Mercurial > repos > swebb > pycrac
diff pyCRAC/pyFastqSplitter.xml @ 0:19b20927172d draft
Uploaded
| author | swebb |
|---|---|
| date | Tue, 18 Jun 2013 09:11:00 -0400 |
| parents | |
| children |
line wrap: on
line diff
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/pyCRAC/pyFastqSplitter.xml Tue Jun 18 09:11:00 2013 -0400 @@ -0,0 +1,140 @@ + <tool id ="pyFastqSplitter" name="pyFastqSplitter" force_history_refresh="True"> + <requirements> + <requirement type="package">pyCRAC</requirement> + </requirements> + <command interpreter="perl"> + pyFastqSplitter.pl + -f $f + --o1 $out1 + --id $label.value + --o2 $out2 + --file_type $ftype.type + #if $joinc.ch == "-c": + -c $joinc.c + #end if# + </command> + <version_command>/usr/local/bin/pyFastqSplitter.py --version</version_command> + <inputs> + <conditional name="ftype"> + <param name="type" type="select" label="File type"> + <option value="fastq" selected="true">FASTQ</option> + <option value="fasta">FASTA</option> + </param> + <when value="fastq"> + <param format="fastq" name="f" type="data" label="FastQ File -f" help="FastQ format" /> + </when> + <when value="fasta"> + <param format="fasta" name="f" type="data" label="FastA File -f" help="FastA format" /> + </when> + </conditional> + <conditional name="joinc"> + <param name="ch" type="select" label="Insert a character at join"> + <option value="" selected="true">NO</option> + <option value="-c">YES</option> + </param> + <when value="-c"> + <param type="text" name="c" label="Split the reads on the -c character" value=":" > + <validator type="empty_field" message="enter a character or turn this option off" /> + </param> + </when> + <when value=""> + </when> + </conditional> + <param name="label" type="text" format="txt" size="30" value="pyFastqSplitter" label="Enter output file label -o" /> + </inputs> + <outputs> + <data format="input" name="out1" label="${label.value}_1.${ftype.type}"/> + <data format="input" name="out2" label="${label.value}_2.${ftype.type}"/> + <change_format> + <when input="ftype.type" value="fasta" format="fasta" /> + </change_format> + </outputs> + <help> + +.. class:: infomark + +**pyFastqSplitter** + +pyFastqSplitter is part of the pyCRAC_ package. Splits a merged fastq file (pyFastqJoiner output) in to two files. + +Example:: + + Here the ":" character was used to separate the two sequences. By using the -c flag you can tell pyFastqSplitter where to split the sequences. + This character is ignored by pyFastqDuplicateRemover + + + @FCC102EACXX:3:1101:1343:2181#ATCACGAT/1##CAATAG@FCC102EACXX:3:1101:1343:2181#ATCACGAT/2 + CAAATTAGAGTGTTCAAAGCAGGCGTATTGCTCGAAT:AGCCTTTAAGTTTCAGCCTTGCGACCATACTCCCCCCAGAACCCAAAGA + + + `efhYb][bdQQ`eeaeaYbeY^ceU__IXa[^ZYaeYJaSJ`Z`K`YbSb[[daeJRR[YeWd_I^I^ecgc]OV\bdeaegbXb + @FCC102EACXX:3:1101:1424:2248#ATCACGAT/1##CCAGGA@FCC102EACXX:3:1101:1424:2248#ATCACGAT/2 + CTAACCATAAACTATGCCTACTAGGGATCCAGAGGTG:AAGTCCTTTAAGTTACAGCCTTGCGACCATACTACACCCAGAACCCAAA + + + ^_adddhJbaehbedd`dIb_^cXaRI^BBBBBBBBBYJJ\`JQY\`KJ`gY[[QRYY[[`H[_ceI^e[PYO^IWOHW^eaefhh + @FCC102EACXX:3:1101:1623:2036#ATCACGAN/1##CTCAGC@FCC102EACXX:3:1101:1623:2036#ATCACGAN/2 + CAAAGTTAGGGGATCGAAGATGATCAGATACCGTCGT:GGCCAATCCTTATTGTGTCTGGACCTGGTGAGTTTCCCCGTGTTGAGTC + + + bghfc^YbgbeadggfdffeaS^ac_X^cegaGZ_efPP\`ccQ`eY[bQQ[d`ghehaghfgdg[`gb^bd[ePbH^c_c\a_eg + + Result: + + Forward reaction: + + @FCC102EACXX:3:1101:1343:2181#ATCACGAT/1##CAATAG + CAAATTAGAGTGTTCAAAGCAGGCGTATTGCTCGAAT + + + `efhYb][bdQQ`eeaeaYbeY^ceU__IXa[^ZYae + @FCC102EACXX:3:1101:1424:2248#ATCACGAT/1##CCAGGA + CTAACCATAAACTATGCCTACTAGGGATCCAGAGGTG + + + ^_adddhJbaehbedd`dIb_^cXaRI^BBBBBBBBB + @FCC102EACXX:3:1101:1623:2036#ATCACGAN/1##CTCAGC + CAAAGTTAGGGGATCGAAGATGATCAGATACCGTCGT + + + bghfc^YbgbeadggfdffeaS^ac_X^cegaGZ_ef + @FCC102EACXX:3:1101:1574:2214#ATCACGAT/1##CGTTTT + CTAATGACCCACTCGGCACCTTACGAAATCAAAGTCT + + + cdfgYY`cefhhZef\eaggXaceeghfQaeghWNW\ + + Reverse reaction: + + @FCC102EACXX:3:1101:1343:2181#ATCACGAT/2 + AGCCTTTAAGTTTCAGCCTTGCGACCATACTCCCCCCAGAACCCAAAGA + + + YJaSJ`Z`K`YbSb[[daeJRR[YeWd_I^I^ecgc]OV\bdeaegbXb + @FCC102EACXX:3:1101:1424:2248#ATCACGAT/2 + AAGTCCTTTAAGTTACAGCCTTGCGACCATACTACACCCAGAACCCAAA + + + YJJ\`JQY\`KJ`gY[[QRYY[[`H[_ceI^e[PYO^IWOHW^eaefhh + @FCC102EACXX:3:1101:1623:2036#ATCACGAN/2 + GGCCAATCCTTATTGTGTCTGGACCTGGTGAGTTTCCCCGTGTTGAGTC + + + PP\`ccQ`eY[bQQ[d`ghehaghfgdg[`gb^bd[ePbH^c_c\a_eg + +.. _pyCRAC: http://sandergranneman.bio.ed.ac.uk/Granneman_Lab/pyCRAC_software.html + +------ + +**Parameter list** + +Options:: + + -f fastq_file, --filename=fastq_file + To provide the names of two raw data files separated + by a single space. Default = standard input + --file_type=FASTQ + Can split joined fasta and fastq files. Fastq is default + If there isn't a specific character splitting the two reads + the tool assumes that the two reads were of equal length + -o splitfastq, --outfile=splitfastq + Provide the name of the output files (WITHOUT file + extension). By default the data will be printed to the + standard output + -c :, --character=: + If the joined sequences were separated by a specific + character then the program can divide the sequences by + looking for that character + + </help> +</tool>
