--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/pyCRAC/pyFastqDuplicateRemover.xml	Tue Jun 18 09:11:00 2013 -0400
@@ -0,0 +1,117 @@
+ <tool id ="pyFastqDuplicateRemover" name="pyFastqDuplicateRemover">
+    <requirements>
+        <requirement type="package">pyCRAC</requirement>
+    </requirements>
+	<command interpreter="perl"> 
+	pyFastqDuplicateRemover.pl
+	-f $ftype.f
+	#if $ftype.reverse.rev == "yes":
+        -r=$ftype.reverse.r
+		--out2 $out2
+    #end if#
+	-o $out
+	--id $out.id
+	</command>
+	<version_command>pyFastqDuplicateRemover.py --version</version_command>
+	<inputs>
+		<conditional name="ftype">
+		<param name="type" type="select"  label="File type">
+			<option value="fastq" selected="true">FASTQ</option>
+			<option value="fasta">FASTA</option>
+		</param>
+		<when value="fastq">
+			<param format="fastq" name="f" type="data" label="FastQ File -f" help="FastQ format" />
+			<conditional name="reverse">
+                <param name="rev" type="select"  label="Add a reverse or paired FastQ file">
+                    <option value="no" selected="true">NO</option>
+                    <option value="yes">YES</option>
+                </param>        
+                <when value="yes">
+				    <param format="fastq" name="r" type="data" label="Reverse FastQ File -f" help="FastQ format" />
+				</when>
+				<when value="no">
+				</when>
+			</conditional>
+		</when>
+		<when value="fasta">
+			<param format="fasta" name="f" type="data" label="FastA File -f" help="FastA format" />
+			<conditional name="reverse">
+                <param name="rev" type="select"  label="Add a reverse or paired FastA file">
+                    <option value="no" selected="true">NO</option>
+                    <option value="yes">YES</option>
+                </param>        
+                <when value="yes">
+				    <param format="fasta" name="r" type="data" label="Reverse FastA File -f" help="FastA format" />
+				</when>
+				<when value="no">
+				</when>
+			</conditional>
+		</when>
+		</conditional>
+		<param name="label" type="text" format="txt" size="30" value="pyFastqDuplicateRemover" label="Enter output file label -o" />
+	</inputs>
+	<outputs>
+		<data format="fasta" name="out" label="${label.value}.fasta"/>
+		<data format="fasta" name="out2" label="${label.value}_reverse.fasta">
+			<filter>ftype['reverse']['rev'] == "yes"</filter>
+		</data>
+	</outputs>
+	<help>
+
+.. class:: infomark
+
+**pyFastqDuplicateRemover**
+
+pyFastqDuplicateRemover is part of the pyCRAC_ package. Removes identical sequences from fastq and fasta files and returns a fasta file with collapsed data.
+
+Can also process paired-end data.
+
+**Examples**
+
+Unprocessed fastq data with six random nucleotides at 5' end of the read::
+    
+    @FCC102EACXX:3:1101:3231:2110#TGACCAAT/1
+    GCGCCTGCCAATTCCATCGTAATGATTAATAGGGACGGTCGGGGGCATC
+    +
+    bb_ceeeegggggiiiiiifghiihiihiiiiiiiiiifggfhiecccc
+    
+After pyBarcodeFilter::
+
+    @FCC102EACXX:3:1101:3231:2110#TGACCAAT/1##GCGCCT
+    TCCATCGTAATGATTAATAGGGACGGTCGGGGGCATC
+    +
+    giiiiiifghiihiihiiiiiiiiiifggfhiecccc
+    
+    This entry is printed to the NNNNNNGCCAAT barcode file.
+
+After pyFastqDuplicateRemover::
+
+    >1_GCGCCT_5/1
+    TCCATCGTAATGATTAATAGGGACGGTCGGGGGCATC
+    
+    The '1' indicates that this is the first unique cDNA in the data
+    GCGCCT is the random barcode sequence
+    the '5' indicates that 5 reads were found with identical read and random barcode sequences
+    the '/1' indicates that the seqeuence originates from the forward sequencing reaction
+   
+.. _pyCRAC: http://sandergranneman.bio.ed.ac.uk/Granneman_Lab/pyCRAC_software.html
+        
+------
+
+**Parameter list**
+
+Options::
+
+  -f FILE, --input_file=FILE		
+                                        name of the FASTQ or FASTA input file
+
+  -r FILE, --reverse_input_file=FILE	
+                                        name of the paired (or reverse) FASTQ or FASTA input file
+
+  -o FILE, --output_file=FILE		
+                                        Provide the path and name of the fastq or fasta output file. Default is standard output. 
+					For paired-end data just provide a file name without file extension (!)
+	</help>
+</tool>
+
+