# HG changeset patch
# User scottx611x
# Date 1461692424 14400
# Node ID 620cb7a7ef60a95e1d589a7dbd10e01a171ccf11

Uploaded

diff -r 000000000000 -r 620cb7a7ef60 tophat2/._tool_dependencies.xml
Binary file tophat2/._tool_dependencies.xml has changed
diff -r 000000000000 -r 620cb7a7ef60 tophat2/._tophat2_wrapper.xml
Binary file tophat2/._tophat2_wrapper.xml has changed
diff -r 000000000000 -r 620cb7a7ef60 tophat2/._tophat_macros.xml
Binary file tophat2/._tophat_macros.xml has changed
diff -r 000000000000 -r 620cb7a7ef60 tophat2/test-data/bowtie2/tophat_test.1.bt2
Binary file tophat2/test-data/bowtie2/tophat_test.1.bt2 has changed
diff -r 000000000000 -r 620cb7a7ef60 tophat2/test-data/bowtie2/tophat_test.2.bt2
Binary file tophat2/test-data/bowtie2/tophat_test.2.bt2 has changed
diff -r 000000000000 -r 620cb7a7ef60 tophat2/test-data/bowtie2/tophat_test.3.bt2
Binary file tophat2/test-data/bowtie2/tophat_test.3.bt2 has changed
diff -r 000000000000 -r 620cb7a7ef60 tophat2/test-data/bowtie2/tophat_test.4.bt2
Binary file tophat2/test-data/bowtie2/tophat_test.4.bt2 has changed
diff -r 000000000000 -r 620cb7a7ef60 tophat2/test-data/bowtie2/tophat_test.fa
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/tophat2/test-data/bowtie2/tophat_test.fa	Tue Apr 26 13:40:24 2016 -0400
@@ -0,0 +1,14 @@
+>test_chromosome
+AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
+ACTACTATCTGACTAGACTGGAGGCGCTTGCGACTGAGCTAGGACGTGCC
+ACTACGGGGATGACGACTAGGACTACGGACGGACTTAGAGCGTCAGATGC
+AGCGACTGGACTATTTAGGACGATCGGACTGAGGAGGGCAGTAGGACGCT
+ACGTATTTGGCGCGCGGCGCTACGGCTGAGCGTCGAGCTTGCGATACGCC
+GTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
+AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAG
+ACTATTACTTTATTATCTTACTCGGACGTAGACGGATCGGCAACGGGACT
+GTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
+AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAG
+TTTTCTACTTGAGACTGGGATCGAGGCGGACTTTTTAGGACGGGACTTGC
+AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
+AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
diff -r 000000000000 -r 620cb7a7ef60 tophat2/test-data/bowtie2/tophat_test.rev.1.bt2
Binary file tophat2/test-data/bowtie2/tophat_test.rev.1.bt2 has changed
diff -r 000000000000 -r 620cb7a7ef60 tophat2/test-data/bowtie2/tophat_test.rev.2.bt2
Binary file tophat2/test-data/bowtie2/tophat_test.rev.2.bt2 has changed
diff -r 000000000000 -r 620cb7a7ef60 tophat2/test-data/bowtie2_indices.loc
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/tophat2/test-data/bowtie2_indices.loc	Tue Apr 26 13:40:24 2016 -0400
@@ -0,0 +1,1 @@
+tophat_test	tophat_test	tophat_test	${__HERE__}/bowtie2/tophat_test
diff -r 000000000000 -r 620cb7a7ef60 tophat2/test-data/tophat2_out1j.bed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/tophat2/test-data/tophat2_out1j.bed	Tue Apr 26 13:40:24 2016 -0400
@@ -0,0 +1,3 @@
+track name=junctions description="TopHat junctions"
+test_chromosome	180	400	JUNC00000001	19	+	180	400	255,0,0	2	70,50	0,170
+test_chromosome	350	550	JUNC00000002	23	+	350	550	255,0,0	2	50,50	0,150
diff -r 000000000000 -r 620cb7a7ef60 tophat2/test-data/tophat2_out2j.bed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/tophat2/test-data/tophat2_out2j.bed	Tue Apr 26 13:40:24 2016 -0400
@@ -0,0 +1,3 @@
+track name=junctions description="TopHat junctions"
+test_chromosome	179	400	JUNC00000001	37	+	179	400	255,0,0	2	71,50	0,171
+test_chromosome	350	550	JUNC00000002	37	+	350	550	255,0,0	2	50,50	0,150
diff -r 000000000000 -r 620cb7a7ef60 tophat2/test-data/tophat2_out3j.bed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/tophat2/test-data/tophat2_out3j.bed	Tue Apr 26 13:40:24 2016 -0400
@@ -0,0 +1,3 @@
+track name=junctions description="TopHat junctions"
+test_chromosome	180	400	JUNC00000001	19	+	180	400	255,0,0	2	70,50	0,170
+test_chromosome	350	550	JUNC00000002	23	+	350	550	255,0,0	2	50,50	0,150
diff -r 000000000000 -r 620cb7a7ef60 tophat2/test-data/tophat2_out4j.bed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/tophat2/test-data/tophat2_out4j.bed	Tue Apr 26 13:40:24 2016 -0400
@@ -0,0 +1,3 @@
+track name=junctions description="TopHat junctions"
+test_chromosome	177	400	JUNC00000001	44	+	177	400	255,0,0	2	73,50	0,173
+test_chromosome	350	550	JUNC00000002	42	+	350	550	255,0,0	2	50,50	0,150
diff -r 000000000000 -r 620cb7a7ef60 tophat2/test-data/tophat_in1.fasta
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/tophat2/test-data/tophat_in1.fasta	Tue Apr 26 13:40:24 2016 -0400
@@ -0,0 +1,14 @@
+>test_chromosome
+AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
+ACTACTATCTGACTAGACTGGAGGCGCTTGCGACTGAGCTAGGACGTGCC
+ACTACGGGGATGACGACTAGGACTACGGACGGACTTAGAGCGTCAGATGC
+AGCGACTGGACTATTTAGGACGATCGGACTGAGGAGGGCAGTAGGACGCT
+ACGTATTTGGCGCGCGGCGCTACGGCTGAGCGTCGAGCTTGCGATACGCC
+GTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
+AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAG
+ACTATTACTTTATTATCTTACTCGGACGTAGACGGATCGGCAACGGGACT
+GTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
+AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAG
+TTTTCTACTTGAGACTGGGATCGAGGCGGACTTTTTAGGACGGGACTTGC
+AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
+AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
diff -r 000000000000 -r 620cb7a7ef60 tophat2/test-data/tophat_in2.fastqsanger
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/tophat2/test-data/tophat_in2.fastqsanger	Tue Apr 26 13:40:24 2016 -0400
@@ -0,0 +1,400 @@
+@test_mRNA_150_290_0/1
+TCCTAAAAAGTCCGCCTCGGTCTCAGTCTCAAGTAGAAAAAGTCCCGTTGGCGATCCGTCTACGTCCGAGTAAGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_8_197_1/1
+TCTGACTAGACTGGAGGCGCTTGCGACTGAGCTAGGACGTGACACTACGGGGATGGCGACTAGGACTACGGACGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_82_255_2/1
+GAAAAAGTCCCGTTGCCGATCCGTCTACGTCCGAGTAATATAGTAAAGTAATAGTGGCGTATCGCAAGCTCGACG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_96_238_3/1
+GATCCGTCTACGTCCGCGTAAGATAATAAAGTACTAGTAGCGTATCGCAAGCTCGACGCTCAGCCGTAGGGCCGC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_72_258_4/1
+GTAGAAAAAGTCCCGTTGCCCATCCGTCTACGTCCGAGTAAGATAATAAAGTAATAGTGGCGTATCGCAAGCTCG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_107_286_5/1
+AAAAAGTCCGCCTCGATCCCAGTCTCAAGTAGAAAAAGTCCCGTTGCCGATCCGTCTACGTCCGAGTAAGATAAT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_122_299_6/1
+CAAGTCCCGTCCTAAAAAGTCCGCCTCGATCCCAGTCTCAAGTAGAAAAAGTCCCGTTGCCGCTCCGTCTACGTC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_58_234_7/1
+AGTCTACGTCCGAGTCAGATAATAAACTAATAGTGGCGTATCGCAAGCTCGACGCTCAGCCGTAGGGCCGCGCGC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_57_231_8/1
+GGGATGACGACTAGGACTACGGACGGACTTAGAGCGTCAGATGCACCGACTGGACTATTTAGGACGATCGGACTG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_8_155_9/1
+TACGTAGCGTCCTACTGCCCTCCTCAGTCCGATCGTCCTAAATAGTACAGTCGCTGCATCTGACGCTCGAAGTCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_51_237_a/1
+ACTACGGGGATGACGACTAGGACTACGGACGGACTTAGAGCGTCAGATGCAGCGACTGGACTATTTAGGACGATC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_89_230_b/1
+TACGTCCGAGTGAGTTAATAAAGTAATAGTGGCGTATCGCAAGCTCGACGCTCAGCCGTAGGGCCGCGCGCCAGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_105_276_c/1
+CCTCGATCCCAGTCTCAAGTAGAAAAAGCCCCGTTGCCGATCCGTCTACGTCCGAGTAAGATAATAAAGTAATAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_111_268_d/1
+CCAGTCTCAAGTAGAAAAAGTCCCGTTGCCGATCCGTCTACGTCCGAGTAAGATAATAAAATAATAGTGGCGTAT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_151_286_e/1
+ACGTATTTGGCGCGCGGCCGTACGGCTGAGCGTCGAGCTTGCGATACGCCACTATTACTTTATTATCTTACTCGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_118_297_f/1
+AGTCCCGTCCTAAAAAGTCCGCCTCGATCCCAGTCTCAAGTAGAAAAAGTCCCGTTGCCGATCCGTCTACGTCCG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_16_194_10/1
+TCGCAAGCTCGACGCTCAGCCGTAGGGCCGCGCGCCAAATACGTAGCGTCCTACTGCCCTCCTCAGTCCGATCGT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_28_188_11/1
+TTGCGACTGAGCTAGGACGTGCCACTACGGGGATGACGACTAGGACTACGAACGGACTTAGAGCGTCAGATGCAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_36_218_12/1
+GAGCTAGGACGTGCCACTACGGGGATGACGACTAGGACTACGGACGGCCTTAGAGCGTCAGATGCAGCGACTGGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_105_266_13/1
+AGTCTCAAGTAGAAAAAGTCCCGTTGCCGATCCGTCTACGTCCGAGTAAGATAATAAAGTAATAGTGGCGGATCG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_51_248_14/1
+ACTACGGGGATGACGACGAGGACTACGGACGGACTTAGAGCGTCAGATGCAGCGACTGAACTTTTTAGGACGATC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_89_245_15/1
+AGCGTCAGATGCAGCGACTGGACTATTTAGGACGATCGGACTGAGGAGGGCAGTAGGACGCTACGTATTTGGCGC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_58_218_16/1
+AGATAATAAAGTAATAGTGGCGTATCGCAAGCTCGACGCTCAGCCGTAGGGCCGCGCGCCAAATACGTAGCGTCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_46_195_17/1
+ATCCCAAGCTCGACGCTCAGCCGTAGGGCCGCGCGACAAATATGTAGCGTCCTACTGCCCTCCTCAGTCCAATCG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_126_282_18/1
+AGTCCGCCTCGATCCCAGTCTCAAGTAGAAAAAGTCCCGTTGCCGATCCGTCTACGTCCGAGTAAGATAATAAAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_53_212_19/1
+TACGGGGATGACGACTAGGACTACGGACGGACTTAGAGCGTCAGATGCAGCGACTGGAATATTTAGGACGATCGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_11_190_1a/1
+GACTAGACTGGAGGCGCTTGCGACTGAGCTAGGACGTGCCACTACGGGGATGACGACTAGGACTACGGACGGACT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_52_261_1b/1
+CTACGGGAATGACGACTAGGGCTACGGAGGGACTTACAGCGTCAGATGCAGCGACTGGACTATTTAGGACGATCG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_104_274_1c/1
+TCGATCCCAGTCTCAAGTAGAAAAAGTCCCGTTGCCGATCCGTCTACGTCCGAGTAAGATAATAAAGTAATAGTG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_151_297_1d/1
+ACGTATTTGGCGCGCGGCCCTACGGCTGAGCGTCGAGCTTGCGATACGCCACTATTACTTTATTATCTTACTCGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_44_225_1e/1
+CCGAGTAAGATAATAAAGTAATAGTGGCGTATCGCAAGCTCGACGCTCAGCCGTAGGGCCGCGCGCCATATACGT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_28_206_1f/1
+TTGCGACTGAGCTAGGACGTGCCACTACGGGGATGACGACTAGGACTACGGACGGACTTAGAGCGTCAGACGCAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_48_249_20/1
+GTCCCGTTGCCGATCCGTCTCCGTCCGAGTAAGATAGTAAAGTAATAGTGGCGTATCGCAAGCTCGACGCTCAGC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_75_235_21/1
+ACGGACGGACTTAGAGCGTCAGATGCAGCGACTGGACTATTTAGCACGATCGGACTGAGGAGGGCAGTAGAACGT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_110_267_22/1
+CAGTCTCAAGTAGAAAAAGTCCCGTTGCCGATCCGTCTACGTCCGAGTAAGATAATAAAGTAATAGTGGCGTATC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_69_229_23/1
+ACGTCCGAGTAAGATAATAAAGTAATAGTGGCGTATCGCAAGCTAGACGCTCAGCCGTAGGGCCGCGCGCCAAAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_21_208_24/1
+GTAATAGTGGCGTATCGCAAGCTCGACGCTCAGGCGTAGGGCCGCGCGCCAAATACGTAGCGTCCTACTGCCCTC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_42_209_25/1
+GGACGTGCCACTACGTGGATGACGACTAGGACTACGGACGGACTTAGAGCGTCAGATGCAGCGACTGGACTATTT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_97_275_26/1
+ATGCAGCGACTGGACTATTTAGGACGATCGGACTGAGGAGGGCAGTAGGACGCTACGTATTTGGCGCGCGGCCCT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_36_146_27/1
+ACCTACTGCACTCCTCAGTCCGATCGTCCTAAATAGTCCAGTCGCTGCATCTGACGCTCTAAGTCCGTCCGTAGT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_110_271_28/1
+ACTATTTAGGACGATCGGACTGAGGAGGGCAGTAGGACGCTACGTATTTGGCGCGCGGCCCTACGGCTGAGCGTC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_38_199_29/1
+GCTAGGACGTGCCACTACGGGGATGACGACTAGGACTACGGACGGACTTAGAGCGTCAGATGCAGCGACTGGACT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_103_284_2a/1
+AAAGTCCGCCTCGATCCCAGTCTCAAGTAGAAAAAGTCCCGTTGCCGATCCGTCTACGTCCGAGTAAGATAATAA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_116_271_2b/1
+ATCCCAGTCTCAAGTAGAAAAAGTCCCGTTGCCGATCTGTCTACGTCCGAGTAAGATAATAAAGTAATAGTGGCG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_77_256_2c/1
+GGACGGACTTAGAGCATCAGATGCAGCGACTGGACTATTTAGGACGATCGGACTGAGGAGGGCAGTAGGACGCTA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_50_224_2d/1
+CGAGTAAGATAATAAAGTAATAGTGGCGTATCGCAAGCTCGACGCTCAGCCGTAGGGCCGCGCGCCAAATACGTA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_65_238_2e/1
+GACTAGGACTACGGACGGACTTAGAGCGTCAGAAGCAGCGACTGGACTATTTAGGACGATCGGACTGAGGAGGGC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_46_232_2f/1
+GTGCCACTACGGGGATGACGACTAGGACTACGGCCGGACTTAGAGCGTCAGATGCAGCGACTGGACTATTTAGGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_26_189_30/1
+AGCTCGACGCTCAGCCGTAGGGCCGCGCGCCAAATACGTACCGTCCTACTGCCCTCCTCAGTCCGATCGTCCTAA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_79_256_31/1
+AGAAAAAGTCCCGTTGCCGATCCGGCTACGTCCGAGTAAGATAATAAAGTAATAGTGGCGTATGGCAAGCTCGAC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_89_267_32/1
+CAGTCTCAAGTAGAAAAAGTCCCGTTGCCGATCCGTCTACGTCCGAGAAAGATAATAAAGTAATAGTGCCGTATC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_131_260_33/1
+GAGGAGGGCAGTAGGACGCTACGTATTTGGCGCGCGGCCCTACGGCTGAGCGTCGAGCTTGCGATACGCCACTAT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_73_240_34/1
+CTACGGACGGACTTAGAGCGTCAGATGCAGCGAATGGACTATTTAGGACGCTCGGACTGAGGAGGGCAGTAGGAC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_44_197_35/1
+ACGTGCAACTACGGGGATGACGACTAGGACTACGGACGGACTTAGAGCGTCAGATGCAGCGACTGGACTATTTAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_128_252_36/1
+ACTGAGGAGGGCAGTAGGACGCTACGCATTTGGCGCGCGGCCCTACGGCTGAGCGTCGAGCTTGCGATAGGCCAC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_145_300_37/1
+GCAAGTCCCGTCCTAAAAAGTCCGCCTCGATCCCAGTCTCAAGTAGAAAAAGTCCCGTTTCCGATCCGTCTACGT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_85_275_38/1
+TTAGAGCGTCAGATGCAGCGACTGGACTATTTAGGACGATCGGACTGAGGAGGGCAGTAGGAAGCTACGTCTTTC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_48_207_39/1
+GCCCCTACGGGGATGACGACTAGGACTACGGACGGATTTAGACCGTCAGATGCAGCGACTGGACTATTTAGGACG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_81_228_3a/1
+CCTACGAGTAAGATAATAAAGTAATAGTGGCGTATCGCAAGCTCGACGCTCAGCCATAGGGCCGCGCGCCAAATA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_75_277_3b/1
+ACGGACGGACTTAAAGCTTCAGATGCAGCGACAGGACTATTTAGGACGATCGGACTGAGGAGGGCAGTAGGACGC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_30_231_3c/1
+CTACGTGCGAGTAAGATATTAAAGTAATAGTGGCGTATCGCAAGCTCGACGCTTAGCCGTAGGGCCGCGCGCCAA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_58_220_3d/1
+GAAGATAATAAAGTAATAGTGGCGTATCGCAACCTCGACGCTCAGCCGTAGGGCCGCGCGCCAAATACGTAGCGT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_104_278_3e/1
+CGCCTCGATTCCAGTCTCAAGTAGAAAAAGTCCCGTTGCCGATCCGTCTACGTCCGAGTAAGATAATAAAGTAAT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_44_193_3f/1
+ACGTGCCACTACGGGGATGACGACTAGGACTACGGACGGACTTAGAGCGTCAGATGCAGCGACTGGTCTATTTAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_94_291_40/1
+CAGATGCAGCGACTGTACTATTTAGGACGACCTGACTGAGGAGGGTAGTAGGACGCTACGTATTTGGCGCGCGGC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_91_256_41/1
+CGTCAGATGCAGCGACTGGACTATTTAGGACGATCGGACTGAGGAGGGCAGTAGGACGCTACGTATTTGGCGCGC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_23_186_42/1
+TCGACGCTCAGTCGTAGGGCCGCGCGCCAAATACGTAGCGTCCTTCTGCCCTCCTCCGTCCGATCGTCCTAAATA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_92_266_43/1
+GTCAGATGCAGCGACTGGACTATTTAGGACGATCGGACTCAGGAGGGCAGTAGGACGCTACGTATTTGGCGCGCG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_92_250_44/1
+GTCAGATGCAGCGACTGGACTATTTAGGACGATCGGACTGAGGAGGGCAGTAGGACGCTACGTATTTGGCGCGCG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_106_253_45/1
+AAAAGTCCCGTTGCCGATCCGTTTACGTCCGAGTAAGATAATAAAGTAATAGTGGCGTATCGCAAGCTCGACGCT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_5_197_46/1
+CTATCTGACTAGACTCGAGGCGCTTGCGTCTGAGCTAGGACGTGCCACTACGGGGATGACGACTAGGACTACGGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_51_194_47/1
+TCGCAAGCTCGACGCTCAGCCGTAGGGCCGCGCGCCAAATACGTAGCGTCCTACTGCCCTCCTCAGTCCGATCGT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_125_280_48/1
+CGGACTGAGGAGGGCAGTAGGACGCTATGTATTTGGCGCGCGGCCCTACGGCTGAGCGTCGAGCTTGCGAAACGC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_51_194_49/1
+ACTACGGGGATGACGACTAGGCCTACGGATGGACTTAGAGCGTCAGATGCAGCGACTGGACTATTTAGGACGATC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_33_189_4a/1
+AGCCCGACGCTCAGCCGTAGGGCCGCGCGCCAAATAGGTAGCGTCCTACTGCCCTCCTCAGTCCGATCGTCCTAA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_78_276_4b/1
+GACGGACTTAGAGCGTCAGATGCAGCGACTGGACTATTTAGGACGATCGGACTGAGGAGGGCAGTAGGGCGCTAC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_63_229_4c/1
+ACGTCCGAGTAAGATAATAAAGTAATAGTGGCGTATCGCAAGCTCGACACTCAGCCGTAGGGCCGCGCGCCAAAT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_81_245_4d/1
+CGTTGCCGATCCGTCTACGTCCGAGTAAGATTATAAAGTAATAGTGGCGTATCGCAACCTCGACGCTCAGCCGTA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_33_223_4e/1
+ACTGAGCTAGGACGTGCCACTACGGGGATGACGACTAGGACTACGGACGGACTTAGAGCGTCAGATGCAGCGACT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_172_294_4f/1
+ACGGATGAGCGTCGAGCTTGCGATACGCCACTATTACTTTATTATCTTCCTCGGACGTAGACGGATCGCCAACGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_88_257_50/1
+TAGAAAAAGTCCCGTTGCCGATCCGTCTACGTCCGAGTAAGATAATAAAGTAATAGTGGCGTATCGCAAGCTCGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_3_187_51/1
+TACTATTTGACTAGACTGGAGGCGCTTGCGACTGAGCTAGGACGTGCCACTACGGGGATGACGACTCGGACTACG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_9_179_52/1
+TCAGCCGTAGGGCCGCGCGCCAAATACGTAGCGTCCTACTGCCCTCCTCAGTCCGATCGTCCTAAATGGTCCAGT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_85_268_53/1
+TTAGTGCGTCAGATGCAGCGACTGGACTATTTAGGACGATCGGACTGAGGAGGGCAGTAGGACGCTACGTATTTG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_75_204_54/1
+ACGGACGGACTTCGAGCCTCAGATGCAGCGACTGGACTATTTAGGACGATCGGACTGAGGAGGGCAGTAGGACGC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_41_236_55/1
+AGGACGTGCCACTACGGGGATGACGACTAGGACTACGGACGGACTTAGAGCGTCAGATGCAGCGACTGGAATATT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_56_183_56/1
+GGGGATGACGACTAGGACTACGGACGGACTTAGAGCGTCAGATGCAGCGACTGGACTATTTGGGACGATCGGACT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_87_250_57/1
+AGTCCCGTTGCCGATCCGTCTACGTCCGAGTAAGATAATAAAGTAATAGTGGCGTATCGCAAGCTCGACGCTCAT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_82_271_58/1
+GACTTAGAGCGTCAGTTGCAGCGACTGGACTATTTAGGACGATCGGACTGAGGAGGGCAGTAGGACGCTACGTAT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_6_182_59/1
+TATCTGACTAGACTGGAGGCGCTTGCGACTGAGCTAGGACGTGCCAGTACGGGGATGACGACTAGGACTACGGAC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_53_272_5a/1
+GATCCCAGTGTCAAGTAGAAAAAGTCCCGTTGCCGATCCGTCTACGTCCGAGTAAGATAATAAAGTAATAGTGGC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_114_277_5b/1
+GCCTCGATCCCAGTCTCAAGCAGAAAAAGTCCCGTTGCCGTTCCGTCTACCTCCGAGTAAGATAATAAAGTAATA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_39_219_5c/1
+CTAGGACGTCCCACTATGGGGATGACGACTAGGACTACGGACGGACTTAGAGCGTCAGATGCAGCGGCTGGACTA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_4_191_5d/1
+CAAGCTCGACGCTCAGCCGTAGGGCCGCGCGCCAAATACGTAGTGTCCTACTGCCCTACTCAGTCCGATCGTCCT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_73_259_5e/1
+CTACGGACGGACTTAGAGCGTCAGATGCTGCGACTGGACTATTTGGGACGATCGGACTGAGGAGGGCAGTAGGAC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_87_279_5f/1
+CCGCCTCGATCCCAGTCTCAAGTAGAAAAAGTCCCGTTGCCGATCCGTCTACGTCCGAGTAAGATAATAAAGTAA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_125_293_60/1
+CCGTCCTAAAAAGTCCGCCTCGATCCCAGTCTCAAGTAGAAAAAGTCCCGTTGCCGATCCGTCTACGTCCGAGTA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_111_297_61/1
+AGTCCCGTCCTAAAAAGTCCGCCTCGATCCCAGTCTCAAGTAGAAAAAGTCCCGTTGCGGATCCGTCTACGTCCG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_22_173_62/1
+AGGCGCTTGCGACTGAGCTAGGACGTGCCACTACGGGGATGACGACTAGGACTACGGACGGACTTAGAGCGTCAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_116_295_63/1
+TCCCGTCCTAAAAAGTCCGCCTCGATCCCAGTCTCAAGTAGAAAAAGTCCCGTTGCCGATCCGTCTACGTCCGAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
diff -r 000000000000 -r 620cb7a7ef60 tophat2/test-data/tophat_in3.fastqsanger
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/tophat2/test-data/tophat_in3.fastqsanger	Tue Apr 26 13:40:24 2016 -0400
@@ -0,0 +1,400 @@
+@test_mRNA_150_290_0/2
+TACGTATTTGTCGCGCGGCCCTACGGCTGAGCGTCGAGCTTGCGATCCGCCACTATTACTTTATTATCTTACTCG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_8_197_1/2
+GTATCGCAAGCTCGACGCTCAGCCGTAGGGCCGCGCGCCAAATACGTAGCGTCCTACTGCCCTCCTCAGTCCGAT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_82_255_2/2
+GACTTAGAGCGTCAGATGCAGCGACTGGACTTTTTAGGACGATCGGACTGAGGAGGGCAGTAGGACGCTACGTAT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_96_238_3/2
+GATGCAGCGACTGGACTATTTAGGACGATCGGACGGAGGAGGGCAGTAGGACGCTACGTATTTGGCGCGCGGACC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_72_258_4/2
+ACTACGGACGGACTTAGAGCGTCAGATGCAGCAACTGGACTATTTAGGACGATCGGACTGAGGAGGGCAGTAGGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_107_286_5/2
+TGGACTATTTAGGACGATCGGACTGAGGAGGGCAGTAGGACGCTACGCATTTGGCGCGCGGCCCTACGGCTGAGC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_122_299_6/2
+GATCGGACTGAGGAGGGCAGTAGGACGCTACGTATTTGGCGCGCGGCCCTACGGCTGAGCGTCGAGCTTGCGATA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_58_234_7/2
+GGATGACGCCTAGGACTACGGACGGACTTAGAGCGTCAGATGCAGCGACTGGACTATTTAGGACGATCGGACTGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_57_231_8/2
+CTACGTCCGAGTAAGATAATAAAGTAATAGTGGCGTATCGCAAGCTCGACGCTCAGCCCTAGGGCCGCGCGCCAA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_8_155_9/2
+TGTGACTAGACTGGAGGCGCTTGCGACTGAGCTAGGACGTGCCACTACGGGGATGACGACTAGGACTACGGACGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_51_237_a/2
+ATCCGTCTACGTCCGAGTAAGATAATAAAGTAATAGTGGCGTATCGCAAGCTCGACGCTCAGCCGTAGGGCCGCG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_89_230_b/2
+AGCGTCAGGTGCAGCGACTGGACTATTTAGGACGATCGGACTGAGGAGGGCAGTAGGACGCTACGTATTTGGCGC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_105_276_c/2
+ACTGGACTATTTAGGACGATCGGACTGAGGAAGGCAGTAGGACGCTACGTATTTGGCGCGCGGCCCTACGGCTGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_111_268_d/2
+CTATTTAAGACGTTCCGCCTGAGGAGGGCAGTAGGACGCTACGTATTTGGCGCGCGGCCCTACGGCTGAGCGTCG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_151_286_e/2
+AAAAAGTCCGCCTCGATCCCAGTCTCAAGTAGATAAAGTCCCGTTGCCGATCCGTCTACGTCCGAGTAAGATAAT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_118_297_f/2
+GGACGATCGGACTGAGGAGGGCAGTAGGACGCTACGTATTTGGCGCGCGGCCCTACGGCTGAGCGTCGAGCTTGC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_16_194_10/2
+GACTGGATGCGCTTGCGACTGAGCTAGGACGTGCCACTACGGGGATGACGACTCGGACTACGGACGGACTTAAAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_28_188_11/2
+GCTCGACGCTCAGCCGTAGGGCCTCGCGCCAAATACGAAGCGTCCTACTGCCTTCCTCAGTCCGATCGTCCTAAA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_36_218_12/2
+AGATAATAAAGTAATAGTGGCGTATCGCAAGCTCGACGCTCAGCCGTAGGGCCGCGCGCCAAATACGTAGCGTCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_105_266_13/2
+ACTGGACTATTTAGGACGATCGGACTGAGGAGGGCAGTAGGACGCTACGTATTTGGCGCGCGGCCCTACGGCTGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_51_248_14/2
+TCCCGTTGCCGTTCCGTCTACGTCCGAGTAAGATAATAAAGTAATAGTGGCGTATCGCAAGCTCGACGCTCAGCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_89_245_15/2
+CGTTGCCGATCCGTCTACGTCCGAGTAAGATAATAGAGAAATAGTGGCGTATCGCAAGCTCGACGCTCAGCCGTA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_58_218_16/2
+GGATGACGACTAGGACTACGGACGGACTTAGAACGTCAGATGCAGCGACTGGACTATTTAGGACGATCGGACTGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_46_195_17/2
+GTGCCACTACGGGGATGACGACTAGGACTACGGACGGACTTAGAGCGTCAGATGCAGCGACTGGACTATTTAGGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_126_282_18/2
+GGACTGAGGAGGGCAGTAGGACGCTACGTATTTGGCGCGCGGCCCTACGGCTGAGCGTCGAGCTTGCGATACGCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_53_212_19/2
+TAAAGAAATAGTGGCGTATCGCAAGCTCGACGCTCAGCCGTAGGGCCGCGCGCCAAATACGTAGCGTCCTACTGC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_11_190_1a/2
+AAGCTCGACGCTCAGCCGTAGGGCCACGCGCCAAATACGTAGCGTCCTACTGCCCTCCTCAGTCCCATCGACCTA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_52_261_1b/2
+CAAGTAGAAAAAGTCCCGTTGCCGATCCTTCTACGTCCGAGTAAGATAATTAAGTAATAGTGGCGTATCGCAAGC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_104_274_1c/2
+GAGTGTACTATTTAGGACGATCGGACTGAGGAGGGCAGTAGGACGCTACGTATGTGCCGCGCGGCCCTACGGCTG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_151_297_1d/2
+AGTCCCGTCCTAAAATGTCCGCCTCGATCCCAGTCTCAAGTAGAAAAAGTCCCGTTGCCGATCCGTCTACGTCCG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_44_225_1e/2
+ACGTGCCACTACGGGGATGACGACTAGGACTACGGACGGACTTAGAGCGTCGGGTGCAGCGACTGGACTATTTAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_28_206_1f/2
+AATAGTGGCTTATCGCAAGCTCGACTCTCAGCCGTAGGGCCGCGCGCCAAATACGTGGCGTCCTACTGCCCTCCT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_48_249_20/2
+GCCACTACGGGGATGACGACTAGGACGACGGACGGACTTAGAGCGTCAGATGCAGCGACTGGACTATTTAGGACG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_75_235_21/2
+CCGTCTACGTCCGAGTAAGATAATAAAGTAATAGTGGCGTATCGCAAGCTCAACGCTCAGCCGTAGGGCCGTGCG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_110_267_22/2
+ACTAGTTAGGGCGATCGGACTGAGGAGGGCAGTAGGACGCTACGTAGTTGGCGCGCGGCCCTACGACTGAGCGTC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_69_229_23/2
+AGGACTACGGACGGACTTATAGGGTCAGATGCAGCGACTGGACTATTTAGGACGATCGGACTGAGGAGGGCAGTA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_21_208_24/2
+GAGGCGCTTGCGACTGAGCTAGGACGTGCCACTACGGGGATGACGACTAGGACTACGGACGGACTTAGAGCGTCA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_42_209_25/2
+AGTAATAGTGGCGTATCGCAAGCTCGACGCTCAGCCGTAGGGCCGCGCGCCAAATACGTAGCGTCCTACTGCCCT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_97_275_26/2
+CTCGATCCCAGTCTCAAGTAGAAAGAGTCCCGTTTCCGATCCGTCTACGTCCGACTAAGATAATAAAGTAATAGT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_36_146_27/2
+GCGCTAGGACGTGCCACTACGGGGATGACGACTAGGACTACAGACGGACTTAGAGCGTCAGATGCAGCGACTGGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_110_271_28/2
+ATCCCAGTCTCAAGTAGAAAAAGCCCCGTTGCCGATCCGTCTTCGTCCGAGTAAGATAATAAAGTAATAGTGGCG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_38_199_29/2
+GCGTATCGCAAGCTCGACGCTCAGCCGTAGGGCCGCGCGCCAAATACGTAGCGTCCTACTGCCCTCCTCAGTCCG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_103_284_2a/2
+CGACTGGACTATTTAGGACGATCGGACTGAGGAGGGCAGTAGGACGCTACGTATTTGGCGCGCGGCCCTACGGCT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_116_271_2b/2
+TAGGACGATCGGACTGAGGAGGGCAGTAGGACGCTACGTATTTGGCGCGCGGCCCTACGGCTGAGCGTCGAGCTT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_77_256_2c/2
+AGAAAAAGTCCCGTTGCCGATCCGTCTACGTCCGAGTAAGATAATAAAGTAATAGTGGCGTATCGCAAGCTCGAC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_50_224_2d/2
+CACTACGAGGATGACGTCTAGGACTACGGACGGACTTAGAGCGTCAGACGCAGCGACTGGACTATTTAGGACGAT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_65_238_2e/2
+GATCCGTCTACGTCCGAGTAAGATAATAAAGTAATAGTGGCGTATCGCAAGCTCGACGCGCAGCCGTAGGGCCGC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_46_232_2f/2
+TCTACGTCCGAGTAAGATAATAAAGTAATAGTGGCGTATCGCAAGCTCGACGCTCAGCCGTAGGGCCGCGCGCCA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_26_189_30/2
+GCTTGCGACTGAGCTAGGACGTGCCACTACGGGGATGACGACTAGGACTACGGACGGACTTAGAGCGTCAGATGC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_79_256_31/2
+ACGGACTTAGAGCGTCAGATGCAGCGACTGGACTATTTAGGACGATCGGACTGAGGAGGGCAGTAGGACGCTACG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_89_267_32/2
+AGCGTCAGATGCAGCGACTGGACTATTTAGGACGATCGGAGTGAGGAGGGCAGTAGGACGCTACGTATTTGGCGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_131_260_33/2
+AAGTAAAAAAAGTCCCGTGGCCGATCCGTTTACGTCCGAGTAAGATAATAAAGTAATAGTGGCGTATCACAAGCT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_73_240_34/2
+CCGATCCGTCTACGTCCGAGAAAGATAATAAAGTAATAGTGGCGTATCGCAAGCTCGACGCTCAGCCGTAGGGCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_44_197_35/2
+GTATCGCAAGCTCGACGATCAGCCGTAGGGCCGCGCGCCAAATACGTAGCGTCCTACTGCCCTCCTCAGTCCGAT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_128_252_36/2
+AAAGTCCCGTTCCCGATCCGTCTACGTCCGAGTAAGATAATAAAGTAATAGTGGCGTATCGCAAGCTCGACGCTC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_145_300_37/2
+GACGCTACGTATTTGGCGCGGGGCCCTATGGCTGAGCGTCGAGCTTGCGATACGCCACTATTACTTTAGTATATT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_85_275_38/2
+CTCGATCCCAGTCTCAAGTAGTAAAAGTCCCGTTGCCGATCCGTCTACGTCCGAGTAAGATAATAAAGTAAGAGT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_48_207_39/2
+TAAGAGTGGCGTATCGCAAGATCGACGCTCAGCCGTAGGGCCGCGCGCCAAATACGTAGCGTCCTACTTCCCTCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_81_228_3a/2
+GGACTGAGAGCGTCAGATGCAGCGACTGGACTATTTAGGACGATCGGACTGAGGAGGGTAGTAGGACGCTACGTA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_75_277_3b/2
+GCCTCGATCCCAGTCTCAGGTAGAAAAAGTCCCGTTGCCGATCCGTCTACGTCCGAGTAAGATAATAAAGTAATA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_30_231_3c/2
+GCGACTGAGCTAGGACGTGCCACTACGGGGATGACGACTAGGACTACGGACGGACTTAGAGCGTCAGATGCAGCG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_58_220_3d/2
+GGATGACGACTAGGACTACGGACGGACTTAGAGCGTCAGATGCAGCGACTGGACTATTTAGGACGATCGGACTGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_104_278_3e/2
+GACTGGACTATTTAGGACGATCGGACTGAGGAGGGCAGTAGGACGCTACGTTTTTGGCGCGCGGCCCTACGGCTG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_44_193_3f/2
+CGCAAGCTCGACGCTCAGCCGTAGGGCCGCGCGCCAAATACGTAGCGTCCTACTGCTCTCCCCAGTCCGATCGTC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_94_291_40/2
+GTCCCAAAAAGTCCGCCTCGATCCCAGTCTCAAGTAGAAAATGTCGCGTTGCCGATCCGTCTACGTCCCAGGAAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_91_256_41/2
+AGAAAAAGTCCCGTTGCCGATCCGTCTACGTCCGAGTAAGATAATAAAGTAATAGTGGCGTATCGCAAGCTCGAC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_23_186_42/2
+GGCGCTTGTGACTGAGCTAGGACGTGCCACTACGGGGATGAAGACTAGGACTACGGACGGACTTAGAGCGTCAGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_92_266_43/2
+GGTCTCAAGTAGAAAAAGTCCCGTTGCCGCTCCGTCTACGTCCGAGTAAGATAAGAAAGTAATAGTGGCGTATCG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_92_250_44/2
+AGTCCCGTACCCGATCCGTCTACGTCCGAGTAAGATAATAAAGTAATAGTGGCGTATCGCAAGCTCGACGCTCAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_106_253_45/2
+CTGGACTATTTAGGTCGATCGGACTGAGGAGGGCAGTAGGACGCTACGTATTTGGCGCGCGGCCCTACGGCTGAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_5_197_46/2
+GTATCGCAAGCTCGACGCTCAGCCGTAGGGCCGCCCGCCAAATACGTAGCGTCCTACTGCCCTCCTCCGTCCGAT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_51_194_47/2
+ACTACGGGGATGACGACTAGGACTACGGACGGACTTAGAGCGTCAGATGCAGCGACTGGACTATTTAGGACGATC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_125_280_48/2
+TCCGCCTCGCTCCCAGTCTCAAGTAGAAAAAGTCCCGTTGCCGATCCGTCTACGTCAGAGTAAGATAATAAAGTA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_51_194_49/2
+CCGCAAGCTCGACGCTCAGCCGTAGGGCCGCGCGCCAAATACGTGGCGTCCTACTGCCCTCCTCAGTCCGAACGT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_33_189_4a/2
+ACTGAGCTAGGACGTGCCACTACGGGGATTACCACTAGGGCTACGGACGGACTTAGAGCGTCAGATGCAGCGACT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_78_276_4b/2
+CCTCGATCCTAGTCTCAAGTAGAAAAAGTCCCGTTGCCGATCCGTCTACGTCCGAGTAAGATAATAAAGTAATAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_63_229_4c/2
+ACGACTAGGACTACGGACGGACTTAGAGCGTCAGATGCAGGGACTGGACTATTTAGGACGATCGGACTGAGGAGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_81_245_4d/2
+GGACTTAGAGCGTCAGATGCAGCGACTGGACTATTTAGGACGATCGGACTGATGAGGGCAGTAGGACGCTACGTA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_33_223_4e/2
+GAGTTAGATAATAAAGTAATAGTGGCTTATCGCAAGCTCGACGCTCAGCCGTAGGGCCGCGCGCCAAATACCTAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_172_294_4f/2
+CCCGTCCTAAAACGTCCGCCTCGATCCCAGTCTCAAGTAGAAAAAGTCCCGCTGCCGACCCGTCTACGTCCGAGT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_88_257_50/2
+GAGCGTCAGATGCAGCGACTGGACTATTTAGGACGATCGGACTGAGGAGGGCAGTAGGACGCTACGTATTTGGCG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_3_187_51/2
+CTCGACGCTCAGCCGTAGGGCCGCGCGCCAAATACGTAGCGTCCTACTGCCCTCCTCAGTCCGATCGTCCTAAAT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_9_179_52/2
+CTGACTAGACTGGAGGCGCTCGCGACTGAGCTAGGACGTGCCACTACGGGGATGACGACTAGGACTACGGACGGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_85_268_53/2
+CCAGTCTCAAGTAGAAAAAGTCCCGTTGACGATCCGTCTACGTCCGAGTAAGATAATAAAGTAATAGTGGCGTAT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_75_204_54/2
+TCGTGGCGTATCGCAAGCTCGACGCTCAGCCGTAGGGCCGCGCGCCAAATACGTAGCGTCCTACTGCCCTCCTCA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_41_236_55/2
+TCCGTCTACGTCCGAGTAAGATAATAAAGTAATAGTGGCGTATCGCAAGCTCGACGCTCAGCCGTAGGGCCGCGC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_56_183_56/2
+ACGCTCAGCCGTAGGGCCGCGCGCCAAATACGTAGCGTCCTACTGCCCTCCTCAGTCCGATCGTCCTAAATAGTC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_87_250_57/2
+AGAGCGTCAGATGCAGAGACTGGACTATTTAGGACGATCGGACTGAGGAGTGCAGTAGGACGCTACGTATTTGGC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_82_271_58/2
+ATCCCAGTCTCAAGTAGAAAAAGTCCCGTTGCCGATGCGTCTACGTCCGAGTAAGATAATAAAGTAATAGTGGCG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_6_182_59/2
+CGCTCAGCCGTAGGGCCGCGCGCCAAATACGTAGCGTCCTACTGCCCTCCTCAGTCCGATCGTCCTAAATAGTCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_53_272_5a/2
+TACGGGGATGACGACTAGGACTACGGACGGACTTAGAGCGTCAGATGCAGCGACTGGACTATTTAGGACGATCGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_114_277_5b/2
+TTTAGGACGATCGGACTGAGGAGGGCAGTAGGACGCTACGTATTTGGCGCGCGGCCCTACGCCTGAGCGTCGAGC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_39_219_5c/2
+AAGATAATAAAGTAATAGTGGCGTATCGCAAGCTGGACGCTCAGCCGTAGGGCCGCGCGCCAAATACGTAGCGTC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_4_191_5d/2
+ACTATCTGACGAGACTGGAGGCGCTTGCGACTGAGCTAGGACGTACCATTACGCGGATGACGACTAGGACTACGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_73_259_5e/2
+AGTAGAAAAAGTCCCGTTGCCGATCCGTCTACGTCCGAGTAAGATAATACAGTAATAGTGGCGTATCGCAAGCTC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_87_279_5f/2
+AGAGCGTCAGATGCAGCGACTGGACTATTTAGGACGATCGGACCGAGGAGGGCAGTAGGACGCTACGTATTTGGC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_125_293_60/2
+CGGACTGAGGAGGGCAGTAGGACGCTATGTATTTGGCGCGCGGCCCTACGGCTGAGCTTCGAGGTTGCGATACGC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_111_297_61/2
+CTATTTAGGACGATCGGACTGGGGAGGGCAGTAGGACGCTACGGATTTGGCGCGCGGCCCTACGGCTGAGCGTCG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_22_173_62/2
+GTAGGGCCGCGCGCCAAATACGTAGCGTCCTACTGCCCTCCTCAGTCCGATCGTCCTAAATAGTCCAGTCGCTGC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_mRNA_116_295_63/2
+TAGGACGATCGGACTGAGGAGGGCAGTAGGACGCTACGTATTTGGCGCGCGGCCCTACGGCTGAGCGTCGAGCTT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
diff -r 000000000000 -r 620cb7a7ef60 tophat2/test-data/tophat_out1h.bam
Binary file tophat2/test-data/tophat_out1h.bam has changed
diff -r 000000000000 -r 620cb7a7ef60 tophat2/test-data/tophat_out2h.bam
Binary file tophat2/test-data/tophat_out2h.bam has changed
diff -r 000000000000 -r 620cb7a7ef60 tophat2/test-data/tophat_out3d.bed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/tophat2/test-data/tophat_out3d.bed	Tue Apr 26 13:40:24 2016 -0400
@@ -0,0 +1,1 @@
+track name=deletions description="TopHat deletions"
diff -r 000000000000 -r 620cb7a7ef60 tophat2/test-data/tophat_out3h.bam
Binary file tophat2/test-data/tophat_out3h.bam has changed
diff -r 000000000000 -r 620cb7a7ef60 tophat2/test-data/tophat_out3i.bed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/tophat2/test-data/tophat_out3i.bed	Tue Apr 26 13:40:24 2016 -0400
@@ -0,0 +1,1 @@
+track name=insertions description="TopHat insertions"
diff -r 000000000000 -r 620cb7a7ef60 tophat2/test-data/tophat_out4h.bam
Binary file tophat2/test-data/tophat_out4h.bam has changed
diff -r 000000000000 -r 620cb7a7ef60 tophat2/tool-data/bowtie2_indices.loc.sample
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/tophat2/tool-data/bowtie2_indices.loc.sample	Tue Apr 26 13:40:24 2016 -0400
@@ -0,0 +1,37 @@
+# bowtie2_indices.loc.sample
+# This is a *.loc.sample file distributed with Galaxy that enables tools
+# to use a directory of indexed data files. This one is for Bowtie2 and Tophat2.
+# See the wiki: http://wiki.galaxyproject.org/Admin/NGS%20Local%20Setup
+# First create these data files and save them in your own data directory structure.
+# Then, create a bowtie_indices.loc file to use those indexes with tools.
+# Copy this file, save it with the same name (minus the .sample), 
+# follow the format examples, and store the result in this directory.
+# The file should include an one line entry for each index set.
+# The path points to the "basename" for the set, not a specific file.
+# It has four text columns seperated by TABS.
+#
+# <unique_build_id>	<dbkey>	<display_name>	<file_base_path>
+#
+# So, for example, if you had hg18 indexes stored in:
+#
+#    /depot/data2/galaxy/hg19/bowtie2/
+#
+# containing hg19 genome and hg19.*.bt2 files, such as:
+#    -rw-rw-r-- 1 james   james   914M Feb 10 18:56 hg19canon.fa
+#    -rw-rw-r-- 1 james   james   914M Feb 10 18:56 hg19canon.1.bt2
+#    -rw-rw-r-- 1 james   james   683M Feb 10 18:56 hg19canon.2.bt2
+#    -rw-rw-r-- 1 james   james   3.3K Feb 10 16:54 hg19canon.3.bt2
+#    -rw-rw-r-- 1 james   james   683M Feb 10 16:54 hg19canon.4.bt2
+#    -rw-rw-r-- 1 james   james   914M Feb 10 20:45 hg19canon.rev.1.bt2
+#    -rw-rw-r-- 1 james   james   683M Feb 10 20:45 hg19canon.rev.2.bt2
+#
+# then the bowtie2_indices.loc entry could look like this:
+#
+#hg19	hg19	Human (hg19)	/depot/data2/galaxy/hg19/bowtie2/hg19canon
+#
+#More examples:
+#
+#mm10	mm10	Mouse (mm10)	/depot/data2/galaxy/mm10/bowtie2/mm10
+#dm3	dm3		D. melanogaster (dm3)	/depot/data2/galaxy/mm10/bowtie2/dm3
+#
+#
diff -r 000000000000 -r 620cb7a7ef60 tophat2/tool_data_table_conf.xml.sample
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/tophat2/tool_data_table_conf.xml.sample	Tue Apr 26 13:40:24 2016 -0400
@@ -0,0 +1,8 @@
+<!-- Use the file tool_data_table_conf.xml.oldlocstyle if you don't want to update your loc files as changed in revision 4550:535d276c92bc-->
+<tables>
+    <!-- Locations of indexes in the Bowtie2 mapper format for TopHat2 to use -->
+    <table name="tophat2_indexes" comment_char="#">
+        <columns>value, dbkey, name, path</columns>
+        <file path="tool-data/bowtie2_indices.loc" />
+    </table>
+</tables>
diff -r 000000000000 -r 620cb7a7ef60 tophat2/tool_data_table_conf.xml.test
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/tophat2/tool_data_table_conf.xml.test	Tue Apr 26 13:40:24 2016 -0400
@@ -0,0 +1,6 @@
+<tables>
+    <table name="tophat2_indexes" comment_char="#">
+        <columns>value, dbkey, name, path</columns>
+        <file path="${__HERE__}/test-data/bowtie2_indices.loc" />
+    </table>
+</tables>
diff -r 000000000000 -r 620cb7a7ef60 tophat2/tool_dependencies.xml
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/tophat2/tool_dependencies.xml	Tue Apr 26 13:40:24 2016 -0400
@@ -0,0 +1,12 @@
+<?xml version="1.0"?>
+<tool_dependency>
+  <package name="bowtie2" version="2.2.5">
+      <repository changeset_revision="8b300d21e6bd" name="package_bowtie_2_2_5" owner="iuc" toolshed="https://toolshed.g2.bx.psu.edu" />
+    </package>
+    <package name="tophat" version="2.0.14">
+      <repository changeset_revision="536f7bb5616d" name="package_tophat_2_0_14" owner="iuc" toolshed="https://toolshed.g2.bx.psu.edu" />
+    </package>
+	<package name="data_manager_fetch_gene_annotation" version="1.0.0">
+		<repository changeset_revision="0442068f5c91" name="data_manager_fetch_gene_annotation" owner="scottx611x" toolshed="https://toolshed.g2.bx.psu.edu" />
+	</package>
+</tool_dependency>
diff -r 000000000000 -r 620cb7a7ef60 tophat2/tophat2_wrapper.xml
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/tophat2/tophat2_wrapper.xml	Tue Apr 26 13:40:24 2016 -0400
@@ -0,0 +1,610 @@
+<tool id="tophat2" name="TopHat" version="0.9">
+    <!-- Wrapper compatible with Tophat version 2.0.0+ -->
+    <description>Gapped-read mapper for RNA-seq data</description>
+    <version_command>tophat2 --version</version_command>
+    <requirements>
+        <requirement type="package" version="2.2.5">bowtie2</requirement>
+        <requirement type="package" version="2.0.14">tophat</requirement>
+    </requirements>
+
+    <command>
+        ##
+        ## Set path to index, building the reference if necessary.
+        ##
+
+        #set index_path = ''
+        #if $refGenomeSource.genomeSource == "history":
+            bowtie2-build "$refGenomeSource.ownFile" genome ; ln -s "$refGenomeSource.ownFile" genome.fa ;
+            #set index_path = 'genome'
+        #else:
+            #set index_path = $refGenomeSource.index.fields.path
+        #end if
+
+        ##
+        ## Run tophat.
+        ##
+
+        tophat2
+
+        ## Change this to accommodate the number of threads you have available.
+        --num-threads \${GALAXY_SLOTS:-4}
+
+        ## Set params.
+        #if $params.settingsType == "full":
+            --read-mismatches $params.read_mismatches
+            #if str($params.bowtie_n) == "Yes":
+                --bowtie-n
+            #end if
+
+            --read-edit-dist $params.read_edit_dist
+            --read-realign-edit-dist $params.read_realign_edit_dist
+            -a $params.anchor_length
+            -m $params.splice_mismatches
+            -i $params.min_intron_length
+            -I $params.max_intron_length
+            -g $params.max_multihits
+            --min-segment-intron $params.min_segment_intron
+            --max-segment-intron $params.max_segment_intron
+            --segment-mismatches $params.seg_mismatches
+            --segment-length $params.seg_length
+            --library-type $params.library_type
+
+            ## Indel search.
+            #if $params.indel_search.allow_indel_search == "Yes":
+                ## --allow-indels
+                --max-insertion-length $params.indel_search.max_insertion_length
+                --max-deletion-length $params.indel_search.max_deletion_length
+            #else:
+                --no-novel-indels
+            #end if
+
+            ## Supplying junctions parameters.
+            #if $params.own_junctions.use_junctions == "Yes":
+                #if $params.own_junctions.gene_model_ann.use_annotations == "indexed"
+                    -G $params.own_junctions.gene_model_ann.gene_annotation_model.fields.path
+                #elif $params.own_junctions.gene_model_ann.use_annotations == "history"
+                    -G $params.own_junctions.gene_model_ann.gene_annotation_model
+                #end if
+                #if $params.own_junctions.raw_juncs.use_juncs == "Yes":
+                    -j $params.own_junctions.raw_juncs.raw_juncs
+                #end if
+                #if str($params.own_junctions.no_novel_juncs) == "Yes":
+                    --no-novel-juncs
+                #end if
+            #end if
+
+            #if $params.coverage_search.use_search == "Yes":
+                --coverage-search
+                --min-coverage-intron $params.coverage_search.min_coverage_intron
+                --max-coverage-intron $params.coverage_search.max_coverage_intron
+            #else:
+                --no-coverage-search
+            #end if
+
+            #if str($params.microexon_search) == "Yes":
+                --microexon-search
+            #end if
+
+            #if $params.fusion_search.do_search == "Yes":
+                --fusion-search
+                --fusion-anchor-length $params.fusion_search.anchor_len
+                --fusion-min-dist $params.fusion_search.min_dist
+                --fusion-read-mismatches $params.fusion_search.read_mismatches
+                --fusion-multireads $params.fusion_search.multireads
+                --fusion-multipairs $params.fusion_search.multipairs
+                --fusion-ignore-chromosomes "$params.fusion_search.ignore_chromosomes"
+            #end if
+
+            #if $params.bowtie2_settings.b2_settings == "Yes":
+                #if $params.bowtie2_settings.preset.b2_preset == "Yes":
+                    --b2-$params.bowtie2_settings.preset.b2_preset_select
+                #end if
+            #end if
+
+        #end if
+
+        ## Read group information.
+        #if $readGroup.specReadGroup == "yes"
+          --rg-id "$readGroup.rgid"
+          --rg-library "$readGroup.rglb"
+          --rg-platform "$readGroup.rgpl"
+          --rg-sample "$readGroup.rgsm"
+        #end if
+
+        ## Set index path, inputs and parameters specific to paired data.
+        #if $singlePaired.sPaired != "single"
+            -r $singlePaired.mate_inner_distance
+            --mate-std-dev=$singlePaired.mate_std_dev
+
+            #if str($singlePaired.report_discordant_pairs) == "No":
+                --no-discordant
+            #end if
+
+            #if $singlePaired.sPaired == "paired"
+              ${index_path} "$singlePaired.input1" "$singlePaired.input2"
+            #else
+              ${index_path} "$singlePaired.input.forward" "$singlePaired.input.reverse"
+            #end if
+        #else
+            ${index_path} "$singlePaired.input1"
+        #end if
+    </command>
+
+    <inputs>
+        <conditional name="singlePaired">
+            <param name="sPaired" type="select" label="Is this single-end or paired-end data?">
+              <option value="single">Single-end</option>
+              <option value="paired">Paired-end (as individual datasets)</option>
+              <option value="paired_collection">Paired-end (as collection)</option>
+            </param>
+            <when value="single">
+                <param format="fastqsanger" name="input1" type="data" label="RNA-Seq FASTQ file" help="Must have Sanger-scaled quality values with ASCII offset 33"/>
+            </when>
+            <when value="paired">
+                <param format="fastqsanger" name="input1" type="data" label="RNA-Seq FASTQ file, forward reads" help="Must have Sanger-scaled quality values with ASCII offset 33" />
+                <param format="fastqsanger" name="input2" type="data" label="RNA-Seq FASTQ file, reverse reads" help="Must have Sanger-scaled quality values with ASCII offset 33" />
+                <expand macro="paired_parameters" />
+            </when>
+            <when value="paired_collection">
+                <param format="fastqsanger" name="input" type="data_collection" collection_type="paired" label="RNA-Seq FASTQ paired reads" help="Must have Sanger-scaled quality values with ASCII offset 33" />
+                <expand macro="paired_parameters" />
+            </when>
+        </conditional>
+        <expand macro="refGenomeSourceConditional">
+          <options from_data_table="tophat2_indexes">
+            <filter type="sort_by" column="2"/>
+            <validator type="no_options" message="No genomes are available for the selected input dataset"/>
+          </options>
+        </expand>
+        <conditional name="params">
+            <param name="settingsType" type="select" label="TopHat settings to use" help="You can use the default settings or set custom values for any of Tophat's parameters.">
+              <option value="preSet">Use Defaults</option>
+              <option value="full">Full parameter list</option>
+            </param>
+            <when value="preSet" />
+            <!-- Full/advanced params. -->
+            <when value="full">
+              <param name="read_realign_edit_dist" type="integer" value="1000" label="Max realign edit distance" help="--read-realign-edit-dist; Some of the reads spanning multiple exons may be mapped incorrectly as a contiguous alignment to the genome even though the correct alignment should be a spliced one - this can happen in the presence of processed pseudogenes that are rarely (if at all) transcribed or expressed. This option can direct TopHat to re-align reads for which the edit distance of an alignment obtained in a previous mapping step is above or equal to this option value. If you set this option to 0, TopHat will map every read in all the mapping steps (transcriptome if you provided gene annotations, genome, and finally splice variants detected by TopHat), reporting the best possible alignment found in any of these mapping steps. This may greatly increase the mapping accuracy at the expense of an increase in running time. The default value for this option is set such that TopHat will not try to realign reads already mapped in earlier steps." />
+
+              <param name="read_edit_dist" type="integer" value="2" label="Max edit distance" help="--read-edit-dist; Final read alignments having more than these many edit distance are discarded." />
+
+              <param name="library_type" type="select" label="Library Type" help="--library-type; TopHat will treat the reads as strand specific. Every read alignment will have an XS attribute tag. Consider supplying library type options below to select the correct RNA-seq protocol.">
+                  <option value="fr-unstranded">FR Unstranded</option>
+                  <option value="fr-firststrand">FR First Strand</option>
+                  <option value="fr-secondstrand">FR Second Strand</option>
+              </param>
+              <param name="read_mismatches" type="integer" value="2" label="Final read mismatches" help="--read-mismatches; Final read alignments having more than these many mismatches are discarded." />
+              <param name="bowtie_n" type="select" label="Use bowtie -n mode" help="--bowtie-n; TopHat uses &quot;-v&quot; in Bowtie for initial read mapping (the default), but with this option, &quot;-n&quot; is used instead. Read segments are always mapped using &quot;-v&quot; option.">
+                  <option selected="true" value="No">No</option>
+                  <option value="Yes">Yes</option>
+              </param>
+              <param name="anchor_length" type="integer" value="8" label="Anchor length (at least 3)" help="-a/--min-anchor-length; TopHat will report junctions spanned by reads with at least this many bases on each side of the junction. Note that individual spliced alignments may span a junction with fewer than this many bases on one side. However, every junction involved in spliced alignments is supported by at least one read with this many bases on each side. This must be at least 3 and the default is 8." />
+              <param name="splice_mismatches" type="integer" value="0" label="Maximum number of mismatches that can appear in the anchor region of spliced alignment" help="-m/--splice-mismatches; The default is 0."/>
+              <param name="min_intron_length" type="integer" value="70" label="The minimum intron length" help="-i/--min-intron-length; TopHat will ignore donor/acceptor pairs closer than this many bases apart. The default is 70." />
+              <param name="max_intron_length" type="integer" value="500000" label="The maximum intron length" help="-I/--max-intron-length; When searching for junctions ab initio, TopHat will ignore donor/acceptor pairs farther than this many bases apart, except when such a pair is supported by a split segment alignment of a long read. The default is 500000." />
+
+              <expand macro="indel_searchConditional" />
+
+              <param name="max_multihits" type="integer" value="20" label="Maximum number of alignments to be allowed" help="-g/--max-multihits; Instructs TopHat to allow up to this many alignments to the reference for a given read, and choose the alignments based on their alignment scores if there are more than this number. The default is 20 for read mapping. Unless you use --report-secondary-alignments, TopHat will report the alignments with the best alignment score. If there are more alignments with the same score than this number, TopHat will randomly report only this many alignments. In case of using --report-secondary-alignments, TopHat will try to report alignments up to this option value, and TopHat may randomly output some of the alignments with the same score to meet this number."/>
+              <param name="min_segment_intron" type="integer" value="50" label="Minimum intron length that may be found during split-segment (default) search" help="--min-segment-intron; The minimum intron length that may be found during split-segment search. The default is 50."/>
+              <param name="max_segment_intron" type="integer" value="500000" label="Maximum intron length that may be found during split-segment (default) search" help="--max-segment-intron; The maximum intron length that may be found during split-segment search. The default is 500000."/>
+              <param name="seg_mismatches" type="integer" min="0" max="3" value="2" label="Number of mismatches allowed in each segment alignment for reads mapped independently" help="--segment-mismatches;  Read segments are mapped independently, allowing up to this many mismatches in each segment alignment. The default is 2."/>
+              <param name="seg_length" type="integer" value="25" label="Minimum length of read segments" help="--segment-length; Each read is cut up into segments, each at least this long. These segments are mapped independently. The default is 25."/>
+              <param name="output_unmapped" type="boolean" truevalue="true" falsevalue="false" checked="false" label="Output unmapped reads" help="If checked, a BAM with the unmapped reads will be added to the history" />
+              <!-- Options for supplying own junctions. -->
+              <expand macro="own_junctionsConditional" />
+              <!-- Coverage search. -->
+              <conditional name="coverage_search">
+                <param name="use_search" type="select" label="Use Coverage Search" help="Enables the coverage based search for junctions. Use when coverage search is disabled by default (such as for reads 75bp or longer), for maximum sensitivity.">
+                    <option selected="true" value="No">No</option>
+                    <option value="Yes">Yes</option>
+                </param>
+                <when value="Yes">
+                    <param name="min_coverage_intron" type="integer" value="50" label="Minimum intron length that may be found during coverage search" help="--min-coverage-intron; The minimum intron length that may be found during coverage search. The default is 50."/>
+                    <param name="max_coverage_intron" type="integer" value="20000" label="Maximum intron length that may be found during coverage search" help="--max-coverage-intron; The maximum intron length that may be found during coverage search. The default is 20000."/>
+                </when>
+                <when value="No" />
+              </conditional>
+
+              <!-- Microexon search params -->
+              <param name="microexon_search" type="select" label="Use Microexon Search" help="--microexon-search; With this option, the pipeline will attempt to find alignments incident to microexons. Works only for reads 50bp or longer.">
+                <option value="No">No</option>
+                <option value="Yes">Yes</option>
+              </param>
+
+              <!-- Fusion mapping. -->
+              <conditional name="fusion_search">
+                  <param name="do_search" type="select" label="Do Fusion Search" help="Reads can be aligned to potential fusion transcripts if the --fusion-search option is specified. The fusion alignments are reported in SAM format using custom fields XF and XP (see the output format) and some additional information about fusions will be reported (see fusions.out). Once mapping is done, you can run tophat-fusion-post to filter out fusion transcripts (see the TopHat-Fusion website for more details).">
+                      <option selected="true" value="No">No</option>
+                      <option value="Yes">Yes</option>
+                  </param>
+                  <when value="No" />
+                  <when value="Yes">
+                      <param name="anchor_len" type="integer" value="20" label="Anchor Length" help="--fusion-anchor-length; A 'supporting' read must map to both sides of a fusion by at least this many bases. The default is 20."/>
+                      <param name="min_dist" type="integer" value="10000000" label="Minimum Distance" help="--fusion-min-dist; For intra-chromosomal fusions, TopHat-Fusion tries to find fusions separated by at least this distance. The default is 10000000."/>
+                      <param name="read_mismatches" type="integer" value="2" label="Read Mismatches" help="--fusion-read-mismatches; Reads support fusions if they map across fusion with at most this many mismatches. The default is 2."/>
+                      <param name="multireads" type="integer" value="2" label="Multireads" help="--fusion-multireads; Reads that map to more than this many places will be ignored. It may be possible that a fusion is supported by reads (or pairs) that map to multiple places. The default is 2."/>
+                      <param name="multipairs" type="integer" value="2" label="Multipairs" help="--fusion-multipairs; Pairs that map to more than this many places will be ignored. The default is 2."/>
+                      <param name="ignore_chromosomes" type="text" value='' label="--fusion-ignore-chromosomes; Ignore some chromosomes such as chrM when detecting fusion break points"/>
+                  </when>
+              </conditional>
+
+              <!-- Bowtie2 settings. -->
+              <conditional name="bowtie2_settings">
+                  <param name="b2_settings" type="select" label="Set Bowtie2 settings">
+                        <option selected="true" value="No">No</option>
+                        <option value="Yes">Yes</option>
+                  </param>
+                  <when value="No" />
+                  <when value="Yes">
+                      <conditional name="preset">
+                          <param name="b2_preset" type="select" label="Use Preset options">
+                                <option selected="true" value="Yes">Yes</option>
+                                <option value="No">No</option>
+                          </param>
+                          <when value="Yes">
+                              <param name="b2_preset_select" type="select" label="Preset option">
+                                  <option value="very-fast">Very fast</option>
+                                  <option value="fast">Fast</option>
+                                  <option selected="true" value="sensitive">Sensitive</option>
+                                  <option value="very-sensitive">Very sensitive</option>
+                              </param>
+                          </when>
+                          <!-- TODO: -->
+                          <when value="No" />
+                      </conditional>
+                  </when>
+              </conditional>
+            </when>  <!-- full -->
+      </conditional>  <!-- params -->
+      <conditional name="readGroup">
+        <param name="specReadGroup" type="select" label="Specify read group?">
+            <option value="yes">Yes</option>
+            <option value="no" selected="True">No</option>
+        </param>
+        <when value="yes">
+            <param name="rgid" type="text" label="Read group identifier (ID). Each @RG line must have a unique ID. The value of ID is used in the RG tags of alignment records. Must be unique among all read groups in header section." help="Required if RG specified. Read group IDs may be modified when merging SAM files in order to handle collisions." />
+            <param name="rglb" type="text" label="Library name (LB)" help="Required if RG specified" />
+            <param name="rgpl" type="text" label="Platform/technology used to produce the reads (PL)" help="Required if RG specified. Valid values : CAPILLARY, LS454, ILLUMINA, SOLID, HELICOS, IONTORRENT and PACBIO" />
+            <param name="rgsm" type="text" label="Sample (SM)" help="Required if RG specified. Use pool name where a pool is being sequenced" />
+        </when>
+        <when value="no" />
+      </conditional> <!-- readGroup -->
+    </inputs>
+
+    <stdio>
+        <regex match="Exception|Error" source="both" level="fatal" description="Tool execution failed"/>
+        <regex match=".*" source="both" level="log" description="tool progress"/>
+    </stdio>
+
+    <outputs>
+        <data format="txt" name="align_summary" label="${tool.name} on ${on_string}: align_summary" from_work_dir="tophat_out/align_summary.txt"/>
+        <data format="tabular" name="fusions" label="${tool.name} on ${on_string}: fusions" from_work_dir="tophat_out/fusions.out">
+            <filter>(params['settingsType'] == 'full' and params['fusion_search']['do_search'] == 'Yes')</filter>
+        </data>
+        <data format="bed" name="insertions" label="${tool.name} on ${on_string}: insertions" from_work_dir="tophat_out/insertions.bed">
+            <expand macro="dbKeyActions" />
+        </data>
+        <data format="bed" name="deletions" label="${tool.name} on ${on_string}: deletions" from_work_dir="tophat_out/deletions.bed">
+          <expand macro="dbKeyActions" />
+        </data>
+        <data format="bed" name="junctions" label="${tool.name} on ${on_string}: splice junctions" from_work_dir="tophat_out/junctions.bed">
+          <expand macro="dbKeyActions" />
+        </data>
+        <data format="bam" name="accepted_hits" label="${tool.name} on ${on_string}: accepted_hits" from_work_dir="tophat_out/accepted_hits.bam">
+          <expand macro="dbKeyActions" />
+        </data>
+        <data format="bam" name="unmapped" label="${tool.name} on ${on_string}: unmapped" from_work_dir="tophat_out/unmapped.bam">
+            <filter>(params['settingsType'] == 'full' and params['output_unmapped'])</filter>
+            <expand macro="dbKeyActions" />
+        </data>
+
+    </outputs>
+
+    <macros>
+      <import>tophat_macros.xml</import>
+      <xml name="paired_parameters">
+        <param name="mate_inner_distance" type="integer" value="300" label="Mean Inner Distance between Mate Pairs" help="-r/--mate-inner-dist; This is the expected (mean) inner distance between mate pairs. For, example, for paired end runs with fragments selected at 300bp, where each end is 50bp, you should set -r to be 200. The default is 50bp."/>
+        <param name="mate_std_dev" type="integer" value="20" label="Std. Dev for Distance between Mate Pairs"  help="--mate-std-dev; The standard deviation for the distribution on inner distances between mate pairs. The default is 20bp."/>
+        <!-- Discordant pairs. -->
+        <param name="report_discordant_pairs" type="select" label="Report discordant pair alignments?" help="--no-discordant">
+            <option value="No">No</option>
+            <option selected="True" value="Yes">Yes</option>
+        </param>
+      </xml>
+      <macro name="dbKeyActions">
+        <actions>
+          <conditional name="refGenomeSource.genomeSource">
+            <when value="indexed">
+              <action type="metadata" name="dbkey">
+                <option type="from_data_table" name="tophat2_indexes" column="1" offset="0">
+                  <filter type="param_value" column="0" value="#" compare="startswith" keep="False"/>
+                  <filter type="param_value" ref="refGenomeSource.index" column="0"/>
+                </option>
+              </action>
+            </when>
+            <when value="history">
+              <action type="metadata" name="dbkey">
+                <option type="from_param" name="refGenomeSource.ownFile" param_attribute="dbkey" />
+              </action>
+            </when>
+          </conditional>
+        </actions>
+      </macro>
+    </macros>
+
+    <tests>
+        <!-- Test base-space single-end reads with pre-built index and preset parameters -->
+        <test>
+            <!-- TopHat commands:
+            tophat2 -o tmp_dir -p 1 tophat_in1 test-data/tophat_in2.fastqsanger
+            Rename the files in tmp_dir appropriately
+            -->
+            <param name="sPaired" value="single" />
+            <param name="input1" ftype="fastqsanger" value="tophat_in2.fastqsanger" />
+            <param name="genomeSource" value="indexed" />
+            <param name="index" value="tophat_test" />
+            <param name="settingsType" value="preSet" />
+            <param name="specReadGroup" value="no" />
+            <output name="junctions" file="tophat2_out1j.bed" />
+            <output name="accepted_hits" file="tophat_out1h.bam" compare="sim_size" />
+        </test>
+        <!-- Test using base-space test data: paired-end reads, index from history. -->
+        <test>
+            <!-- TopHat commands:
+            bowtie2-build -f test-data/tophat_in1.fasta tophat_in1
+            tophat2 -o tmp_dir -p 1 -r 20 tophat_in1 test-data/tophat_in2.fastqsanger test-data/tophat_in3.fastqsanger
+            Rename the files in tmp_dir appropriately
+            -->
+            <param name="sPaired" value="paired" />
+            <param name="input1" ftype="fastqsanger" value="tophat_in2.fastqsanger" />
+            <param name="input2" ftype="fastqsanger" value="tophat_in3.fastqsanger" />
+            <param name="genomeSource" value="history" />
+            <param name="ownFile" ftype="fasta" value="tophat_in1.fasta" />
+            <param name="mate_inner_distance" value="20" />
+            <param name="settingsType" value="preSet" />
+            <param name="specReadGroup" value="no" />
+            <output name="junctions" file="tophat2_out2j.bed" />
+            <output name="accepted_hits" file="tophat_out2h.bam" compare="sim_size" />
+        </test>
+        <test>
+            <!-- Same test as above but with a collection. -->
+            <param name="sPaired" value="paired_collection" />
+            <param name="input">
+              <collection type="paired">
+                <element name="forward" value="tophat_in2.fastqsanger" ftype="fastqsanger" />
+                <element name="reverse" value="tophat_in3.fastqsanger" ftype="fastqsanger" />
+              </collection>
+            </param>
+            <param name="genomeSource" value="history" />
+            <param name="ownFile" ftype="fasta" value="tophat_in1.fasta" />
+            <param name="mate_inner_distance" value="20" />
+            <param name="settingsType" value="preSet" />
+            <param name="specReadGroup" value="no" />
+            <output name="junctions" file="tophat2_out2j.bed" />
+            <output name="accepted_hits" file="tophat_out2h.bam" compare="sim_size" />
+        </test>
+        <!-- Test base-space single-end reads with user-supplied reference fasta and full parameters -->
+        <test>
+            <!-- TopHat commands:
+            bowtie2-build -f test-data/tophat_in1.fasta tophat_in1
+            tophat2 -o tmp_dir -p 1 -a 8 -m 0 -i 70 -I 500000 -g 40 +coverage-search +min-coverage-intron 50 +max-coverage-intro 20000 +segment-mismatches 2 +segment-length 25 +microexon-search tophat_in1 test-data/tophat_in2.fastqsanger
+            Replace the + with double-dash
+            Rename the files in tmp_dir appropriately
+            -->
+            <conditional name="singlePaired">
+              <param name="sPaired" value="single"/>
+              <param name="input1" ftype="fastqsanger" value="tophat_in2.fastqsanger"/>
+            </conditional>
+            <param name="genomeSource" value="history"/>
+            <param name="ownFile" value="tophat_in1.fasta"/>
+            <conditional name="params">
+              <param name="settingsType" value="full"/>
+              <param name="library_type" value="FR Unstranded"/>
+              <param name="read_mismatches" value="2"/>
+              <param name="bowtie_n" value="No"/>
+              <param name="anchor_length" value="8"/>
+              <param name="splice_mismatches" value="0"/>
+              <param name="min_intron_length" value="70"/>
+              <param name="max_intron_length" value="500000"/>
+              <param name="max_multihits" value="40"/>
+              <param name="min_segment_intron" value="50" />
+              <param name="max_segment_intron" value="500000" />
+              <param name="seg_mismatches" value="2"/>
+              <param name="seg_length" value="25"/>
+              <conditional name="indel_search">
+                <param name="allow_indel_search" value="Yes"/>
+                <param name="max_insertion_length" value="3"/>
+                <param name="max_deletion_length" value="3"/>
+              </conditional>
+              <conditional name="own_junctions">
+                <param name="use_junctions" value="Yes" />
+                <conditional name="gene_model_ann">
+                  <param name="use_annotations" value="No" />
+                </conditional>
+                <conditional name="raw_juncs">
+                  <param name="use_juncs" value="No" />
+                </conditional>
+                <conditional name="no_novel_juncs">
+                  <param name="no_novel_juncs" value="No" />
+                </conditional>
+              </conditional>
+              <conditional name="coverage_search">
+                <param name="use_search" value="Yes" />
+                <param name="min_coverage_intron" value="50" />
+                <param name="max_coverage_intron" value="20000" />
+              </conditional>
+              <param name="microexon_search" value="Yes" />
+              <conditional name="bowtie2_settings">
+                <param name="b2_settings" value="No" />
+              </conditional>
+              <!-- Fusion search params -->
+              <conditional name="fusion_search">
+                <param name="do_search" value="Yes" />
+                <param name="anchor_len" value="21" />
+                <param name="min_dist" value="10000021" />
+                <param name="read_mismatches" value="3" />
+                <param name="multireads" value="4" />
+                <param name="multipairs" value="5" />
+                <param name="ignore_chromosomes" value="chrM"/>
+              </conditional>
+            </conditional>
+            <conditional name="readGroup">
+              <param name="specReadGroup" value="no" />
+            </conditional>
+            <output name="insertions" file="tophat_out3i.bed" />
+            <output name="deletions" file="tophat_out3d.bed" />
+            <output name="junctions" file="tophat2_out3j.bed" />
+            <output name="accepted_hits" file="tophat_out3h.bam" compare="sim_size" />
+        </test>
+        <!-- Test base-space paired-end reads with user-supplied reference fasta and full parameters -->
+        <test>
+            <!-- TopHat commands:
+            tophat2 -o tmp_dir -r 20 -p 1 -a 8 -m 0 -i 70 -I 500000 -g 40 +coverage-search +min-coverage-intron 50 +max-coverage-intro 20000 +segment-mismatches 2 +segment-length 25 +microexon-search +report_discordant_pairs tophat_in1 test-data/tophat_in2.fastqsanger test-data/tophat_in3.fastqsanger
+            Replace the + with double-dash
+            Rename the files in tmp_dir appropriately
+            -->
+            <conditional name="singlePaired">
+              <param name="sPaired" value="paired"/>
+              <param name="input1" ftype="fastqsanger" value="tophat_in2.fastqsanger"/>
+              <param name="input2" ftype="fastqsanger" value="tophat_in3.fastqsanger"/>
+              <param name="mate_inner_distance" value="20"/>
+              <param name="report_discordant_pairs" value="Yes" />
+            </conditional>
+            <param name="genomeSource" value="indexed"/>
+            <param name="index" value="tophat_test"/>
+            <conditional name="params">
+              <param name="settingsType" value="full"/>
+              <param name="library_type" value="FR Unstranded"/>
+              <param name="read_mismatches" value="5"/>
+              <!-- Error: the read mismatches (5) and the read gap length (2) should be less than or equal to the read edit dist (2) -->
+              <param name="read_edit_dist" value="5" />
+              <param name="bowtie_n" value="Yes"/>
+              <param name="mate_std_dev" value="20"/>
+              <param name="anchor_length" value="8"/>
+              <param name="splice_mismatches" value="0"/>
+              <param name="min_intron_length" value="70"/>
+              <param name="max_intron_length" value="500000"/>
+              <param name="max_multihits" value="40"/>
+              <param name="min_segment_intron" value="50" />
+              <param name="max_segment_intron" value="500000" />
+              <param name="seg_mismatches" value="2"/>
+              <param name="seg_length" value="25"/>
+              <conditional name="indel_search">
+                <param name="allow_indel_search" value="No"/>
+              </conditional>
+              <conditional name="own_junctions">
+                <param name="use_junctions" value="Yes" />
+                <conditional name="gene_model_ann">
+                  <param name="use_annotations" value="No" />
+                </conditional>
+                <conditional name="raw_juncs">
+                  <param name="use_juncs" value="No" />
+                </conditional>
+                <conditional name="no_novel_juncs">
+                  <param name="no_novel_juncs" value="No" />
+                </conditional>
+              </conditional>
+              <conditional name="coverage_search">
+                <param name="use_search" value="No" />
+              </conditional>
+              <param name="microexon_search" value="Yes" />
+              <conditional name="bowtie2_settings">
+                <param name="b2_settings" value="No" />
+              </conditional>
+              <!-- Fusion search params -->
+              <conditional name="fusion_search">
+                <param name="do_search" value="Yes" />
+                <param name="anchor_len" value="21" />
+                <param name="min_dist" value="10000021" />
+                <param name="read_mismatches" value="3" />
+                <param name="multireads" value="4" />
+                <param name="multipairs" value="5" />
+                <param name="ignore_chromosomes" value="chrM"/>
+              </conditional>
+            </conditional>
+            <conditional name="readGroup">
+              <param name="specReadGroup" value="no" />
+            </conditional>
+            <output name="junctions" file="tophat2_out4j.bed" />
+            <output name="accepted_hits" file="tophat_out4h.bam" compare="sim_size" />
+        </test>
+    </tests>
+    <help>
+**TopHat Overview**
+
+TopHat_ is a fast splice junction mapper for RNA-Seq reads. It aligns RNA-Seq reads to mammalian-sized genomes using the ultra high-throughput short read aligner Bowtie(2), and then analyzes the mapping results to identify splice junctions between exons.
+
+.. _TopHat: http://ccb.jhu.edu/software/tophat/
+
+------
+
+**Know what you are doing**
+
+.. class:: warningmark
+
+There is no such thing (yet) as an automated gearshift in splice junction identification. It is all like stick-shift driving in San Francisco. In other words, running this tool with default parameters will probably not give you meaningful results. A way to deal with this is to **understand** the parameters by carefully reading the `documentation`__ and experimenting. Fortunately, Galaxy makes experimenting easy.
+
+.. __: http://ccb.jhu.edu/software/tophat/manual.shtml
+
+------
+
+**Input formats**
+
+TopHat accepts files in Sanger FASTQ format. Use the FASTQ Groomer to prepare your files.
+
+------
+
+**Outputs**
+
+TopHat produces two output files:
+
+- junctions -- A UCSC BED_ track of junctions reported by TopHat. Each junction consists of two connected BED blocks, where each block is as long as the maximal overhang of any read spanning the junction. The score is the number of alignments spanning the junction.
+- accepted_hits -- A list of read alignments in BAM_ format.
+
+.. _BED: http://genome.ucsc.edu/FAQ/FAQformat.html#format1
+.. _BAM: http://samtools.sourceforge.net/
+
+Two other possible outputs, depending on the options you choose, are insertions and deletions, both of which are in BED format.
+
+-------
+
+**TopHat settings**
+
+All of the options have a default value. You can change any of them. Some of the options in TopHat have been implemented here.
+
+------
+
+**TopHat parameter list**
+
+This is a list of implemented TopHat options::
+
+  -r                                This is the expected (mean) inner distance between mate pairs. For, example, for paired end runs with fragments
+                                    selected at 300bp, where each end is 50bp, you should set -r to be 200. There is no default, and this parameter
+                                    is required for paired end runs.
+  --mate-std-dev INT                The standard deviation for the distribution on inner distances between mate pairs. The default is 20bp.
+  -a/--min-anchor-length INT        The "anchor length". TopHat will report junctions spanned by reads with at least this many bases on each side of the junction. Note that individual spliced
+                                    alignments may span a junction with fewer than this many bases on one side. However, every junction involved in spliced alignments is supported by at least one
+                                    read with this many bases on each side. This must be at least 3 and the default is 8.
+  -m/--splice-mismatches INT        The maximum number of mismatches that may appear in the "anchor" region of a spliced alignment. The default is 0.
+  -i/--min-intron-length INT        The minimum intron length. TopHat will ignore donor/acceptor pairs closer than this many bases apart. The default is 70.
+  -I/--max-intron-length INT        The maximum intron length. When searching for junctions ab initio, TopHat will ignore donor/acceptor pairs farther than this many bases apart, except when such a pair is supported by a split segment alignment of a long read. The default is 500000.
+  -g/--max-multihits INT            Instructs TopHat to allow up to this many alignments to the reference for a given read, and suppresses all alignments for reads with more than this many
+                                    alignments. The default is 40.
+  -G/--GTF [GTF 2.2 file]           Supply TopHat with a list of gene model annotations. TopHat will use the exon records in this file to build a set of known splice junctions for each gene, and will attempt to align reads to these junctions even if they would not normally be covered by the initial mapping.
+  -j/--raw-juncs [juncs file]       Supply TopHat with a list of raw junctions. Junctions are specified one per line, in a tab-delimited format. Records look like: [chrom] [left] [right] [+/-], left and right are zero-based coordinates, and specify the last character of the left sequenced to be spliced to the first character of the right sequence, inclusive.
+  -no-novel-juncs                   Only look for junctions indicated in the supplied GFF file. (ignored without -G)
+  --no-coverage-search              Disables the coverage based search for junctions.
+  --coverage-search                 Enables the coverage based search for junctions. Use when coverage search is disabled by default (such as for reads 75bp or longer), for maximum sensitivity.
+  --microexon-search                With this option, the pipeline will attempt to find alignments incident to microexons. Works only for reads 50bp or longer.
+  --segment-mismatches              Read segments are mapped independently, allowing up to this many mismatches in each segment alignment. The default is 2.
+  --segment-length                  Each read is cut up into segments, each at least this long. These segments are mapped independently. The default is 25.
+  --min-coverage-intron             The minimum intron length that may be found during coverage search. The default is 50.
+  --max-coverage-intron             The maximum intron length that may be found during coverage search. The default is 20000.
+  --min-segment-intron              The minimum intron length that may be found during split-segment search. The default is 50.
+  --max-segment-intron              The maximum intron length that may be found during split-segment search. The default is 500000.
+    </help>
+    <citations>
+        <citation type="doi">10.1186/gb-2013-14-4-r36</citation>
+    </citations>
+</tool>
diff -r 000000000000 -r 620cb7a7ef60 tophat2/tophat_macros.xml
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/tophat2/tophat_macros.xml	Tue Apr 26 13:40:24 2016 -0400
@@ -0,0 +1,78 @@
+<macros>
+  <macro name="refGenomeSourceConditional">
+    <conditional name="refGenomeSource">
+      <param name="genomeSource" type="select" label="Use a built in reference genome or own from your history" help="Built-ins genomes were created using default options">
+        <option value="indexed" selected="True">Use a built-in genome</option>
+        <option value="history">Use a genome from history</option>
+      </param>
+      <when value="indexed">
+        <param name="index" type="select" label="Select a reference genome" help="If your genome of interest is not listed, contact the Galaxy team">
+          <yield />
+        </param>
+      </when>
+      <when value="history">
+        <param name="ownFile" type="data" format="fasta" metadata_name="dbkey" label="Select the reference genome" />
+      </when>  <!-- history -->
+    </conditional>  <!-- refGenomeSource -->
+  </macro>
+  <macro name="indel_searchConditional">
+    <conditional name="indel_search">
+      <param name="allow_indel_search" type="select" label="Allow indel search">
+        <option value="Yes">Yes</option>
+        <option value="No">No</option>
+      </param>
+      <when value="No"/>
+      <when value="Yes">
+        <param name="max_insertion_length" type="integer" value="3" label="Max insertion length." help="--max-insertion-length; The maximum insertion length. The default is 3." />
+        <param name="max_deletion_length" type="integer" value="3" label="Max deletion length." help="--max-deletion-length; The maximum deletion length. The default is 3." />
+      </when>
+    </conditional>    
+  </macro>
+  <macro name="own_junctionsConditional">
+    <conditional name="own_junctions">
+      <param name="use_junctions" type="select" label="Do you want to supply your own junction data" help="The options below allow you validate your own list of known transcripts or junctions with your RNA-Seq data. Note that the chromosome names in the files provided with the options below must match the names in the Bowtie index.">
+        <option value="No">No</option>
+        <option value="Yes">Yes</option>
+      </param>
+      <when value="Yes">
+        <conditional name="gene_model_ann">
+          <param name="use_annotations" type="select" label="Use Gene Annotation Model" help="-G/--GTF; TopHat with a set of gene model annotations and/or known transcripts, as a GTF 2.2 or GFF3 formatted file. If this option is provided, TopHat will first extract the transcript sequences and use Bowtie to align reads to this virtual transcriptome first. Only the reads that do not fully map to the transcriptome will then be mapped on the genome. The reads that did map on the transcriptome will be converted to genomic mappings (spliced as needed) and merged with the novel mappings and junctions in the final tophat output. Please note that the values in the first column of the provided GTF/GFF file (column which indicates the chromosome or contig on which the feature is located), must match the name of the reference sequence in the Bowtie index you are using with TopHat.">
+            <option value="No">No</option>
+             <option value="indexed">Use a built-in gene annotation</option>
+            <option value="history">Use a gene annotation from history</option>
+          </param>
+          <when value="No" />
+          <when value="indexed">
+            <param format="gtf,gff3" name="gene_annotation_model" type="select" label="Gene Model Annotations">
+                <options from_data_table="gene_annotation"/>
+             </param>
+          </when>
+          <when value="history">
+            <param format="gtf,gff3" name="gene_annotation_model" type="data" label="Gene Model Annotations" metadata_name="dbkey" />
+          </when>  
+        </conditional>
+        <expand macro="raw_juncsConditional" />
+        <expand macro="no_novel_juncsParam" />
+      </when>
+      <when value="No" />
+    </conditional> <!-- /own_junctions -->
+  </macro>
+  <macro name="raw_juncsConditional">
+    <conditional name="raw_juncs">
+      <param name="use_juncs" type="select" label="Use Raw Junctions">
+        <option value="No">No</option>
+        <option value="Yes">Yes</option>
+      </param>
+      <when value="No" />
+      <when value="Yes">
+        <param format="interval" name="raw_juncs" type="data" label="Raw Junctions" help="-j/--raw-juncs; Supply TopHat with a list of raw junctions. Junctions are specified one per line, in a tab-delimited format. Records look like: [chrom] [left] [right] [+/-] left and right are zero-based coordinates, and specify the last character of the left sequenced to be spliced to the first character of the right sequence, inclusive."/>
+      </when>
+    </conditional>
+  </macro>
+  <macro name="no_novel_juncsParam">
+    <param name="no_novel_juncs" type="select" label="Only look for supplied junctions" help="--no-novel-juncs; Only look for reads across junctions indicated in the supplied GFF or junctions file.">
+      <option value="No">No</option>
+      <option value="Yes">Yes</option>
+    </param>
+  </macro>    
+</macros>