# HG changeset patch # User thanhlv # Date 1643627820 0 # Node ID a33c3356b8cff4dde50eae408f697e1812c25a54 "planemo upload for repository https://github.com/quadram-institute-bioscience/galaxy-tools/tree/master/tools/centrifuge commit e7a2d92dc14da78e7ba641c603de75a985d037b6-dirty" diff -r 000000000000 -r a33c3356b8cf CHANGELOG --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/CHANGELOG Mon Jan 31 11:17:00 2022 +0000 @@ -0,0 +1,3 @@ +Edited based on the original version at https://github.com/jvolkening/galaxy-tools +- 2022-01-31 + - Added k parameter diff -r 000000000000 -r a33c3356b8cf README diff -r 000000000000 -r a33c3356b8cf centrifuge.xml --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/centrifuge.xml Mon Jan 31 11:17:00 2022 +0000 @@ -0,0 +1,436 @@ + + + Read-based metagenome characterization + + + + + centrifuge + + + + + centrifuge --version | perl -wnE'print "$1\n" for /centrifuge\S+ version (\S+)/g' + + + + + + + + + + + +
+ + + + + + + + + + + + + + + + + + + + + + + + +
+ +
+ + + + + + + + + + + + + + +
+ +
+ + + + + + + + + + + + + + +
+ +
+ + + + + + + + + + + + + + + + + + + + +
+ + + + + + + + + (outputs['out_fmt'] == "tab") + + + (outputs['out_fmt'] == "sam") + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + {-1 -2 | -U | --sra-acc } [-S ] [--report-file ] + + Index filename prefix (minus trailing .X.cf). + Files with #1 mates, paired with files in . + Could be gzip'ed (extension: .gz) or bzip2'ed (extension: .bz2). + Files with #2 mates, paired with files in . + Could be gzip'ed (extension: .gz) or bzip2'ed (extension: .bz2). + Files with unpaired reads. + Could be gzip'ed (extension: .gz) or bzip2'ed (extension: .bz2). + Comma-separated list of SRA accession numbers, e.g. --sra-acc SRR353653,SRR353654. + File for classification output (default: stdout) + File for tabular report output (default: centrifuge_report.tsv) + + , , can be comma-separated lists (no whitespace) and can be + specified many times. E.g. '-U file1.fq,file2.fq -U file3.fq'. + + Options (defaults in parentheses): + + Input: + -q query input files are FASTQ .fq/.fastq (default) + --qseq query input files are in Illumina's qseq format + -f query input files are (multi-)FASTA .fa/.mfa + -r query input files are raw one-sequence-per-line + -c , , are sequences themselves, not files + -s/--skip skip the first reads/pairs in the input (none) + -u/--upto stop after first reads/pairs (no limit) + -5/--trim5 trim bases from 5'/left end of reads (0) + -3/--trim3 trim bases from 3'/right end of reads (0) + --phred33 qualities are Phred+33 (default) + --phred64 qualities are Phred+64 + --int-quals qualities encoded as space-delimited integers + --ignore-quals treat all quality values as 30 on Phred scale (off) + --nofw do not align forward (original) version of read (off) + --norc do not align reverse-complement version of read (off) + --sra-acc SRA accession ID + + Classification: + --min-hitlen minimum length of partial hits (default 22, must be greater than 15) + --min-totallen minimum summed length of partial hits per read (default 0) + --host-taxids comma-separated list of taxonomic IDs that will be preferred in classification + --exclude-taxids comma-separated list of taxonomic IDs that will be excluded in classification + + Output: + --out-fmt define output format, either 'tab' or 'sam' (tab) + --tab-fmt-cols columns in tabular format, comma separated + default: readID,seqID,taxID,score,2ndBestScore,hitLength,queryLength,numMatches + -t/--time print wall-clock time taken by search phases + --un write unpaired reads that didn't align to + --al write unpaired reads that aligned at least once to + --un-conc write pairs that didn't align concordantly to + --al-conc write pairs that aligned concordantly at least once to + (Note: for --un, --al, --un-conc, or --al-conc, add '-gz' to the option name, e.g. + --un-gz , to gzip compress output, or add '-bz2' to bzip2 compress output.) + --quiet print nothing to stderr except serious errors + --met-file send metrics to file at (off) + --met-stderr send metrics to stderr (off) + --met report internal counters & metrics every secs (1) + + Performance: + -o/--offrate override offrate of index; must be >= index's offrate + -p/--threads number of alignment threads to launch (1) + --mm use memory-mapped I/O for index; many 'bowtie's can share + + Other: + --qc-filter filter out reads that are bad according to QSEQ filter + --seed seed for random number generator (0) + --non-deterministic seed rand. gen. arbitrarily instead of using read attributes + --version print version information and quit + -h/--help print this usage message + + ]]> + + + + + + 10.1101/gr.210641.116 + + + diff -r 000000000000 -r a33c3356b8cf test-data/both.report --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/both.report Mon Jan 31 11:17:00 2022 +0000 @@ -0,0 +1,3 @@ +name taxID taxRank genomeSize numReads numUniqueReads abundance +Ailuropoda melanoleuca 9646 species 556 8 4 0.312231 +Bos taurus 9913 species 517 12 8 0.687769 diff -r 000000000000 -r a33c3356b8cf test-data/both.tsv --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/both.tsv Mon Jan 31 11:17:00 2022 +0000 @@ -0,0 +1,21 @@ +1 gi|4 9646 4050 0 120 120 1 +1_1 gi|4 9646 4225 0 80 80 1 +1_2 gi|4 9646 4225 0 80 80 1 +2 gi|4 9646 4050 2025 120 120 1 +2_1 gi|7 9913 4225 0 80 80 1 +2_2 gi|7 9913 4225 0 80 80 1 +2_3 gi|7 9913 4225 0 80 80 1 +2_4 gi|7 9913 4225 0 80 80 1 +2_5 gi|7 9913 4225 0 80 80 1 +2_6 gi|7 9913 4225 0 80 80 1 +3 gi|7 9913 4050 0 120 120 1 +4 gi|7 9913 4050 2025 120 120 1 +C_1 gi|4 9646 4225 4225 80 80 2 +C_1 gi|7 9913 4225 4225 80 80 2 +C_2 gi|4 9646 4225 4225 80 80 2 +C_2 gi|7 9913 4225 4225 80 80 2 +C_3 gi|4 9646 4225 4225 80 80 2 +C_3 gi|7 9913 4225 4225 80 80 2 +C_4 gi|4 9646 4225 4225 80 80 2 +C_4 gi|7 9913 4225 4225 80 80 2 +readID seqID taxID score 2ndBestScore hitLength queryLength numMatches diff -r 000000000000 -r a33c3356b8cf test-data/centrifuge_indices.loc --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/centrifuge_indices.loc Mon Jan 31 11:17:00 2022 +0000 @@ -0,0 +1,1 @@ +test_db test_db ${__HERE__}/db/centrifuge_test diff -r 000000000000 -r a33c3356b8cf test-data/db/centrifuge_test.1.cf Binary file test-data/db/centrifuge_test.1.cf has changed diff -r 000000000000 -r a33c3356b8cf test-data/db/centrifuge_test.2.cf Binary file test-data/db/centrifuge_test.2.cf has changed diff -r 000000000000 -r a33c3356b8cf test-data/db/centrifuge_test.3.cf Binary file test-data/db/centrifuge_test.3.cf has changed diff -r 000000000000 -r a33c3356b8cf test-data/defaults.report --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/defaults.report Mon Jan 31 11:17:00 2022 +0000 @@ -0,0 +1,3 @@ +name taxID taxRank genomeSize numReads numUniqueReads abundance +Ailuropoda melanoleuca 9646 species 556 6 2 0.230286 +Bos taurus 9913 species 517 10 6 0.769714 diff -r 000000000000 -r a33c3356b8cf test-data/defaults.tsv --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/defaults.tsv Mon Jan 31 11:17:00 2022 +0000 @@ -0,0 +1,17 @@ +1_1 gi|4 9646 4225 0 80 80 1 +1_2 gi|4 9646 4225 0 80 80 1 +2_1 gi|7 9913 4225 0 80 80 1 +2_2 gi|7 9913 4225 0 80 80 1 +2_3 gi|7 9913 4225 0 80 80 1 +2_4 gi|7 9913 4225 0 80 80 1 +2_5 gi|7 9913 4225 0 80 80 1 +2_6 gi|7 9913 4225 0 80 80 1 +C_1 gi|4 9646 4225 4225 80 80 2 +C_1 gi|7 9913 4225 4225 80 80 2 +C_2 gi|4 9646 4225 4225 80 80 2 +C_2 gi|7 9913 4225 4225 80 80 2 +C_3 gi|4 9646 4225 4225 80 80 2 +C_3 gi|7 9913 4225 4225 80 80 2 +C_4 gi|4 9646 4225 4225 80 80 2 +C_4 gi|7 9913 4225 4225 80 80 2 +readID seqID taxID score 2ndBestScore hitLength queryLength numMatches diff -r 000000000000 -r a33c3356b8cf test-data/exclude.report --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/exclude.report Mon Jan 31 11:17:00 2022 +0000 @@ -0,0 +1,2 @@ +name taxID taxRank genomeSize numReads numUniqueReads abundance +Ailuropoda melanoleuca 9646 species 556 6 6 1 diff -r 000000000000 -r a33c3356b8cf test-data/exclude.tsv --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/exclude.tsv Mon Jan 31 11:17:00 2022 +0000 @@ -0,0 +1,13 @@ +1_1 gi|4 9646 4225 0 80 80 1 +1_2 gi|4 9646 4225 0 80 80 1 +2_1 unclassified 0 0 0 0 80 1 +2_2 unclassified 0 0 0 0 80 1 +2_3 unclassified 0 0 0 0 80 1 +2_4 unclassified 0 0 0 0 80 1 +2_5 unclassified 0 0 0 0 80 1 +2_6 unclassified 0 0 0 0 80 1 +C_1 gi|4 9646 4225 0 80 80 1 +C_2 gi|4 9646 4225 0 80 80 1 +C_3 gi|4 9646 4225 0 80 80 1 +C_4 gi|4 9646 4225 0 80 80 1 +readID seqID taxID score 2ndBestScore hitLength queryLength numMatches diff -r 000000000000 -r a33c3356b8cf test-data/host.report --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/host.report Mon Jan 31 11:17:00 2022 +0000 @@ -0,0 +1,3 @@ +name taxID taxRank genomeSize numReads numUniqueReads abundance +Ailuropoda melanoleuca 9646 species 556 2 2 0.156809 +Bos taurus 9913 species 517 10 10 0.843191 diff -r 000000000000 -r a33c3356b8cf test-data/host.tsv --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/host.tsv Mon Jan 31 11:17:00 2022 +0000 @@ -0,0 +1,13 @@ +1_1 gi|4 9646 4225 0 80 80 1 +1_2 gi|4 9646 4225 0 80 80 1 +2_1 gi|7 9913 4225 0 80 80 1 +2_2 gi|7 9913 4225 0 80 80 1 +2_3 gi|7 9913 4225 0 80 80 1 +2_4 gi|7 9913 4225 0 80 80 1 +2_5 gi|7 9913 4225 0 80 80 1 +2_6 gi|7 9913 4225 0 80 80 1 +C_1 gi|7 9913 4225 0 80 80 1 +C_2 gi|7 9913 4225 0 80 80 1 +C_3 gi|7 9913 4225 0 80 80 1 +C_4 gi|7 9913 4225 0 80 80 1 +readID seqID taxID score 2ndBestScore hitLength queryLength numMatches diff -r 000000000000 -r a33c3356b8cf test-data/input_f.fq --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/input_f.fq Mon Jan 31 11:17:00 2022 +0000 @@ -0,0 +1,16 @@ +@1 +GGCGCTGAATCCTCGAAAATCCTGACCCTTTTAATTCATGCTCCCTTACTCACGAGAGAT ++ +555555555555555555555555555555555555555555555555555555555555 +@2 +CAGGCCCCTACACCCAATGTGGAACCGGGGTCCCGAATGAAAATGCTGCTGTTCCCTGGA ++ +555555555555555555555555555555555555555555555555555555555555 +@3 +GAGAACCCCCATGCTGCTCGCCCTGCTGGCCCTGGCCACACTCTGCCTCGCTGGCCGGGC ++ +555555555555555555555555555555555555555555555555555555555555 +@4 +CAGGCCCCTACACCCAATGTGGAACCGGGGTCCCGAATGAAAATGCTGCTGTTCCCTGGA ++ +555555555555555555555555555555555555555555555555555555555555 diff -r 000000000000 -r a33c3356b8cf test-data/input_r.fq --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/input_r.fq Mon Jan 31 11:17:00 2022 +0000 @@ -0,0 +1,16 @@ +@1 +AAGCCTGACGAGAGTGCCCCATAGTGGTCTCTGAGACCCCACACAGTCCAGGGAAATATC ++ +555555555555555555555555555555555555555555555555555555555555 +@2 +CCGTCTTAGCACTATCATCACCCTTCGTTAATAGGGAAACATGAGGGAACGTGGTCGCGA ++ +555555555555555555555555555555555555555555555555555555555555 +@3 +CTCGCTGCCCTCCTGCTTGGACACGAAGGCTGCGCCTTTGCCCGACTCTGCATCACCAGG ++ +555555555555555555555555555555555555555555555555555555555555 +@4 +TGGGTAGGGGGCTGGGGCTCCCAGCCAGTGGTCCAGGTAGCGCCTGAGTCTCTTCACCAA ++ +555555555555555555555555555555555555555555555555555555555555 diff -r 000000000000 -r a33c3356b8cf test-data/input_u.fq --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/input_u.fq Mon Jan 31 11:17:00 2022 +0000 @@ -0,0 +1,48 @@ +@C_1 +GATCCTCCCCAGGCCCCTACACCCAATGTGGAACCGGGGTCCCGAATGAAAATGCTGCTGTTCCCTGGAGGTGTTTTCCT ++ +55555555555555555555555555555555555555555555555555555555555555555555555555555555 +@C_2 +GATCCTCCCCAGGCCCCTACACCCAATGTGGAACCGGGGTCCCGAATGAAAATGCTGCTGTTCCCTGGAGGTGTTTTCCT ++ +55555555555555555555555555555555555555555555555555555555555555555555555555555555 +@C_3 +GATCCTCCCCAGGCCCCTACACCCAATGTGGAACCGGGGTCCCGAATGAAAATGCTGCTGTTCCCTGGAGGTGTTTTCCT ++ +55555555555555555555555555555555555555555555555555555555555555555555555555555555 +@C_4 +GATCCTCCCCAGGCCCCTACACCCAATGTGGAACCGGGGTCCCGAATGAAAATGCTGCTGTTCCCTGGAGGTGTTTTCCT ++ +55555555555555555555555555555555555555555555555555555555555555555555555555555555 +@1_1 +GGACGCTCTGCTTTGTTACCAATGAGAAGGGCGCTGAATCCTCGAAAATCCTGACCCTTTTAATTCATGCTCCCTTACTC ++ +55555555555555555555555555555555555555555555555555555555555555555555555555555555 +@1_2 +ACGAGAGATGATGATCGTTGATATTTCCCTGGACTGTGTGGGGTCTCAGAGACCACTATGGGGCACTCTCGTCAGGCTTC ++ +55555555555555555555555555555555555555555555555555555555555555555555555555555555 +@2_1 +TGGCCGGGCAGATGCAAAGCCTGGTGATGCAGAGTCGGGCAAAGGCGCAGCCTTCGTGTCCAAGCAGGAGGGCAGCGAGG ++ +55555555555555555555555555555555555555555555555555555555555555555555555555555555 +@2_2 +TGGCCGGGCAGATGCAAAGCCTGGTGATGCAGAGTCGGGCAAAGGCGCAGCCTTCGTGTCCAAGCAGGAGGGCAGCGAGG ++ +55555555555555555555555555555555555555555555555555555555555555555555555555555555 +@2_3 +TGGCCGGGCAGATGCAAAGCCTGGTGATGCAGAGTCGGGCAAAGGCGCAGCCTTCGTGTCCAAGCAGGAGGGCAGCGAGG ++ +55555555555555555555555555555555555555555555555555555555555555555555555555555555 +@2_4 +TGGCCGGGCAGATGCAAAGCCTGGTGATGCAGAGTCGGGCAAAGGCGCAGCCTTCGTGTCCAAGCAGGAGGGCAGCGAGG ++ +55555555555555555555555555555555555555555555555555555555555555555555555555555555 +@2_5 +TGGCCGGGCAGATGCAAAGCCTGGTGATGCAGAGTCGGGCAAAGGCGCAGCCTTCGTGTCCAAGCAGGAGGGCAGCGAGG ++ +55555555555555555555555555555555555555555555555555555555555555555555555555555555 +@2_6 +TGGCCGGGCAGATGCAAAGCCTGGTGATGCAGAGTCGGGCAAAGGCGCAGCCTTCGTGTCCAAGCAGGAGGGCAGCGAGG ++ +55555555555555555555555555555555555555555555555555555555555555555555555555555555 diff -r 000000000000 -r a33c3356b8cf test-data/minlen83.report --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/minlen83.report Mon Jan 31 11:17:00 2022 +0000 @@ -0,0 +1,1 @@ +name taxID taxRank genomeSize numReads numUniqueReads abundance diff -r 000000000000 -r a33c3356b8cf test-data/minlen83.tsv --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/minlen83.tsv Mon Jan 31 11:17:00 2022 +0000 @@ -0,0 +1,13 @@ +1_1 unclassified 0 0 0 0 80 1 +1_2 unclassified 0 0 0 0 80 1 +2_1 unclassified 0 0 0 0 80 1 +2_2 unclassified 0 0 0 0 80 1 +2_3 unclassified 0 0 0 0 80 1 +2_4 unclassified 0 0 0 0 80 1 +2_5 unclassified 0 0 0 0 80 1 +2_6 unclassified 0 0 0 0 80 1 +C_1 unclassified 0 0 0 0 80 1 +C_2 unclassified 0 0 0 0 80 1 +C_3 unclassified 0 0 0 0 80 1 +C_4 unclassified 0 0 0 0 80 1 +readID seqID taxID score 2ndBestScore hitLength queryLength numMatches diff -r 000000000000 -r a33c3356b8cf test-data/nofw.report --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/nofw.report Mon Jan 31 11:17:00 2022 +0000 @@ -0,0 +1,3 @@ +name taxID taxRank genomeSize numReads numUniqueReads abundance +Ailuropoda melanoleuca 9646 species 556 6 2 0.230286 +Bos taurus 9913 species 517 10 6 0.769714 diff -r 000000000000 -r a33c3356b8cf test-data/nofw.tsv --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/nofw.tsv Mon Jan 31 11:17:00 2022 +0000 @@ -0,0 +1,17 @@ +1_1 gi|4 9646 4225 0 80 80 1 +1_2 gi|4 9646 4225 0 80 80 1 +2_1 gi|7 9913 4225 0 80 80 1 +2_2 gi|7 9913 4225 0 80 80 1 +2_3 gi|7 9913 4225 0 80 80 1 +2_4 gi|7 9913 4225 0 80 80 1 +2_5 gi|7 9913 4225 0 80 80 1 +2_6 gi|7 9913 4225 0 80 80 1 +C_1 gi|4 9646 4225 4225 80 80 2 +C_1 gi|7 9913 4225 4225 80 80 2 +C_2 gi|4 9646 4225 4225 80 80 2 +C_2 gi|7 9913 4225 4225 80 80 2 +C_3 gi|4 9646 4225 4225 80 80 2 +C_3 gi|7 9913 4225 4225 80 80 2 +C_4 gi|4 9646 4225 4225 80 80 2 +C_4 gi|7 9913 4225 4225 80 80 2 +readID seqID taxID score 2ndBestScore hitLength queryLength numMatches diff -r 000000000000 -r a33c3356b8cf test-data/norc.report --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/norc.report Mon Jan 31 11:17:00 2022 +0000 @@ -0,0 +1,3 @@ +name taxID taxRank genomeSize numReads numUniqueReads abundance +Ailuropoda melanoleuca 9646 species 556 6 2 0.230286 +Bos taurus 9913 species 517 10 6 0.769714 diff -r 000000000000 -r a33c3356b8cf test-data/norc.tsv --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/norc.tsv Mon Jan 31 11:17:00 2022 +0000 @@ -0,0 +1,17 @@ +1_1 gi|4 9646 4225 0 80 80 1 +1_2 gi|4 9646 4225 0 80 80 1 +2_1 gi|7 9913 4225 0 80 80 1 +2_2 gi|7 9913 4225 0 80 80 1 +2_3 gi|7 9913 4225 0 80 80 1 +2_4 gi|7 9913 4225 0 80 80 1 +2_5 gi|7 9913 4225 0 80 80 1 +2_6 gi|7 9913 4225 0 80 80 1 +C_1 gi|4 9646 4225 4225 80 80 2 +C_1 gi|7 9913 4225 4225 80 80 2 +C_2 gi|4 9646 4225 4225 80 80 2 +C_2 gi|7 9913 4225 4225 80 80 2 +C_3 gi|4 9646 4225 4225 80 80 2 +C_3 gi|7 9913 4225 4225 80 80 2 +C_4 gi|4 9646 4225 4225 80 80 2 +C_4 gi|7 9913 4225 4225 80 80 2 +readID seqID taxID score 2ndBestScore hitLength queryLength numMatches diff -r 000000000000 -r a33c3356b8cf test-data/paired.report --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/paired.report Mon Jan 31 11:17:00 2022 +0000 @@ -0,0 +1,3 @@ +name taxID taxRank genomeSize numReads numUniqueReads abundance +Ailuropoda melanoleuca 9646 species 556 2 2 0.481827 +Bos taurus 9913 species 517 2 2 0.518173 diff -r 000000000000 -r a33c3356b8cf test-data/paired.sam --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/paired.sam Mon Jan 31 11:17:00 2022 +0000 @@ -0,0 +1,4 @@ +1 0 9646 0 0 *0 gi|4 0 0 GGCGCTGAATCCTCGAAAATCCTGACCCTTTTAATTCATGCTCCCTTACTCACGAGAGATNAAGCCTGACGAGAGTGCCCCATAGTGGTCTCTGAGACCCCACACAGTCCAGGGAAATATC 555555555555555555555555555555555555555555555555555555555555I555555555555555555555555555555555555555555555555555555555555 +2 0 9646 0 0 *0 gi|4 0 0 CAGGCCCCTACACCCAATGTGGAACCGGGGTCCCGAATGAAAATGCTGCTGTTCCCTGGANCCGTCTTAGCACTATCATCACCCTTCGTTAATAGGGAAACATGAGGGAACGTGGTCGCGA 555555555555555555555555555555555555555555555555555555555555I555555555555555555555555555555555555555555555555555555555555 +3 0 9913 0 0 *0 gi|7 0 0 GAGAACCCCCATGCTGCTCGCCCTGCTGGCCCTGGCCACACTCTGCCTCGCTGGCCGGGCNCTCGCTGCCCTCCTGCTTGGACACGAAGGCTGCGCCTTTGCCCGACTCTGCATCACCAGG 555555555555555555555555555555555555555555555555555555555555I555555555555555555555555555555555555555555555555555555555555 +4 0 9913 0 0 *0 gi|7 0 0 CAGGCCCCTACACCCAATGTGGAACCGGGGTCCCGAATGAAAATGCTGCTGTTCCCTGGANTGGGTAGGGGGCTGGGGCTCCCAGCCAGTGGTCCAGGTAGCGCCTGAGTCTCTTCACCAA 555555555555555555555555555555555555555555555555555555555555I555555555555555555555555555555555555555555555555555555555555 diff -r 000000000000 -r a33c3356b8cf test-data/paired.tsv --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/paired.tsv Mon Jan 31 11:17:00 2022 +0000 @@ -0,0 +1,5 @@ +1 gi|4 9646 4050 0 120 120 1 +2 gi|4 9646 4050 2025 120 120 1 +3 gi|7 9913 4050 0 120 120 1 +4 gi|7 9913 4050 2025 120 120 1 +readID seqID taxID score 2ndBestScore hitLength queryLength numMatches diff -r 000000000000 -r a33c3356b8cf test-data/seed123.report --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/seed123.report Mon Jan 31 11:17:00 2022 +0000 @@ -0,0 +1,3 @@ +name taxID taxRank genomeSize numReads numUniqueReads abundance +Ailuropoda melanoleuca 9646 species 556 6 2 0.230286 +Bos taurus 9913 species 517 10 6 0.769714 diff -r 000000000000 -r a33c3356b8cf test-data/seed123.tsv --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/seed123.tsv Mon Jan 31 11:17:00 2022 +0000 @@ -0,0 +1,17 @@ +1_1 gi|4 9646 4225 0 80 80 1 +1_2 gi|4 9646 4225 0 80 80 1 +2_1 gi|7 9913 4225 0 80 80 1 +2_2 gi|7 9913 4225 0 80 80 1 +2_3 gi|7 9913 4225 0 80 80 1 +2_4 gi|7 9913 4225 0 80 80 1 +2_5 gi|7 9913 4225 0 80 80 1 +2_6 gi|7 9913 4225 0 80 80 1 +C_1 gi|4 9646 4225 4225 80 80 2 +C_1 gi|7 9913 4225 4225 80 80 2 +C_2 gi|4 9646 4225 4225 80 80 2 +C_2 gi|7 9913 4225 4225 80 80 2 +C_3 gi|4 9646 4225 4225 80 80 2 +C_3 gi|7 9913 4225 4225 80 80 2 +C_4 gi|4 9646 4225 4225 80 80 2 +C_4 gi|7 9913 4225 4225 80 80 2 +readID seqID taxID score 2ndBestScore hitLength queryLength numMatches diff -r 000000000000 -r a33c3356b8cf test-data/skip3.report --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/skip3.report Mon Jan 31 11:17:00 2022 +0000 @@ -0,0 +1,3 @@ +name taxID taxRank genomeSize numReads numUniqueReads abundance +Ailuropoda melanoleuca 9646 species 556 3 2 0.235009 +Bos taurus 9913 species 517 7 6 0.764991 diff -r 000000000000 -r a33c3356b8cf test-data/skip3.tsv --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/skip3.tsv Mon Jan 31 11:17:00 2022 +0000 @@ -0,0 +1,11 @@ +1_1 gi|4 9646 4225 0 80 80 1 +1_2 gi|4 9646 4225 0 80 80 1 +2_1 gi|7 9913 4225 0 80 80 1 +2_2 gi|7 9913 4225 0 80 80 1 +2_3 gi|7 9913 4225 0 80 80 1 +2_4 gi|7 9913 4225 0 80 80 1 +2_5 gi|7 9913 4225 0 80 80 1 +2_6 gi|7 9913 4225 0 80 80 1 +C_4 gi|4 9646 4225 4225 80 80 2 +C_4 gi|7 9913 4225 4225 80 80 2 +readID seqID taxID score 2ndBestScore hitLength queryLength numMatches diff -r 000000000000 -r a33c3356b8cf test-data/trim3_5.report --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/trim3_5.report Mon Jan 31 11:17:00 2022 +0000 @@ -0,0 +1,3 @@ +name taxID taxRank genomeSize numReads numUniqueReads abundance +Ailuropoda melanoleuca 9646 species 556 6 2 0.230286 +Bos taurus 9913 species 517 10 6 0.769714 diff -r 000000000000 -r a33c3356b8cf test-data/trim3_5.tsv --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/trim3_5.tsv Mon Jan 31 11:17:00 2022 +0000 @@ -0,0 +1,17 @@ +1_1 gi|4 9646 3600 0 75 75 1 +1_2 gi|4 9646 3600 0 75 75 1 +2_1 gi|7 9913 3600 0 75 75 1 +2_2 gi|7 9913 3600 0 75 75 1 +2_3 gi|7 9913 3600 0 75 75 1 +2_4 gi|7 9913 3600 0 75 75 1 +2_5 gi|7 9913 3600 0 75 75 1 +2_6 gi|7 9913 3600 0 75 75 1 +C_1 gi|4 9646 3600 3600 75 75 2 +C_1 gi|7 9913 3600 3600 75 75 2 +C_2 gi|4 9646 3600 3600 75 75 2 +C_2 gi|7 9913 3600 3600 75 75 2 +C_3 gi|4 9646 3600 3600 75 75 2 +C_3 gi|7 9913 3600 3600 75 75 2 +C_4 gi|4 9646 3600 3600 75 75 2 +C_4 gi|7 9913 3600 3600 75 75 2 +readID seqID taxID score 2ndBestScore hitLength queryLength numMatches diff -r 000000000000 -r a33c3356b8cf test-data/trim5_10.report --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/trim5_10.report Mon Jan 31 11:17:00 2022 +0000 @@ -0,0 +1,3 @@ +name taxID taxRank genomeSize numReads numUniqueReads abundance +Ailuropoda melanoleuca 9646 species 556 6 2 0.230286 +Bos taurus 9913 species 517 10 6 0.769714 diff -r 000000000000 -r a33c3356b8cf test-data/trim5_10.tsv --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/trim5_10.tsv Mon Jan 31 11:17:00 2022 +0000 @@ -0,0 +1,17 @@ +1_1 gi|4 9646 3025 0 70 70 1 +1_2 gi|4 9646 3025 0 70 70 1 +2_1 gi|7 9913 3025 0 70 70 1 +2_2 gi|7 9913 3025 0 70 70 1 +2_3 gi|7 9913 3025 0 70 70 1 +2_4 gi|7 9913 3025 0 70 70 1 +2_5 gi|7 9913 3025 0 70 70 1 +2_6 gi|7 9913 3025 0 70 70 1 +C_1 gi|4 9646 3025 3025 70 70 2 +C_1 gi|7 9913 3025 3025 70 70 2 +C_2 gi|4 9646 3025 3025 70 70 2 +C_2 gi|7 9913 3025 3025 70 70 2 +C_3 gi|4 9646 3025 3025 70 70 2 +C_3 gi|7 9913 3025 3025 70 70 2 +C_4 gi|4 9646 3025 3025 70 70 2 +C_4 gi|7 9913 3025 3025 70 70 2 +readID seqID taxID score 2ndBestScore hitLength queryLength numMatches diff -r 000000000000 -r a33c3356b8cf test-data/upto6.report --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/upto6.report Mon Jan 31 11:17:00 2022 +0000 @@ -0,0 +1,3 @@ +name taxID taxRank genomeSize numReads numUniqueReads abundance +Ailuropoda melanoleuca 9646 species 556 6 2 1 +Bos taurus 9913 species 517 4 0 7.1246e-13 diff -r 000000000000 -r a33c3356b8cf test-data/upto6.tsv --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/upto6.tsv Mon Jan 31 11:17:00 2022 +0000 @@ -0,0 +1,11 @@ +1_1 gi|4 9646 4225 0 80 80 1 +1_2 gi|4 9646 4225 0 80 80 1 +C_1 gi|4 9646 4225 4225 80 80 2 +C_1 gi|7 9913 4225 4225 80 80 2 +C_2 gi|4 9646 4225 4225 80 80 2 +C_2 gi|7 9913 4225 4225 80 80 2 +C_3 gi|4 9646 4225 4225 80 80 2 +C_3 gi|7 9913 4225 4225 80 80 2 +C_4 gi|4 9646 4225 4225 80 80 2 +C_4 gi|7 9913 4225 4225 80 80 2 +readID seqID taxID score 2ndBestScore hitLength queryLength numMatches diff -r 000000000000 -r a33c3356b8cf tool-data/centrifuge_indices.loc --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/tool-data/centrifuge_indices.loc Mon Jan 31 11:17:00 2022 +0000 @@ -0,0 +1,17 @@ +# centrifuge_indices.loc.sample +# This is a *.loc.sample file distributed with Galaxy that enables tools +# to use a directory of indexed data files. This one is for GOTTCHA. +# See the wiki: http://wiki.galaxyproject.org/Admin/NGS%20Local%20Setup +# First create these data files and save them in your own data directory structure. +# Then, create a bowtie_indices.loc file to use those indexes with tools. +# Copy this file, save it with the same name (minus the .sample), +# follow the format examples, and store the result in this directory. +# The file should include an one line entry for each index set. +# The path points to the "basename" for the set, not a specific file. +# It has three text columns seperated by TABS. +# +# +# +#bacteria_v20150825 Bacteria /depot/data2/galaxy/gottcha/GOTTCHA_BACTERIA_c4937_k24_u30_xHUMAN3x.species +#viruses_v20150825 Viruses /depot/data2/galaxy/gottcha/GOTTCHA_VIRUSES_c5900_k24_u30_xHUMAN3x.species +test test foo/bar/baz diff -r 000000000000 -r a33c3356b8cf tool-data/centrifuge_indices.loc.sample --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/tool-data/centrifuge_indices.loc.sample Mon Jan 31 11:17:00 2022 +0000 @@ -0,0 +1,17 @@ +# centrifuge_indices.loc.sample +# This is a *.loc.sample file distributed with Galaxy that enables tools +# to use a directory of indexed data files. This one is for GOTTCHA. +# See the wiki: http://wiki.galaxyproject.org/Admin/NGS%20Local%20Setup +# First create these data files and save them in your own data directory structure. +# Then, create a bowtie_indices.loc file to use those indexes with tools. +# Copy this file, save it with the same name (minus the .sample), +# follow the format examples, and store the result in this directory. +# The file should include an one line entry for each index set. +# The path points to the "basename" for the set, not a specific file. +# It has three text columns seperated by TABS. +# +# +# +#bacteria_v20150825 Bacteria /depot/data2/galaxy/gottcha/GOTTCHA_BACTERIA_c4937_k24_u30_xHUMAN3x.species +#viruses_v20150825 Viruses /depot/data2/galaxy/gottcha/GOTTCHA_VIRUSES_c5900_k24_u30_xHUMAN3x.species +test test foo/bar/baz diff -r 000000000000 -r a33c3356b8cf tool_data_table_conf.xml.sample --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/tool_data_table_conf.xml.sample Mon Jan 31 11:17:00 2022 +0000 @@ -0,0 +1,8 @@ + + + + + value, name, path + +
+ diff -r 000000000000 -r a33c3356b8cf tool_data_table_conf.xml.test --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/tool_data_table_conf.xml.test Mon Jan 31 11:17:00 2022 +0000 @@ -0,0 +1,6 @@ + + + value, name, path + +
+