Mercurial > repos > swebb > pycrac
view pyCRAC/pyFasta2tab.xml @ 1:7c9574213c0a draft default tip
Uploaded
author | swebb |
---|---|
date | Thu, 20 Jun 2013 12:13:43 -0400 |
parents | 19b20927172d |
children |
line wrap: on
line source
<tool id="pyFasta2Tab" name="pyFasta2Tab"> <description>converter</description> <requirements> <requirement type="package">pyCRAC</requirement> </requirements> <command interpreter="python">/usr/local/bin/pyFasta2tab.py -f $input -o $output </command> <version_command>/usr/local/bin/pyFasta2tab.py --version</version_command> <inputs> <param name="input" type="data" format="fasta" label="Fasta file -f"/> <param name="label" type="text" format="txt" size="30" value="pyFasta2Tab" label="Enter output file label -o" /> </inputs> <outputs> <data name="output" format="tabular" label="${label.value}.tab"/> </outputs> <help> .. class:: infomark **pyFasta2Tab** pyFasta2Tab is part of the pyCRAC_ package. Converts fasta to tabular format. Is used to convert your reference sequences in fasta format to the tabular format that pyCRAC uses for almost all tools. Example:: >sequence1 ATAGGATACATAACCATATTATGAGACC Is converted into:: sequence1 ATAGGATACATAACCATATTATGAGACC The pyCRAC package lo .. _pyCRAC: http://sandergranneman.bio.ed.ac.uk/Granneman_Lab/pyCRAC_software.html ------- **Parameter list** Options:: -f fasta_file, --input_file=fasta_file provide the name and path of your fasta input file. Default is standard input. </help> </tool>