--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/pyCRAC/pyFasta2tab.xml	Tue Jun 18 09:11:00 2013 -0400
@@ -0,0 +1,51 @@
+<tool id="pyFasta2Tab" name="pyFasta2Tab">
+	  <description>converter</description>
+	  <requirements>
+        	<requirement type="package">pyCRAC</requirement>
+    	  </requirements>
+ 	  <command interpreter="python">/usr/local/bin/pyFasta2tab.py -f $input -o $output
+ 	  </command>
+	  <version_command>/usr/local/bin/pyFasta2tab.py --version</version_command>
+ 	  <inputs>
+	      <param name="input" type="data" format="fasta" label="Fasta file -f"/>
+ 	  </inputs>
+	  <param name="label" type="text" format="txt" size="30" value="pyFasta2Tab" label="Enter output file label -o" />
+ 	  <outputs>
+	    <data name="output" format="tabular" label="${label.value}.tab"/>
+ 	  </outputs>
+	  <help>
+
+.. class:: infomark
+
+**pyFasta2Tab**
+
+pyFasta2Tab is part of the pyCRAC_ package. Converts fasta to tabular format. Is used to convert your reference sequences in fasta format to the tabular format that pyCRAC uses for almost all tools.
+
+Example::
+    
+    >sequence1
+    ATAGGATACATAACCATATTATGAGACC
+    
+Is converted into::
+
+    sequence1   ATAGGATACATAACCATATTATGAGACC
+    
+The pyCRAC package lo
+   
+.. _pyCRAC: http://sandergranneman.bio.ed.ac.uk/Granneman_Lab/pyCRAC_software.html
+
+-------
+
+**Parameter list**                                                                                                                                         
+
+Options::
+
+  -f fasta_file, --input_file=fasta_file
+                        provide the name and path of your fasta input file.
+                        Default is standard input.
+
+        
+
+ 	  </help>
+</tool>
+