or gzip header and + trailer around the deflate stream. + + inflateBack() uses two subroutines supplied by the caller that are then + called by inflateBack() for input and output. inflateBack() calls those + routines until it reads a complete deflate stream and writes out all of the + uncompressed data, or until it encounters an error. The function's + parameters and return types are defined above in the in_func and out_func + typedefs. inflateBack() will call in(in_desc, &buf) which should return the + number of bytes of provided input, and a pointer to that input in buf. If + there is no input available, in() must return zero--buf is ignored in that + case--and inflateBack() will return a buffer error. inflateBack() will call + out(out_desc, buf, len) to write the uncompressed data buf[0..len-1]. out() + should return zero on success, or non-zero on failure. If out() returns + non-zero, inflateBack() will return with an error. Neither in() nor out() + are permitted to change the contents of the window provided to + inflateBackInit(), which is also the buffer that out() uses to write from. + The length written by out() will be at most the window size. Any non-zero + amount of input may be provided by in(). + + For convenience, inflateBack() can be provided input on the first call by + setting strm->next_in and strm->avail_in. If that input is exhausted, then + in() will be called. Therefore strm->next_in must be initialized before + calling inflateBack(). If strm->next_in is Z_NULL, then in() will be called + immediately for input. If strm->next_in is not Z_NULL, then strm->avail_in + must also be initialized, and then if strm->avail_in is not zero, input will + initially be taken from strm->next_in[0 .. strm->avail_in - 1]. + + The in_desc and out_desc parameters of inflateBack() is passed as the + first parameter of in() and out() respectively when they are called. These + descriptors can be optionally used to pass any information that the caller- + supplied in() and out() functions need to do their job. + + On return, inflateBack() will set strm->next_in and strm->avail_in to + pass back any unused input that was provided by the last in() call. The + return values of inflateBack() can be Z_STREAM_END on success, Z_BUF_ERROR + if in() or out() returned an error, Z_DATA_ERROR if there was a format + error in the deflate stream (in which case strm->msg is set to indicate the + nature of the error), or Z_STREAM_ERROR if the stream was not properly + initialized. In the case of Z_BUF_ERROR, an input or output error can be + distinguished using strm->next_in which will be Z_NULL only if in() returned + an error. If strm->next is not Z_NULL, then the Z_BUF_ERROR was due to + out() returning non-zero. (in() will always be called before out(), so + strm->next_in is assured to be defined if out() returns non-zero.) Note + that inflateBack() cannot return Z_OK. +*/ + +ZEXTERN int ZEXPORT inflateBackEnd OF((z_streamp strm)); +/* + All memory allocated by inflateBackInit() is freed. + + inflateBackEnd() returns Z_OK on success, or Z_STREAM_ERROR if the stream + state was inconsistent. +*/ + +ZEXTERN uLong ZEXPORT zlibCompileFlags OF((void)); +/* Return flags indicating compile-time options. + + Type sizes, two bits each, 00 = 16 bits, 01 = 32, 10 = 64, 11 = other: + 1.0: size of uInt + 3.2: size of uLong + 5.4: size of voidpf (pointer) + 7.6: size of z_off_t + + Compiler, assembler, and debug options: + 8: DEBUG + 9: ASMV or ASMINF -- use ASM code + 10: ZLIB_WINAPI -- exported functions use the WINAPI calling convention + 11: 0 (reserved) + + One-time table building (smaller code, but not thread-safe if true): + 12: BUILDFIXED -- build static block decoding tables when needed + 13: DYNAMIC_CRC_TABLE -- build CRC calculation tables when needed + 14,15: 0 (reserved) + + Library content (indicates missing functionality): + 16: NO_GZCOMPRESS -- gz* functions cannot compress (to avoid linking + deflate code when not needed) + 17: NO_GZIP -- deflate can't write gzip streams, and inflate can't detect + and decode gzip streams (to avoid linking crc code) + 18-19: 0 (reserved) + + Operation variations (changes in library functionality): + 20: PKZIP_BUG_WORKAROUND -- slightly more permissive inflate + 21: FASTEST -- deflate algorithm with only one, lowest compression level + 22,23: 0 (reserved) + + The sprintf variant used by gzprintf (zero is best): + 24: 0 = vs*, 1 = s* -- 1 means limited to 20 arguments after the format + 25: 0 = *nprintf, 1 = *printf -- 1 means gzprintf() not secure! + 26: 0 = returns value, 1 = void -- 1 means inferred string length returned + + Remainder: + 27-31: 0 (reserved) + */ + + + /* utility functions */ + +/* + The following utility functions are implemented on top of the + basic stream-oriented functions. To simplify the interface, some + default options are assumed (compression level and memory usage, + standard memory allocation functions). The source code of these + utility functions can easily be modified if you need special options. +*/ + +ZEXTERN int ZEXPORT compress OF((Bytef *dest, uLongf *destLen, + const Bytef *source, uLong sourceLen)); +/* + Compresses the source buffer into the destination buffer. sourceLen is + the byte length of the source buffer. Upon entry, destLen is the total + size of the destination buffer, which must be at least the value returned + by compressBound(sourceLen). Upon exit, destLen is the actual size of the + compressed buffer. + This function can be used to compress a whole file at once if the + input file is mmap'ed. + compress returns Z_OK if success, Z_MEM_ERROR if there was not + enough memory, Z_BUF_ERROR if there was not enough room in the output + buffer. +*/ + +ZEXTERN int ZEXPORT compress2 OF((Bytef *dest, uLongf *destLen, + const Bytef *source, uLong sourceLen, + int level)); +/* + Compresses the source buffer into the destination buffer. The level + parameter has the same meaning as in deflateInit. sourceLen is the byte + length of the source buffer. Upon entry, destLen is the total size of the + destination buffer, which must be at least the value returned by + compressBound(sourceLen). Upon exit, destLen is the actual size of the + compressed buffer. + + compress2 returns Z_OK if success, Z_MEM_ERROR if there was not enough + memory, Z_BUF_ERROR if there was not enough room in the output buffer, + Z_STREAM_ERROR if the level parameter is invalid. +*/ + +ZEXTERN uLong ZEXPORT compressBound OF((uLong sourceLen)); +/* + compressBound() returns an upper bound on the compressed size after + compress() or compress2() on sourceLen bytes. It would be used before + a compress() or compress2() call to allocate the destination buffer. +*/ + +ZEXTERN int ZEXPORT uncompress OF((Bytef *dest, uLongf *destLen, + const Bytef *source, uLong sourceLen)); +/* + Decompresses the source buffer into the destination buffer. sourceLen is + the byte length of the source buffer. Upon entry, destLen is the total + size of the destination buffer, which must be large enough to hold the + entire uncompressed data. (The size of the uncompressed data must have + been saved previously by the compressor and transmitted to the decompressor + by some mechanism outside the scope of this compression library.) + Upon exit, destLen is the actual size of the compressed buffer. + This function can be used to decompress a whole file at once if the + input file is mmap'ed. + + uncompress returns Z_OK if success, Z_MEM_ERROR if there was not + enough memory, Z_BUF_ERROR if there was not enough room in the output + buffer, or Z_DATA_ERROR if the input data was corrupted or incomplete. +*/ + + +typedef voidp gzFile; + +ZEXTERN gzFile ZEXPORT gzopen OF((const char *path, const char *mode)); +/* + Opens a gzip (.gz) file for reading or writing. The mode parameter + is as in fopen ("rb" or "wb") but can also include a compression level + ("wb9") or a strategy: 'f' for filtered data as in "wb6f", 'h' for + Huffman only compression as in "wb1h", or 'R' for run-length encoding + as in "wb1R". (See the description of deflateInit2 for more information + about the strategy parameter.) + + gzopen can be used to read a file which is not in gzip format; in this + case gzread will directly read from the file without decompression. + + gzopen returns NULL if the file could not be opened or if there was + insufficient memory to allocate the (de)compression state; errno + can be checked to distinguish the two cases (if errno is zero, the + zlib error is Z_MEM_ERROR). */ + +ZEXTERN gzFile ZEXPORT gzdopen OF((int fd, const char *mode)); +/* + gzdopen() associates a gzFile with the file descriptor fd. File + descriptors are obtained from calls like open, dup, creat, pipe or + fileno (in the file has been previously opened with fopen). + The mode parameter is as in gzopen. + The next call of gzclose on the returned gzFile will also close the + file descriptor fd, just like fclose(fdopen(fd), mode) closes the file + descriptor fd. If you want to keep fd open, use gzdopen(dup(fd), mode). + gzdopen returns NULL if there was insufficient memory to allocate + the (de)compression state. +*/ + +ZEXTERN int ZEXPORT gzsetparams OF((gzFile file, int level, int strategy)); +/* + Dynamically update the compression level or strategy. See the description + of deflateInit2 for the meaning of these parameters. + gzsetparams returns Z_OK if success, or Z_STREAM_ERROR if the file was not + opened for writing. +*/ + +ZEXTERN int ZEXPORT gzread OF((gzFile file, voidp buf, unsigned len)); +/* + Reads the given number of uncompressed bytes from the compressed file. + If the input file was not in gzip format, gzread copies the given number + of bytes into the buffer. + gzread returns the number of uncompressed bytes actually read (0 for + end of file, -1 for error). */ + +ZEXTERN int ZEXPORT gzwrite OF((gzFile file, + voidpc buf, unsigned len)); +/* + Writes the given number of uncompressed bytes into the compressed file. + gzwrite returns the number of uncompressed bytes actually written + (0 in case of error). +*/ + +ZEXTERN int ZEXPORTVA gzprintf OF((gzFile file, const char *format, ...)); +/* + Converts, formats, and writes the args to the compressed file under + control of the format string, as in fprintf. gzprintf returns the number of + uncompressed bytes actually written (0 in case of error). The number of + uncompressed bytes written is limited to 4095. The caller should assure that + this limit is not exceeded. If it is exceeded, then gzprintf() will return + return an error (0) with nothing written. In this case, there may also be a + buffer overflow with unpredictable consequences, which is possible only if + zlib was compiled with the insecure functions sprintf() or vsprintf() + because the secure snprintf() or vsnprintf() functions were not available. +*/ + +ZEXTERN int ZEXPORT gzputs OF((gzFile file, const char *s)); +/* + Writes the given null-terminated string to the compressed file, excluding + the terminating null character. + gzputs returns the number of characters written, or -1 in case of error. +*/ + +ZEXTERN char * ZEXPORT gzgets OF((gzFile file, char *buf, int len)); +/* + Reads bytes from the compressed file until len-1 characters are read, or + a newline character is read and transferred to buf, or an end-of-file + condition is encountered. The string is then terminated with a null + character. + gzgets returns buf, or Z_NULL in case of error. +*/ + +ZEXTERN int ZEXPORT gzputc OF((gzFile file, int c)); +/* + Writes c, converted to an unsigned char, into the compressed file. + gzputc returns the value that was written, or -1 in case of error. +*/ + +ZEXTERN int ZEXPORT gzgetc OF((gzFile file)); +/* + Reads one byte from the compressed file. gzgetc returns this byte + or -1 in case of end of file or error. +*/ + +ZEXTERN int ZEXPORT gzungetc OF((int c, gzFile file)); +/* + Push one character back onto the stream to be read again later. + Only one character of push-back is allowed. gzungetc() returns the + character pushed, or -1 on failure. gzungetc() will fail if a + character has been pushed but not read yet, or if c is -1. The pushed + character will be discarded if the stream is repositioned with gzseek() + or gzrewind(). +*/ + +ZEXTERN int ZEXPORT gzflush OF((gzFile file, int flush)); +/* + Flushes all pending output into the compressed file. The parameter + flush is as in the deflate() function. The return value is the zlib + error number (see function gzerror below). gzflush returns Z_OK if + the flush parameter is Z_FINISH and all output could be flushed. + gzflush should be called only when strictly necessary because it can + degrade compression. +*/ + +ZEXTERN z_off_t ZEXPORT gzseek OF((gzFile file, + z_off_t offset, int whence)); +/* + Sets the starting position for the next gzread or gzwrite on the + given compressed file. The offset represents a number of bytes in the + uncompressed data stream. The whence parameter is defined as in lseek(2); + the value SEEK_END is not supported. + If the file is opened for reading, this function is emulated but can be + extremely slow. If the file is opened for writing, only forward seeks are + supported; gzseek then compresses a sequence of zeroes up to the new + starting position. + + gzseek returns the resulting offset location as measured in bytes from + the beginning of the uncompressed stream, or -1 in case of error, in + particular if the file is opened for writing and the new starting position + would be before the current position. +*/ + +ZEXTERN int ZEXPORT gzrewind OF((gzFile file)); +/* + Rewinds the given file. This function is supported only for reading. + + gzrewind(file) is equivalent to (int)gzseek(file, 0L, SEEK_SET) +*/ + +ZEXTERN z_off_t ZEXPORT gztell OF((gzFile file)); +/* + Returns the starting position for the next gzread or gzwrite on the + given compressed file. This position represents a number of bytes in the + uncompressed data stream. + + gztell(file) is equivalent to gzseek(file, 0L, SEEK_CUR) +*/ + +ZEXTERN int ZEXPORT gzeof OF((gzFile file)); +/* + Returns 1 when EOF has previously been detected reading the given + input stream, otherwise zero. +*/ + +ZEXTERN int ZEXPORT gzdirect OF((gzFile file)); +/* + Returns 1 if file is being read directly without decompression, otherwise + zero. +*/ + +ZEXTERN int ZEXPORT gzclose OF((gzFile file)); +/* + Flushes all pending output if necessary, closes the compressed file + and deallocates all the (de)compression state. The return value is the zlib + error number (see function gzerror below). +*/ + +ZEXTERN const char * ZEXPORT gzerror OF((gzFile file, int *errnum)); +/* + Returns the error message for the last error which occurred on the + given compressed file. errnum is set to zlib error number. If an + error occurred in the file system and not in the compression library, + errnum is set to Z_ERRNO and the application may consult errno + to get the exact error code. +*/ + +ZEXTERN void ZEXPORT gzclearerr OF((gzFile file)); +/* + Clears the error and end-of-file flags for file. This is analogous to the + clearerr() function in stdio. This is useful for continuing to read a gzip + file that is being written concurrently. +*/ + + /* checksum functions */ + +/* + These functions are not related to compression but are exported + anyway because they might be useful in applications using the + compression library. +*/ + +ZEXTERN uLong ZEXPORT adler32 OF((uLong adler, const Bytef *buf, uInt len)); +/* + Update a running Adler-32 checksum with the bytes buf[0..len-1] and + return the updated checksum. If buf is NULL, this function returns + the required initial value for the checksum. + An Adler-32 checksum is almost as reliable as a CRC32 but can be computed + much faster. Usage example: + + uLong adler = adler32(0L, Z_NULL, 0); + + while (read_buffer(buffer, length) != EOF) { + adler = adler32(adler, buffer, length); + } + if (adler != original_adler) error(); +*/ + +ZEXTERN uLong ZEXPORT adler32_combine OF((uLong adler1, uLong adler2, + z_off_t len2)); +/* + Combine two Adler-32 checksums into one. For two sequences of bytes, seq1 + and seq2 with lengths len1 and len2, Adler-32 checksums were calculated for + each, adler1 and adler2. adler32_combine() returns the Adler-32 checksum of + seq1 and seq2 concatenated, requiring only adler1, adler2, and len2. +*/ + +ZEXTERN uLong ZEXPORT crc32 OF((uLong crc, const Bytef *buf, uInt len)); +/* + Update a running CRC-32 with the bytes buf[0..len-1] and return the + updated CRC-32. If buf is NULL, this function returns the required initial + value for the for the crc. Pre- and post-conditioning (one's complement) is + performed within this function so it shouldn't be done by the application. + Usage example: + + uLong crc = crc32(0L, Z_NULL, 0); + + while (read_buffer(buffer, length) != EOF) { + crc = crc32(crc, buffer, length); + } + if (crc != original_crc) error(); +*/ + +ZEXTERN uLong ZEXPORT crc32_combine OF((uLong crc1, uLong crc2, z_off_t len2)); + +/* + Combine two CRC-32 check values into one. For two sequences of bytes, + seq1 and seq2 with lengths len1 and len2, CRC-32 check values were + calculated for each, crc1 and crc2. crc32_combine() returns the CRC-32 + check value of seq1 and seq2 concatenated, requiring only crc1, crc2, and + len2. +*/ + + + /* various hacks, don't look :) */ + +/* deflateInit and inflateInit are macros to allow checking the zlib version + * and the compiler's view of z_stream: + */ +ZEXTERN int ZEXPORT deflateInit_ OF((z_streamp strm, int level, + const char *version, int stream_size)); +ZEXTERN int ZEXPORT inflateInit_ OF((z_streamp strm, + const char *version, int stream_size)); +ZEXTERN int ZEXPORT deflateInit2_ OF((z_streamp strm, int level, int method, + int windowBits, int memLevel, + int strategy, const char *version, + int stream_size)); +ZEXTERN int ZEXPORT inflateInit2_ OF((z_streamp strm, int windowBits, + const char *version, int stream_size)); +ZEXTERN int ZEXPORT inflateBackInit_ OF((z_streamp strm, int windowBits, + unsigned char FAR *window, + const char *version, + int stream_size)); +#define deflateInit(strm, level) \ + deflateInit_((strm), (level), ZLIB_VERSION, sizeof(z_stream)) +#define inflateInit(strm) \ + inflateInit_((strm), ZLIB_VERSION, sizeof(z_stream)) +#define deflateInit2(strm, level, method, windowBits, memLevel, strategy) \ + deflateInit2_((strm),(level),(method),(windowBits),(memLevel),\ + (strategy), ZLIB_VERSION, sizeof(z_stream)) +#define inflateInit2(strm, windowBits) \ + inflateInit2_((strm), (windowBits), ZLIB_VERSION, sizeof(z_stream)) +#define inflateBackInit(strm, windowBits, window) \ + inflateBackInit_((strm), (windowBits), (window), \ + ZLIB_VERSION, sizeof(z_stream)) + + +#if !defined(ZUTIL_H) && !defined(NO_DUMMY_DECL) + struct internal_state {int dummy;}; /* hack for buggy compilers */ +#endif + +ZEXTERN const char * ZEXPORT zError OF((int)); +ZEXTERN int ZEXPORT inflateSyncPoint OF((z_streamp z)); +ZEXTERN const uLongf * ZEXPORT get_crc_table OF((void)); + +#ifdef __cplusplus +} +#endif + +#endif /* ZLIB_H */
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/SNV/annotate.py Wed Oct 12 19:50:38 2011 -0400 @@ -0,0 +1,80 @@ +#!/usr/bin/env python + +""" +Annotates filtered SNVMix output that has been attached to codon information (outputs the same data with additional columns describing the predicted effect of the SNV) + +usage: %prog [options] + -i, --input1=i: bam file + -o, --output1=o: Output pileup +""" + +import os, shutil, subprocess, sys, tempfile +from galaxy import eggs +import pkg_resources; pkg_resources.require( "bx-python" ) +from bx.cookbook import doc_optparse + + + +def stop_err( msg ): + sys.stderr.write( '%s\n' % msg ) + sys.exit() + +def check_seq_file( dbkey, GALAXY_DATA_INDEX_DIR ): + seqFile = '%s/sam_fa_indices.loc' % GALAXY_DATA_INDEX_DIR + seqPath = '' + for line in open( seqFile ): + line = line.rstrip( '\r\n' ) + if line and not line.startswith( '#' ) and line.startswith( 'index' ): + fields = line.split( '\t' ) + if len( fields ) < 3: + continue + if fields[1] == dbkey: + seqPath = fields[2].strip() + break + return seqPath + +def __main__(): + #Parse Command Line + options, args = doc_optparse.parse( __doc__ ) + #make temp dir + tmpDir = tempfile.mkdtemp() + + cmd = 'identify_nonsynonymous_mutations.pl < %s > %s' + try: + # have to nest try-except in try-finally to handle 2.4 + try: + cmd = cmd % ( options.input1, options.output1 ) + print(cmd, "\n") + tmp = tempfile.NamedTemporaryFile( dir=tmpDir ).name + tmp_stderr = open( tmp, 'wb' ) + + proc = subprocess.Popen( args=cmd, shell=True, cwd=tmpDir, stderr=tmp_stderr.fileno() ) + returncode = proc.wait() + tmp_stderr.close() + #did it succeed? + # get stderr, allowing for case where it's very large + tmp_stderr = open( tmp, 'rb' ) + stderr = '' + try: + while True: + stderr += tmp_stderr.read( ) + if not stderr: + break + except OverflowError: + pass + tmp_stderr.close() + if returncode != 0: + raise Exception, stderr + except Exception, e: + stop_err( 'Error running annotator tool\n' + str( e ) ) + finally: + #clean up temp files + if os.path.exists( tmpDir ): + shutil.rmtree( tmpDir ) + # check that there are results in the output file + if os.path.getsize( options.output1 ) > 0: + sys.stdout.write( 'wrote annotated output' ) + else: + stop_err( 'The output file is empty' ) + +if __name__ == "__main__" : __main__()
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/SNV/annotate.xml Wed Oct 12 19:50:38 2011 -0400 @@ -0,0 +1,38 @@ +<tool id="snv_annotate" name="SNV Annotator"> + <requirements> + <requirement type="package">SNVMix</requirement> + </requirements> + <description>Annotates filtered SNVMix output that has been attached to codon information (outputs the same data with additional columns describing the predicted effect of the SNV)</description> + <command interpreter="python"> + annotate.py + -i $input_codon + -o $output_anno + </command> + <inputs> + <param name="input_codon" type="data" format="tabular" label="Select the codon-linked file to annotate" /> +</inputs> + + <outputs> + <data format="tabular" name="output_anno" label="${tool.name}: annotated SNV calls" /> + </outputs> + <help> + +**What it does** +Annotates filtered SNVMix output that has been attached to codon information (outputs the same data with additional columns describing the predicted effect of the SNV). +Requires input produced by the "SNP filtering and pre-annotation" tool + +The additional columns are as follows: +1) Mutated form of the codon +2) Reference amino acid at that position +3) mutant amino acid at that position +4) CODING or SYNONYMOUS +5) Mutation with position and wild-type amino acid (separated by semicolon for genes with multiple transcripts) + +Example input: +chr7:148139660 ENSG00000106462 -1 TAC 2 602;646; ENST00000350995;ENST00000320356; T A T:39,A:25,0.0000000000,1.0000000000,0.0000000000,2 + +Example output: +chr7:148139660 ENSG00000106462 -1 TAC 2 602;646; ENST00000350995;ENST00000320356; T A T:39,A:25,0.0000000000,1.0000000000,0.0000000000,2 TTC Y F CODING Y602F;Y646F + + </help> +</tool>
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/SNV/filter_snvmix.pl Wed Oct 12 19:50:38 2011 -0400 @@ -0,0 +1,89 @@ +#!/usr/bin/perl +use strict; +use Getopt::Std; +use vars qw($opt_d $opt_p $opt_c $opt_C $opt_i $opt_S $opt_P $opt_I); +getopts("d:cC:i:p:SPI:"); + +my $usage = "$0 -p nonref_p-value_threshold [0.99] -c track_sequenced_bases -d minimum_nonref_depth [2] -C minimum_number_of_read_centered_calls [1] -i max_num_indels [0] -S need_dual_strand_coverage [0] -P use_unpaired_reads_too"; + +#chr:pos ref nref ref:ref_count,nref:nref_count,pAA,pAB,pBB,maxPr+ r- n+ n- nC nE nD +#chr:pos ref nref ref:ref_count,nref:nref_count,pAA,pAB,pBB,maxP ref_fwd ref_rev nref_fwd nref_rev nref_center nref_edges indel_pos ref_clean nref_clean ref_bad_pair nref_bad_pair ref_ins nref_ins ref_del nref_del ref_junc nref_junc nref_in_unique_pos +my $nonref_depth_thresh = $opt_d || 2; +my $min_centered = $opt_C || 1; +my $max_indels = $opt_i || 0; +my $dual_strand = $opt_S; +my $p_threshold = $opt_p || 0.99; +my $track_sequenced_bases = $opt_c; +my $pair_filtering = 1; +my $max_indel_relative = $opt_I; #filter on proportion of indels at SNV position relative to nonref calls. E.g. 0.5 would allow 1/2 the number of indel reads at that position vs indels. +if($opt_P){ + $pair_filtering = 0; +} +while(<STDIN>){ + chomp; + my ($chrpos,$ref,$nonref,$info,$ref_plus,$ref_minus,$nonref_plus,$nonref_minus,$centered,$ended,$indels,$ref_clean,$nonref_clean,$ref_bad_pair,$nonref_bad_pair,$ref_ins,$nonref_ins,$ref_del,$nonref_del,$ref_junc,$nref_junc,$nonref_in_unique_pos) = split; + my $ok; + my ($ref_info, $nref_info, $pAA, $pAB, $pBB, $call) = split(/,/, $info); + my $skip; + if($track_sequenced_bases){ + $skip = 1 if $call == 1; + } + else{ + next if $call == 1; + } + my $is_sequenced; + my ($foo,$nref_num) = split /:/, $nref_info; + if($pAA < ($pAB + $pBB)) { + if( ($pAB + $pBB) >= $p_threshold) { + $is_sequenced = $pAB+$pBB; + } + else{ + next; + } + } + else{ + if($track_sequenced_bases){ + if($pAA >= $p_threshold){ + $is_sequenced = $pAA; + } +# print STDERR "skip $skip\n"; + $skip = 1; + } + else{ + next; + } + + } + + if($track_sequenced_bases){ + if($is_sequenced){ + print STDERR "$chrpos\t$is_sequenced\n"; + } + next if $skip; + } + if($indels <= $max_indels && $centered >= $min_centered && $nref_num >= $nonref_depth_thresh){ + if($dual_strand){ + $ok=1 if $nonref_minus > 0 && $nonref_plus > 0; + } + else{ + $ok= 1; + } + } + else{ + #print "$_ FAIL\n$indels <= $max_indels && $centered >= $min_centered && $nref_num >= $nonref_depth_thresh\n"; + } +# if($nonref_bad_pair > ($nonref_plus+$nonref_minus)/2){ + if($nonref_bad_pair > 1 && $pair_filtering){ + #Rodrigo's bad pair filter fail + #print STDERR "skipping $chrpos due to $nonref_bad_pair > ($nonref_plus+$nonref_minus)/2\n"; + $ok = 0; + + } + + unless($chrpos =~ /^chr/){ + $chrpos = "chr$chrpos"; + } + if($ok){ + print "$chrpos\t$ref\t$nonref\t$info\n"; + } +}
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/SNV/filter_snvmix.py Wed Oct 12 19:50:38 2011 -0400 @@ -0,0 +1,69 @@ +#!/usr/bin/env python + +""" +Filters raw SNVmix output on posterior probability (keeps SNVs with sum of pAB and pBB > 0.99) +Also requires SNV to be supported by at least one 'centered' base call +Can also filter SNVs adjacent to indels (-i) and require SNVs supported by both strands (-S) + +usage: %prog [options] + -s, --input1=s: raw snvmix output file + -o, --output1=o: filtered snvmix file + -i, --max_indels=i: max number of indels in reads allowed + -S, --dual_strand=S: require dual-strand coverage + +""" + +import os, shutil, subprocess, sys, tempfile +from galaxy import eggs +import pkg_resources; pkg_resources.require( "bx-python" ) +from bx.cookbook import doc_optparse + +def stop_err( msg ): + sys.stderr.write( '%s\n' % msg ) + sys.exit() + +def __main__(): + #Parse Command Line + options, args = doc_optparse.parse( __doc__ ) + tmpDir = tempfile.mkdtemp() + #prepare basic filter_snvmix command + cmd = "filter_snvmix.pl " + if options.dual_strand == 'yes': + cmd = cmd + " -S" + if options.max_indels: + cmd = cmd + " -i " + options.max_indels + " " + cmd = cmd + '< %s > %s' + try: + cmd = cmd % ( options.input1, options.output1) + #run command + print(cmd) + tmp = tempfile.NamedTemporaryFile( dir=tmpDir ).name + tmp_stderr = open( tmp, 'wb' ) + proc = subprocess.Popen( args=cmd, shell=True, cwd=tmpDir, stderr=tmp_stderr.fileno() ) + returncode = proc.wait() + tmp_stderr.close() + #did it succeed? + # get stderr, allowing for case where it's very large + tmp_stderr = open( tmp, 'rb' ) + stderr = '' + buffsize = 1048576 + try: + while True: + stderr += tmp_stderr.read( buffsize ) + if not stderr or len( stderr ) % buffsize != 0: + break + except OverflowError: + pass + tmp_stderr.close() + if returncode != 0: + raise Exception, stderr + except Exception, e: + stop_err( 'Error running filter_snvmix tool\n' + str( e ) ) + + # check that there are results in the output file + if os.path.getsize( options.output1 ) > 0: + sys.stdout.write( 'wrote SNVMix output' ) + else: + stop_err( 'The output file is empty. Your input file may have had no matches, or there may be an error with your input file or settings.' ) + +if __name__ == "__main__" : __main__()
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/SNV/filter_snvmix.xml Wed Oct 12 19:50:38 2011 -0400 @@ -0,0 +1,32 @@ +<tool id="filter_snvmix" name="SNVMix filter"> + <requirements> + <requirement type="package">SNVMix</requirement> + </requirements> + <description>post-filtration for SNVMix calls</description> + <command interpreter="python"> + filter_snvmix.py + -s $input1 + -o $output1 + -S $require_dual_strand + -i $max_indels + </command> + <inputs> + <param name="input1" type="data" format="tabular" label="Select the raw SNVMix output to be filtered"></param> + <param name="require_dual_strand" type="select" label="Require support from both strands? (recommended)"> + <option selected="true" value="yes">Yes</option> + <option value="no">No</option> + </param> + <param name="max_indels" type="integer" value="2" label="maximum number of indels in reads supporting variant"> + </param> + </inputs> + <outputs> + <data format="tabular" name="output1" label="${tool.name}: Filtered SNVMix calls" /> + </outputs> + <help> + +**What it does** + +This tool uses a set of thresholds on SNVMix p value and sequence context to reduce the list to likely true variants + + </help> +</tool>
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/SNV/filter_snvmix_somatic.py Wed Oct 12 19:50:38 2011 -0400 @@ -0,0 +1,67 @@ +#!/usr/bin/env python + +""" +Identifies sites with strong evidence for no variant (to be used on SNVMix output from matched normal samples) + +usage: %prog [options] + -n, --input1=n: raw snvmix output file from normal + -t, --input2=t: annoated snvmix output from tumour + -o, --output1=o: sorted list of germline sites + -p, --posterior=p: threshold for posterior probability of AA + -d, --max_nonref_depth=d: maximum number of non-reference bases allowed at site + +""" + +import os, shutil, subprocess, sys, tempfile +from galaxy import eggs +import pkg_resources; pkg_resources.require( "bx-python" ) +from bx.cookbook import doc_optparse +import re + +def stop_err( msg ): + sys.stderr.write( '%s\n' % msg ) + sys.exit() + +def __main__(): + #Parse Command Line + options, args = doc_optparse.parse( __doc__ ) + input = open(options.input1, 'r') + tmpDir = tempfile.mkdtemp() + output = tempfile.NamedTemporaryFile(mode='w',delete=False) + min_p = options.posterior + max_d = int(options.max_nonref_depth) + for line in input: + cols = line.split() + #expect input to look like this: + #1:10143872 C N C:44,N:0,1.0000000000,0.0000000000,0.0000000000,1 + data = cols[3] + #print data + data_list = data.split(',') + nref_val = data_list[1] + ref_p = data_list[2] + nref_depth = int(nref_val.split(":")[1]) + #print nref_depth, 'vs', max_d + if ref_p >= min_p and nref_depth <= max_d: + #print nref_depth, '<=', max_d + has_chr = re.match("chr",cols[0]) + if not has_chr: + output.write("chr") + output.write(cols[0]) + output.write("\n") + output_file_nosort = output.name + + output.close() + cmd = 'sort -S 2000M %s | join - %s > %s' + cmd = cmd % (output_file_nosort,options.input2,options.output1) + proc = subprocess.Popen( args=cmd, shell=True, cwd=tmpDir) + + returncode = proc.wait() + if os.path.getsize( options.output1 ) > 0: + sys.stdout.write( 'wrote filtered output' ) + else: + stop_err( 'The output file is empty. Your input file may have had no matches, or there may be an error with your input file or settings.' ) + #clean up temp files + if os.path.exists( tmpDir ): + shutil.rmtree( tmpDir ) + +if __name__ == "__main__" : __main__()
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/SNV/filter_snvmix_somatic.xml Wed Oct 12 19:50:38 2011 -0400 @@ -0,0 +1,36 @@ +<tool id="snvmix_somatic_filter" name="Get somatic positions from germline SNVMix output" version="0.12.1-rc1"> + <requirements> + <requirement type="package">SNVMix</requirement> + </requirements> + <description>Takes SNVMix output from a set of specific sites in a bam file from a matched normal sample and the SNV calls from the tumour to identify and report high-confidence somatic mutations</description> + <command interpreter="python"> + filter_snvmix_somatic.py + -n $input1 + -t $input2 + -o $output1 + -p $posterior + -d $nonref_support + </command> + <inputs> + <param name="input1" type="data" format="tabular" label="Select the SNVMix raw output from your normal library" /> + <param name="input2" type="data" format="tabular" label="Select the annotated SNV calls from your tumour library" /> + <param name="posterior" type="float" value="0.999" label="Choose a minimum value for the reference state posterior probability p(AA)" /> + <param name="nonref_support" type="integer" value="2" label="Choose a maximum number of non-reference base calls allowed at a site" /> + </inputs> + <outputs> + <data format="tabular" name="output1" label="${tool.name}: Somatic positions" /> + </outputs> + <help> + +**What it does** +Takes the positions identified as SNVs by SNVMix in a tumour sample and compares them to raw SNVMix output from the matched "normal" sequence from the same individual. +The input from the normal must have run SNVMix with the -f (full) option ("SNVMix at selected positions" tool). +The -p option (posterior) is then used to retain only the variants with a strong posterior probability of being "reference" at each position. +These are the high-confidence somatic SNV calls. Variants can be further thresholded for enhanced stringency using the -d (nonref_support) option. +If more than -d non-reference reads exist at the site, the SNV is also considered a "germ line" event and not reported as somatic. This process returns +only the sites that can be confidently identified as somatic. Thus, with limiting or no coverage at the corresponding position in the germ line, +some true somatic sites may not be identified. + + + </help> +</tool>
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/SNV/identify_nonsynonymous_mutations.pl Wed Oct 12 19:50:38 2011 -0400 @@ -0,0 +1,223 @@ +#!/usr/bin/perl +#Author: Ryan Morin (rmorin@bcgsc.ca) +#last modified February, 2010 to match improvements to codon lookup table +#Script to annotate files that have been joined with an appropriate 'codon lookup' table. +#example usage: sort -k 1 snp_file.txt | join codon_lookup.sort - | this_script.pl +#Transcript information and amino acid/codon position information is used to report the amino acid change in this format: N123M where N is the original amino acid at position 123 and M is the new amino acid. +#Transcripts with the same reading frame for position 123 are separated by commas. Distinct reading frames for the affected position are separated by a semi-colon (e.g. 123 = 155 in another isoform) +#an example of the codon lookup table: +#chr10:101658781 ENSG00000107554 -1 GAA 3 37;79;791; ENST00000393570;ENST00000370423;ENST00000324109,ENST00000342239; +#hence, chr10:101658781 corresponds to the third position in a GAA codon which is amino acid 791 in both ENST00000324109 ENST00000342239, amino acid 79 in ENST00000370423 and 37 in ENST00000393570 + +use strict; +use Data::Dumper; +use Getopt::Std; +use vars qw($opt_h); +getopts("h"); + +my %lookup; + +load_ambig(); +my %codons = codons(); + +my $requested_header = $opt_h; + +my $header_printed; +if($requested_header){ + $header_printed = 0; +} +else{ + $header_printed = 1; +} +while(<STDIN>){ + + chomp; + my $line = $_; + + my @cols = split /\s/, $line; + my $ncols = @cols; + unless($header_printed){ + print "\#CHR:POSITION GENE STRAND REF_CODON CODON_POSITION REFBASE IUPAC_BASE_CALL MINOR_ALLELE_REPRESENTATION NEW_CODON REF_AA NEW_AA STATUS"; + print "\n"; + $header_printed = 1; + } + + my $gene = $cols[1]; + my $strand = $cols[2]; + my $codon = $cols[3]; + unless ($codon =~ /[ACTG]{3}/){ + print "\n"; + next; + } + my $codon_pos = $cols[4]; + my $aa_pos = $cols[5]; + my @transcript_strings = split /;/, $cols[6]; + + my $ref = uc($cols[7]); + my $amb = uc($cols[8]); + my $mut = amb_lookup($amb,$ref,$cols[0]); + next if $mut == -1; + my $mut_cor = $mut; + + my $ref_cor = $ref; + if($strand < 0){ + $mut_cor =~ tr/ACTG/TGAC/; + $ref_cor =~ tr/ACTG/TGAC/; + } + my @three = split //, $codon; + #sanity check + + my $codon_ind = $codon_pos -1; + my $orig = $three[$codon_ind]; + if($orig ne $ref_cor){ + print STDERR "$cols[0]\tERROR, base $ref is not the same as codon position $codon_pos ($orig)\n"; + s/1\s\w{3}\s\d\s/1 UNKNOWN 0 /; + print "$line"; + print " UNKNOWN\n"; + next; + + } + else{ + #ok, print normal leader line and continue to downstream work + print "$line"; + } + $three[$codon_ind] = $mut_cor; + my $new_codon = join "", @three; + print " $new_codon "; + + my $old_aa = translate($codon); + my $new_aa = translate($new_codon); + + my $type = "CODING"; + if($old_aa eq $new_aa){ + $type = "SYNONYMOUS"; + } + + my $aa_string; + + my @aa_positions = split /;/, $aa_pos; + for(my $i = 0;$i<@aa_positions;$i++){ + my $string = $old_aa . $aa_positions[$i] . $new_aa; + $aa_string .= "$string;"; + } + chop($aa_string); + print "$old_aa $new_aa $type $aa_string\n"; +} + +sub amb_lookup{ + my $amb = shift; + my $ref = shift; + my $pos = shift; + if($amb =~ /[ACTG]/){ + #print "$amb\n"; + return($amb); + } + #print "LOOKUP: $amb\n"; + my @all = @{$lookup{$amb}}; + #print Dumper @all; + my @some; + for(@all){ + next if $_ eq $ref; + push @some, $_; + + } + if(@some > 1){ + #print Dumper @some; + print STDERR "$pos\t$ref\t$amb\ttwo bases at this position, neither is reference\n"; + return(-1); + } + return($some[0]); +} + +sub load_ambig{ + add('M',qw(A C)); + add('R',qw(A G)); + add('W',qw(A T)); + add('S',qw(C G)); + add('Y',qw(T C)); + add('K',qw(T G)); + add('V',qw(A C G)); + add('H',qw(A C T)); + add('D',qw(A G T)); + add('B',qw(C G T)); +} + +sub add{ + + my $amb = shift; + my @copy = @_; + $lookup{$amb} = \@copy; +} +sub translate{ + my $codon = shift; + return($codons{$codon}); +} +sub codons{ + my %codons = ( + 'TCA' => 'S', # Serine + 'TCC' => 'S', # Serine + 'TCG' => 'S', # Serine + 'TCT' => 'S', # Serine + 'TTC' => 'F', # Phenylalanine + 'TTT' => 'F', # Phenylalanine + 'TTA' => 'L', # Leucine + 'TTG' => 'L', # Leucine + 'TAC' => 'Y', # Tyrosine + 'TAT' => 'Y', # Tyrosine + 'TAA' => '*', # Stop + 'TAG' => '*', # Stop + 'TGC' => 'C', # Cysteine + 'TGT' => 'C', # Cysteine + 'TGA' => '*', # Stop + 'TGG' => 'W', # Tryptophan + 'CTA' => 'L', # Leucine + 'CTC' => 'L', # Leucine + 'CTG' => 'L', # Leucine + 'CTT' => 'L', # Leucine + 'CCA' => 'P', # Proline + 'CCC' => 'P', # Proline + 'CCG' => 'P', # Proline + 'CCT' => 'P', # Proline + 'CAC' => 'H', # Histidine + 'CAT' => 'H', # Histidine + 'CAA' => 'Q', # Glutamine + 'CAG' => 'Q', # Glutamine + 'CGA' => 'R', # Arginine + 'CGC' => 'R', # Arginine + 'CGG' => 'R', # Arginine + 'CGT' => 'R', # Arginine + 'ATA' => 'I', # Isoleucine + 'ATC' => 'I', # Isoleucine + 'ATT' => 'I', # Isoleucine + 'ATG' => 'M', # Methionine + 'ACA' => 'T', # Threonine + 'ACC' => 'T', # Threonine + 'ACG' => 'T', # Threonine + 'ACT' => 'T', # Threonine + 'AAC' => 'N', # Asparagine + 'AAT' => 'N', # Asparagine + 'AAA' => 'K', # Lysine + 'AAG' => 'K', # Lysine + 'AGC' => 'S', # Serine + 'AGT' => 'S', # Serine + 'AGA' => 'R', # Arginine + 'AGG' => 'R', # Arginine + 'GTA' => 'V', # Valine + 'GTC' => 'V', # Valine + 'GTG' => 'V', # Valine + 'GTT' => 'V', # Valine + 'GCA' => 'A', # Alanine + 'GCC' => 'A', # Alanine + 'GCG' => 'A', # Alanine + 'GCT' => 'A', # Alanine + 'GAC' => 'D', # Aspartic Acid + 'GAT' => 'D', # Aspartic Acid + 'GAA' => 'E', # Glutamic Acid + 'GAG' => 'E', # Glutamic Acid + 'GGA' => 'G', # Glycine + 'GGC' => 'G', # Glycine + 'GGG' => 'G', # Glycine + 'GGT' => 'G', # Glycine + ); + return(%codons); +}
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/SNV/snp_filters.py Wed Oct 12 19:50:38 2011 -0400 @@ -0,0 +1,97 @@ +#!/usr/bin/env python + +""" +Creates a pileup file from a bam file and a reference. + +usage: %prog [options] + -i, --input=i: raw snp call file chr:pos + -o, --output1=o: novel snp calls in file + -c, --output2=c: filtered novel SNPs associated with codons + -K, --known_snps=k: known SNPs for filtering (sorted chr:pos file) + -C, --codon=C: codon lookup file (sorted chr:pos) + +""" + +#my $cmd7 = "sort -S 2000M -k 1 $snps | join -a 1 - $known | grep -v dbS | grep -v Vent | grep -v Yor | grep -v Wats | sort -S 2000 -k 1 > $out"; +#my $cmd8 = "join $codon $snps\_novel.txt > $snps\_novel." . $base . "codon"; + +import os, shutil, subprocess, sys, tempfile +from galaxy import eggs +import pkg_resources; pkg_resources.require( "bx-python" ) +from bx.cookbook import doc_optparse + +def stop_err( msg ): + sys.stderr.write( '%s\n' % msg ) + sys.exit() + +def __main__(): + #Parse Command Line + options, args = doc_optparse.parse( __doc__ ) +# if options.known_snps == "" or options.input == "" or options.codon or "": +# print('Error, required arguments not provided\n') + # return(1) + tmpDir = tempfile.mkdtemp() + #prepare basic filter_snvmix command + filter_cmd = "sort -S 2G -k 1 %s | join -a 1 - %s | grep -v dbS | grep -v Vent | grep -v Yor | grep -v Wats | sort -S 2G -k 1 > %s" + try: + filter_cmd = filter_cmd % ( options.input, options.known_snps, options.output1 ) + #run command + #print(filter_cmd) + tmp = tempfile.NamedTemporaryFile( dir=tmpDir ).name + tmp_stderr = open( tmp, 'wb' ) + proc = subprocess.Popen( args=filter_cmd, shell=True, cwd=tmpDir, stderr=tmp_stderr.fileno() ) + returncode = proc.wait() + tmp_stderr.close() + #did it succeed? + # get stderr, allowing for case where it's very large + tmp_stderr = open( tmp, 'rb' ) + stderr = '' + while True: + stderr += tmp_stderr.read( ) + if not stderr: + break + tmp_stderr.close() + if returncode != 0: + raise Exception, stderr + except Exception, e: + stop_err( 'Error running filter command\n' + str( e ) ) + + # check that there are results in the output file + if os.path.getsize( options.output1 ) > 0: + sys.stdout.write( 'wrote output1' ) + else: + stop_err( 'The output file is empty. All SNVs might have been known or there may be an error with your input file or settings.' ) + + codon_cmd = "join %s %s > %s" + try: + codon_cmd = codon_cmd % ( options.codon, options.output1, options.output2 ) + #run command + #print(codon_cmd) + tmp = tempfile.NamedTemporaryFile( dir=tmpDir ).name + tmp_stderr = open( tmp, 'wb' ) + proc = subprocess.Popen( args=codon_cmd, shell=True, cwd=tmpDir, stderr=tmp_stderr.fileno() ) + returncode = proc.wait() + tmp_stderr.close() + #did it succeed? + # get stderr, allowing for case where it's very large + tmp_stderr = open( tmp, 'rb' ) + stderr = '' + while True: + stderr += tmp_stderr.read() + if not stderr: + break + tmp_stderr.close() + if returncode != 0: + raise Exception, stderr + except Exception, e: + stop_err( 'Error running codon command\n' + str( e ) ) + + # check that there are results in the output file + if os.path.getsize( options.output1 ) > 0: + sys.stdout.write( 'wrote output2' ) + else: + stop_err( 'The output file is empty. All SNVs might have been intronic or intergenic or there may be an error with your input file or settings.' ) + + + +if __name__ == "__main__" : __main__()
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/SNV/snp_filters.xml Wed Oct 12 19:50:38 2011 -0400 @@ -0,0 +1,28 @@ +<tool id="snp_filters" name="SNP filtering and pre-annotation"> + <requirements> + <requirement type="package">SNVMix</requirement> + </requirements> + <description>further filtering and annotation of SNVMix calls</description> + <command interpreter="python"> + snp_filters.py + -i $input1 + -o $output1 + -c $output2 + -C $codon_resource + -K $known_snp_resource + </command> + <inputs> + <param name="input1" type="data" format="tabular" label="Select the filtered SNVMix output"></param> + <param name="codon_resource" type="data" format="tabular" label="Select the codon_lookup file"></param> + <param name="known_snp_resource" type="data" format="tabular" label="Select the all_known_snps file"></param> + </inputs> + <outputs> + <data format="tabular" name="output1" label="${tool.name}: non-SNP positions" /> + <data format="tabular" name="output2" label="${tool.name}: Codon-associated non-SNP positions" /> + </outputs> + <help> + +**What it does** + + </help> +</tool>
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/SNV/snvmix.py Wed Oct 12 19:50:38 2011 -0400 @@ -0,0 +1,109 @@ +#!/usr/bin/env python + +""" +Runs the SNVMix2 binary on a bam input file with various options. + +usage: %prog [options] + -i, --input1=i: bam file + -o, --output1=o: Output SNVMix (raw) + -d, --dbkey=d: dbkey of user-supplied file + -x, --indexDir=x: index directory + -t, --type=t: analysis type (e.g. mb|m|b|M|Mb|MB|SNVMix1) + -q, --base=q: base qual threshold + -Q, --map=Q: map qual threshold + -l, --pos=l: position file + -f, --full=f: Full mode (output scores for every position) + -R, --keep_dups: Retain reads flagged as duplicates (not recommended!) + -c, --keep_chastity: Retain reads that failed the chastity filter +""" + +import os, shutil, subprocess, sys, tempfile +from galaxy import eggs +import pkg_resources; pkg_resources.require( "bx-python" ) +from bx.cookbook import doc_optparse + + + +def stop_err( msg ): + sys.stderr.write( '%s\n' % msg ) + sys.exit() + +def check_seq_file( dbkey, GALAXY_DATA_INDEX_DIR ): + seqFile = '%s/sam_fa_indices.loc' % GALAXY_DATA_INDEX_DIR + seqPath = '' + for line in open( seqFile ): + line = line.rstrip( '\r\n' ) + if line and not line.startswith( '#' ) and line.startswith( 'index' ): + fields = line.split( '\t' ) + if len( fields ) < 3: + continue + if fields[1] == dbkey: + seqPath = fields[2].strip() + break + return seqPath + +def __main__(): + #Parse Command Line + options, args = doc_optparse.parse( __doc__ ) + seqPath = check_seq_file( options.dbkey, options.indexDir ) + + #make temp dir + tmpDir = tempfile.mkdtemp() + + #prepare basic SNVMix2 command + cmd = 'SNVMix2 -p b -i %s -r %s -o %s -q %s -Q %s -t %s' + try: + # have to nest try-except in try-finally to handle 2.4 + try: + if not os.path.exists( "%s.fai" % seqPath ): + raise Exception, "No sequences are available for '%s', request them by reporting this error." % options.dbkey + cmd = cmd % ( options.input1, seqPath, options.output1, options.base, options.map, options.type) + + if options.pos != "none": + if os.path.isfile(options.pos): + cmd = cmd + ' -l ' + options.pos + if options.full == "yes": + cmd = cmd + ' -f ' + else: + raise Exception, "position file doesn't exist" + + if options.keep_chastity == "yes": + cmd = cmd + ' -c' + if options.keep_dups == "yes": + cmd = cmd + ' -R' + + #perform SNVMix2 command + tmp = tempfile.NamedTemporaryFile( dir=tmpDir ).name + tmp_stderr = open( tmp, 'wb' ) + + proc = subprocess.Popen( args=cmd, shell=True, cwd=tmpDir, stderr=tmp_stderr.fileno() ) + returncode = proc.wait() + tmp_stderr.close() + #did it succeed? + # get stderr, allowing for case where it's very large + tmp_stderr = open( tmp, 'rb' ) + stderr = '' + buffsize = 1048576 + try: + while True: + stderr += tmp_stderr.read( buffsize ) + if not stderr or len( stderr ) % buffsize != 0: + break + except OverflowError: + pass + tmp_stderr.close() + if returncode != 0: + raise Exception, stderr + except Exception, e: + stop_err( 'Error running SNVMix2 tool\n' + str( e ) ) + finally: + #clean up temp files + if os.path.exists( tmpDir ): + shutil.rmtree( tmpDir ) + # check that there are results in the output file + if os.path.getsize( options.output1 ) > 0: + sys.stdout.write( 'wrote SNVMix output' ) + else: + stop_err( 'The output file is empty. Your input file may have had no matches, or there may be an error with your input file or settings.' ) + +if __name__ == "__main__" : __main__()
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/SNV/snvmix.xml Wed Oct 12 19:50:38 2011 -0400 @@ -0,0 +1,85 @@ +<tool id="snvmix" name="SNVMix" version="0.12.1-rc1"> + <requirements> + <requirement type="package">SNVMix</requirement> + </requirements> + <description>performs SNV calling on a bam file</description> + <command interpreter="python"> + snvmix.py + -i $input1 + -d ${input1.metadata.dbkey} + -o $output_snvmix + -t $type + #if $positionFile == "yes": + -l $pos + #else: + -l 'none' + #end if + -x ${GALAXY_DATA_INDEX_DIR} + -q $q + -Q $Q + -f $full + -R $keep_dups + -c $keep_chastity + </command> + <inputs> + <param name="type" type="select" label="model used"> + <option value="MB">Filter on map quality AND base quality (MB)</option> + <option value="SNVMix1">SNVMix1</option> + <option value="mb">Lowest between map and base quality is used (mb)</option> + <option value="m">Filter on map quality and use as a surrogate for base quality (m)</option> + <option value="b">Filter on base quality and set map quality to 1 (b)</option> + <option value="Mb">Filter on map quality and use both map and base qualities (Mb)</option> + </param> + <conditional name="refOrHistory"> + <param name="reference" type="select" label="Will you select a reference genome from your history or use a built-in index?"> + <option value="indexed">Use a built-in index</option> + <option value="history">Use one from the history</option> + </param> + <when value="indexed"> + <param name="input1" type="data" format="bam" label="Select the BAM file to generate the pileup file for"> + <validator type="unspecified_build" /> + <validator type="dataset_metadata_in_file" filename="sam_fa_indices.loc" metadata_name="dbkey" metadata_column="1" message="Sequences are not currently available for the specified build." line_startswith="index" /> + </param> + </when> + <when value="history"> + <param name="input1" type="data" format="bam" label="Select the BAM file to generate the pileup file for" /> + <param name="ownFile" type="data" format="fasta" metadata_name="dbkey" label="Select a reference genome" /> + </when> + </conditional> + <param name="q" type="integer" value="19" label="Cutoff Phred value for Base Quality, anything less than or equal to this value is ignored" /> + <param name="Q" type="integer" value="19" label="Cutoff Phred value for Map Quality, anything less than or equal to this value is ignored" /> + <conditional name="positionFile"> + <param name="positions" type="select" label="Will you provide a set of positions for SNV calling?"> + <option value="no">No, call variants at every position</option> + <option value="yes">Yes, select one from the history</option> + </param> + <when value="yes"> + <param name="pos" type="data" format="tabular" label="select the tab-delimited file containing positions"> + </param> + </when> + </conditional> + <param name="full" type="select" label="Do you want SNVMix to calculate probabilities for each of these positions? (only works in conjunction with above option)"> + <option value="no">No, I just want possible variants output</option> + <option value="yes">Yes (I know this could generate a huge file)</option> + </param> + <param name="keep_dups" type="select" label="Do you want SNVMix to include reads flagged as duplicates? (only works if Picard or some other tool has set this bit in your bam file"> + <option value="no">No (ignore duplicates for variant calling)</option> + <option value="yes">Yes (use all reads)</option> + </param> + <param name="keep_chastity" type="select" label="Do you want SNVMix to include reads flagged as failing the chastity filter? (only works if Picard or some other tool has set this bit in your bam file"> + <option value="no">No (ignore filtered reads for variant calling)</option> + <option value="yes">Yes (use all reads)</option> + </param> +</inputs> + + <outputs> + <data format="tabular" name="output_snvmix" label="${tool.name}: Raw SNVMix calls" /> + </outputs> + <help> + +**What it does** + +This tool uses the SNVMix model (Goya et al) to call single nucleotide variants (SNVs) from a bam file. The various models described in the study are provided (e.g. SNVMix1, MB, Mb etc.). The most commonly-used models are MB (the default) and SNVMix1. The former thresholds on base quality and mapping quality and uses both qualities in the variant prediction while the latter filters on both and only uses the allele counts in the model. The output is a tab-delimited file that should be passed through the accompanying filtering script prior to use. + + </help> +</tool>
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/SNV/snvmix2.xml Wed Oct 12 19:50:38 2011 -0400 @@ -0,0 +1,72 @@ +<tool id="snvmix2" name="SNVMix at selected positions" version="0.12.1-rc1"> + <requirements> + <requirement type="package">SNVMix</requirement> + </requirements> + <description>performs SNV calling on a bam file only at the positions provided</description> + <command interpreter="python"> + snvmix.py + -i $input1 + -d ${input1.metadata.dbkey} + -o $output_snvmix + -t $type + -l $pos + -x ${GALAXY_DATA_INDEX_DIR} + -q $q + -Q $Q + -f $full + -R $keep_dups + -c $keep_chastity + </command> + <inputs> + <param name="type" type="select" label="model used"> + <option value="MB">Filter on map quality AND base quality (MB)</option> + <option value="SNVMix1">SNVMix1</option> + <option value="mb">Lowest between map and base quality is used (mb)</option> + <option value="m">Filter on map quality and use as a surrogate for base quality (m)</option> + <option value="b">Filter on base quality and set map quality to 1 (b)</option> + <option value="Mb">Filter on map quality and use both map and base qualities (Mb)</option> + </param> + <conditional name="refOrHistory"> + <param name="reference" type="select" label="Will you select a reference genome from your history or use a built-in index?"> + <option value="indexed">Use a built-in index</option> + <option value="history">Use one from the history</option> + </param> + <when value="indexed"> + <param name="input1" type="data" format="bam" label="Select the BAM file to generate the pileup file for"> + <validator type="unspecified_build" /> + <validator type="dataset_metadata_in_file" filename="sam_fa_indices.loc" metadata_name="dbkey" metadata_column="1" message="Sequences are not currently available for the specified build." line_startswith="index" /> + </param> + </when> + <when value="history"> + <param name="input1" type="data" format="bam" label="Select the BAM file to generate the pileup file for" /> + <param name="ownFile" type="data" format="fasta" metadata_name="dbkey" label="Select a reference genome" /> + </when> + </conditional> + <param name="q" type="integer" value="19" label="Cutoff Phred value for Base Quality, anything less than or equal to this value is ignored" /> + <param name="Q" type="integer" value="19" label="Cutoff Phred value for Map Quality, anything less than or equal to this value is ignored" /> + <param name="pos" type="data" format="tabular" label="select the tab-delimited file containing positions" /> + <param name="full" type="select" label="Do you want SNVMix to calculate probabilities for each of these positions? (only works when a set of positions has been provided)"> + <option value="yes">Yes (I know this could generate a huge file)</option> + <option value="no">No, I just want possible variants output</option> + </param> + <param name="keep_dups" type="select" label="Do you want SNVMix to include reads flagged as duplicates? (only works if Picard or some other tool has set this bit in your bam file"> + <option value="no">No (ignore duplicates for variant calling)</option> + <option value="yes">Yes (use all reads)</option> + </param> + <param name="keep_chastity" type="select" label="Do you want SNVMix to include reads flagged as failing the chastity filter? (only works if Picard or some other tool has set this bit in your bam file"> + <option value="no">No (ignore filtered reads for variant calling)</option> + <option value="yes">Yes (use all reads)</option> + </param> +</inputs> + + <outputs> + <data format="tabular" name="output_snvmix" label="${tool.name}: Raw SNVMix calls" /> + </outputs> + <help> + +**What it does** + +This tool uses the SNVMix model (Rodrigo Goya et al, 2010) to call single nucleotide variants (SNVs) from a bam file at a restricted set of positions, similar to samtools pileup -l. This tools is typically used on a matched normal library for the identification of somatic mutations in combination with the SNVMix -f option (report probabilities at all positions). The input must be two columns, the first being the chromosome name and the second being the position. + + </help> +</tool>
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/SNV/tool-data/sam_fa_indeces.loc.sample Wed Oct 12 19:50:38 2011 -0400 @@ -0,0 +1,28 @@ +#This is a sample file distributed with Galaxy that enables tools +#to use a directory of Samtools indexed sequences data files. You will need +#to create these data files and then create a sam_fa_indices.loc file +#similar to this one (store it in this directory) that points to +#the directories in which those files are stored. The sam_fa_indices.loc +#file has this format (white space characters are TAB characters): +# +#index <seq> <location> +# +#So, for example, if you had hg18 indexed stored in +#/depot/data2/galaxy/sam/, +#then the sam_fa_indices.loc entry would look like this: +# +#index hg18 /depot/data2/galaxy/sam/hg18.fa +# +#and your /depot/data2/galaxy/sam/ directory +#would contain hg18.fa and hg18.fa.fai files: +# +#-rw-r--r-- 1 james universe 830134 2005-09-13 10:12 hg18.fa +#-rw-r--r-- 1 james universe 527388 2005-09-13 10:12 hg18.fa.fai +# +#Your sam_fa_indices.loc file should include an entry per line for +#each index set you have stored. The file in the path does actually +#exist, but it should never be directly used. Instead, the name serves +#as a prefix for the index file. For example: +# +#index hg18 /depot/data2/galaxy/sam/hg18.fa +#index hg19 /depot/data2/galaxy/sam/hg19.fa
