--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/pyCRAC/pyFastqSplitter.xml	Tue Jun 18 09:11:00 2013 -0400
@@ -0,0 +1,140 @@
+ <tool id ="pyFastqSplitter" name="pyFastqSplitter" force_history_refresh="True">
+        <requirements>
+                <requirement type="package">pyCRAC</requirement>
+        </requirements>
+	<command interpreter="perl"> 
+	pyFastqSplitter.pl
+	-f $f
+	--o1 $out1
+	--id $label.value 
+	--o2 $out2
+	--file_type $ftype.type
+	#if $joinc.ch == "-c":
+        -c $joinc.c
+    #end if#
+	</command>
+	<version_command>/usr/local/bin/pyFastqSplitter.py --version</version_command>
+	<inputs>
+		<conditional name="ftype">
+            <param name="type" type="select" label="File type">
+                <option value="fastq" selected="true">FASTQ</option>
+                <option value="fasta">FASTA</option>
+            </param>
+            <when value="fastq">
+                <param format="fastq" name="f" type="data" label="FastQ File -f" help="FastQ format" />
+            </when>
+            <when value="fasta">
+                <param format="fasta" name="f" type="data" label="FastA File -f" help="FastA format" />
+            </when>
+		</conditional>
+		<conditional name="joinc">
+            <param name="ch" type="select"  label="Insert a character at join">
+                <option value="" selected="true">NO</option>
+                <option value="-c">YES</option>
+            </param>
+            <when value="-c">
+                <param type="text" name="c" label="Split the reads on the -c character" value=":" >
+                    <validator type="empty_field" message="enter a character or turn this option off" />
+                </param>
+            </when>
+            <when value="">
+            </when>
+		</conditional>
+	    <param name="label" type="text" format="txt" size="30" value="pyFastqSplitter" label="Enter output file label -o" />
+	</inputs>
+	<outputs>
+		<data format="input" name="out1" label="${label.value}_1.${ftype.type}"/>
+		<data format="input" name="out2" label="${label.value}_2.${ftype.type}"/>
+		    <change_format>
+                <when input="ftype.type" value="fasta" format="fasta" />
+            </change_format>
+	</outputs>
+	<help>
+
+.. class:: infomark
+
+**pyFastqSplitter**
+
+pyFastqSplitter is part of the pyCRAC_ package. Splits a merged fastq file (pyFastqJoiner output) in to two files.
+
+Example::
+    
+    Here the ":" character was used to separate the two sequences. By using the -c flag you can tell pyFastqSplitter where to split the sequences.
+    This character is ignored by pyFastqDuplicateRemover
+    
+    
+    @FCC102EACXX:3:1101:1343:2181#ATCACGAT/1##CAATAG@FCC102EACXX:3:1101:1343:2181#ATCACGAT/2
+    CAAATTAGAGTGTTCAAAGCAGGCGTATTGCTCGAAT:AGCCTTTAAGTTTCAGCCTTGCGACCATACTCCCCCCAGAACCCAAAGA
+    +
+    `efhYb][bdQQ`eeaeaYbeY^ceU__IXa[^ZYaeYJaSJ`Z`K`YbSb[[daeJRR[YeWd_I^I^ecgc]OV\bdeaegbXb
+    @FCC102EACXX:3:1101:1424:2248#ATCACGAT/1##CCAGGA@FCC102EACXX:3:1101:1424:2248#ATCACGAT/2
+    CTAACCATAAACTATGCCTACTAGGGATCCAGAGGTG:AAGTCCTTTAAGTTACAGCCTTGCGACCATACTACACCCAGAACCCAAA
+    +
+    ^_adddhJbaehbedd`dIb_^cXaRI^BBBBBBBBBYJJ\`JQY\`KJ`gY[[QRYY[[`H[_ceI^e[PYO^IWOHW^eaefhh
+    @FCC102EACXX:3:1101:1623:2036#ATCACGAN/1##CTCAGC@FCC102EACXX:3:1101:1623:2036#ATCACGAN/2
+    CAAAGTTAGGGGATCGAAGATGATCAGATACCGTCGT:GGCCAATCCTTATTGTGTCTGGACCTGGTGAGTTTCCCCGTGTTGAGTC
+    +
+    bghfc^YbgbeadggfdffeaS^ac_X^cegaGZ_efPP\`ccQ`eY[bQQ[d`ghehaghfgdg[`gb^bd[ePbH^c_c\a_eg
+    
+    Result:
+    
+    Forward reaction:
+    
+    @FCC102EACXX:3:1101:1343:2181#ATCACGAT/1##CAATAG
+    CAAATTAGAGTGTTCAAAGCAGGCGTATTGCTCGAAT
+    +
+    `efhYb][bdQQ`eeaeaYbeY^ceU__IXa[^ZYae
+    @FCC102EACXX:3:1101:1424:2248#ATCACGAT/1##CCAGGA
+    CTAACCATAAACTATGCCTACTAGGGATCCAGAGGTG
+    +
+    ^_adddhJbaehbedd`dIb_^cXaRI^BBBBBBBBB
+    @FCC102EACXX:3:1101:1623:2036#ATCACGAN/1##CTCAGC
+    CAAAGTTAGGGGATCGAAGATGATCAGATACCGTCGT
+    +
+    bghfc^YbgbeadggfdffeaS^ac_X^cegaGZ_ef
+    @FCC102EACXX:3:1101:1574:2214#ATCACGAT/1##CGTTTT
+    CTAATGACCCACTCGGCACCTTACGAAATCAAAGTCT
+    +
+    cdfgYY`cefhhZef\eaggXaceeghfQaeghWNW\
+    
+    Reverse reaction:
+    
+    @FCC102EACXX:3:1101:1343:2181#ATCACGAT/2
+    AGCCTTTAAGTTTCAGCCTTGCGACCATACTCCCCCCAGAACCCAAAGA
+    +
+    YJaSJ`Z`K`YbSb[[daeJRR[YeWd_I^I^ecgc]OV\bdeaegbXb
+    @FCC102EACXX:3:1101:1424:2248#ATCACGAT/2
+    AAGTCCTTTAAGTTACAGCCTTGCGACCATACTACACCCAGAACCCAAA
+    +
+    YJJ\`JQY\`KJ`gY[[QRYY[[`H[_ceI^e[PYO^IWOHW^eaefhh
+    @FCC102EACXX:3:1101:1623:2036#ATCACGAN/2
+    GGCCAATCCTTATTGTGTCTGGACCTGGTGAGTTTCCCCGTGTTGAGTC
+    +
+    PP\`ccQ`eY[bQQ[d`ghehaghfgdg[`gb^bd[ePbH^c_c\a_eg
+   
+.. _pyCRAC: http://sandergranneman.bio.ed.ac.uk/Granneman_Lab/pyCRAC_software.html
+        
+------
+
+**Parameter list**
+
+Options::
+
+    -f fastq_file, --filename=fastq_file
+                        To provide the names of two raw data files separated
+                        by a single space. Default = standard input
+    --file_type=FASTQ     
+                        Can split joined fasta and fastq files. Fastq is default
+                        If there isn't a specific character splitting the two reads
+                        the tool assumes that the two reads were of equal length
+    -o splitfastq, --outfile=splitfastq
+                        Provide the name of the output files (WITHOUT file
+                        extension). By default the data will be printed to the
+                        standard output
+    -c :, --character=:   
+                        If the joined sequences were separated by a specific
+                        character then the program can divide the sequences by
+                        looking for that character
+
+	</help>
+</tool>