--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/pyCRAC/pyFastqJoiner.xml	Tue Jun 18 09:11:00 2013 -0400
@@ -0,0 +1,139 @@
+ <tool id ="pyFastqJoiner" name="pyFastqJoiner">
+    <requirements>
+        <requirement type="package">pyCRAC</requirement>
+    </requirements>
+	<command interpreter="python"> 
+	/usr/local/bin/pyFastqJoiner.py
+	-f $ftype.f1 $ftype.f2
+	-o $out
+	--file_type=$ftype.type
+	#if $joinc.ch == "-c":
+        -c $joinc.c
+    #end if#
+	</command>
+	<version_command>/usr/local/bin/pyFastqJoiner.py --version</version_command>
+	<inputs>
+		<conditional name="ftype">
+            <param name="type" type="select" label="File type">
+                <option value="fastq" selected="true">FASTQ</option>
+                <option value="fasta">FASTA</option>
+            </param>
+            <when value="fastq">
+                <param format="fastq" name="f1" type="data" label="First FastQ File -f" help="FastQ format" />
+                <param format="fastq" name="f2" type="data" label="Second FastQ File -f" help="FastQ format" />
+            </when>
+            <when value="fasta">
+                <param format="fasta" name="f1" type="data" label="First FastA File -f" help="FastA format" />
+                <param format="fasta" name="f2" type="data" label="Second FastA File -f" help="FastA format" />
+            </when>
+		</conditional>
+		<conditional name="joinc">
+            <param name="ch" type="select"  label="Insert a character at join">
+                <option value="" selected="true">NO</option>
+                <option value="-c">YES</option>
+            </param>
+            <when value="-c">
+                <param type="text" name="c" label="Add this character -c" value=":" >
+                    <validator type="empty_field" message="enter a character or turn this option off" />
+                </param>
+            </when>
+            <when value="">
+            </when>
+		</conditional>
+	    <param name="label" type="text" format="txt" size="30" value="pyFastqJoiner" label="Enter output file label -o" />
+	</inputs>
+	<outputs>
+		<data format="input" name="out" label="${label.value}.${ftype.type}"/>
+            <change_format>
+                <when input="ftype.type" value="fasta" format="fasta" />
+            </change_format>
+	</outputs>
+	<help>
+
+.. class:: infomark
+
+**pyFastqJoiner**
+
+pyFastqJoiner is part of the pyCRAC_ package. Merges paired sequences from two fastq or fasta formatted files.
+
+Example::
+
+    Forward reaction:
+    
+    @FCC102EACXX:3:1101:1343:2181#ATCACGAT/1##CAATAG
+    CAAATTAGAGTGTTCAAAGCAGGCGTATTGCTCGAAT
+    +
+    `efhYb][bdQQ`eeaeaYbeY^ceU__IXa[^ZYae
+    @FCC102EACXX:3:1101:1424:2248#ATCACGAT/1##CCAGGA
+    CTAACCATAAACTATGCCTACTAGGGATCCAGAGGTG
+    +
+    ^_adddhJbaehbedd`dIb_^cXaRI^BBBBBBBBB
+    @FCC102EACXX:3:1101:1623:2036#ATCACGAN/1##CTCAGC
+    CAAAGTTAGGGGATCGAAGATGATCAGATACCGTCGT
+    +
+    bghfc^YbgbeadggfdffeaS^ac_X^cegaGZ_ef
+    @FCC102EACXX:3:1101:1574:2214#ATCACGAT/1##CGTTTT
+    CTAATGACCCACTCGGCACCTTACGAAATCAAAGTCT
+    +
+    cdfgYY`cefhhZef\eaggXaceeghfQaeghWNW\
+    
+    Reverse reaction:
+    
+    @FCC102EACXX:3:1101:1343:2181#ATCACGAT/2
+    AGCCTTTAAGTTTCAGCCTTGCGACCATACTCCCCCCAGAACCCAAAGA
+    +
+    YJaSJ`Z`K`YbSb[[daeJRR[YeWd_I^I^ecgc]OV\bdeaegbXb
+    @FCC102EACXX:3:1101:1424:2248#ATCACGAT/2
+    AAGTCCTTTAAGTTACAGCCTTGCGACCATACTACACCCAGAACCCAAA
+    +
+    YJJ\`JQY\`KJ`gY[[QRYY[[`H[_ceI^e[PYO^IWOHW^eaefhh
+    @FCC102EACXX:3:1101:1623:2036#ATCACGAN/2
+    GGCCAATCCTTATTGTGTCTGGACCTGGTGAGTTTCCCCGTGTTGAGTC
+    +
+    PP\`ccQ`eY[bQQ[d`ghehaghfgdg[`gb^bd[ePbH^c_c\a_eg
+    
+    Here the ":" character is used to split the two sequences. This character tells pyFastqSplitter where to split the sequences.
+    This character is ignored by pyFastqDuplicateRemover
+    
+    Result:
+    
+    @FCC102EACXX:3:1101:1343:2181#ATCACGAT/1##CAATAG@FCC102EACXX:3:1101:1343:2181#ATCACGAT/2
+    CAAATTAGAGTGTTCAAAGCAGGCGTATTGCTCGAAT:AGCCTTTAAGTTTCAGCCTTGCGACCATACTCCCCCCAGAACCCAAAGA
+    +
+    `efhYb][bdQQ`eeaeaYbeY^ceU__IXa[^ZYaeYJaSJ`Z`K`YbSb[[daeJRR[YeWd_I^I^ecgc]OV\bdeaegbXb
+    @FCC102EACXX:3:1101:1424:2248#ATCACGAT/1##CCAGGA@FCC102EACXX:3:1101:1424:2248#ATCACGAT/2
+    CTAACCATAAACTATGCCTACTAGGGATCCAGAGGTG:AAGTCCTTTAAGTTACAGCCTTGCGACCATACTACACCCAGAACCCAAA
+    +
+    ^_adddhJbaehbedd`dIb_^cXaRI^BBBBBBBBBYJJ\`JQY\`KJ`gY[[QRYY[[`H[_ceI^e[PYO^IWOHW^eaefhh
+    @FCC102EACXX:3:1101:1623:2036#ATCACGAN/1##CTCAGC@FCC102EACXX:3:1101:1623:2036#ATCACGAN/2
+    CAAAGTTAGGGGATCGAAGATGATCAGATACCGTCGT:GGCCAATCCTTATTGTGTCTGGACCTGGTGAGTTTCCCCGTGTTGAGTC
+    +
+    bghfc^YbgbeadggfdffeaS^ac_X^cegaGZ_efPP\`ccQ`eY[bQQ[d`ghehaghfgdg[`gb^bd[ePbH^c_c\a_eg
+       
+.. _pyCRAC: http://sandergranneman.bio.ed.ac.uk/Granneman_Lab/pyCRAC_software.html
+        
+------
+
+**Parameter list**
+
+Options::
+
+    -f fastq_file1 fastq_file2	
+                        Provide the names of two raw data files separated by a single space.
+                        Make sure the first file is the data file of the forward (/1) sequencing reaction.
+
+    --file_type=FASTQ     
+                        Can join fasta and fastq files. Fastq is default
+    
+    -o mergedfastq.fastq, --outfile=mergedfastq.fastq
+                        provide the name of the output file. By default it
+                        will be printed to the standard output
+    
+    -c :  
+                        This option adds the '|' character between the DNA
+                        sequences so that it is much easier to split the data
+                        again later on
+
+
+	</help>
+</tool>