# HG changeset patch
# User triasteran
# Date 1645624650 0
# Node ID 9e5052835e3488ac4eeb7ebdab262426e4a43a31
# Parent a2b0620733e37ac54dfbf609ad8681fbdd6a075f
Uploaded
diff -r a2b0620733e3 -r 9e5052835e34 bowtie_remove_rrna_wrapper/.hgignore
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/bowtie_remove_rrna_wrapper/.hgignore Wed Feb 23 13:57:30 2022 +0000
@@ -0,0 +1,2 @@
+syntax: glob
+.idea
diff -r a2b0620733e3 -r 9e5052835e34 bowtie_remove_rrna_wrapper/bowtie_indices.loc.sample
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/bowtie_remove_rrna_wrapper/bowtie_indices.loc.sample Wed Feb 23 13:57:30 2022 +0000
@@ -0,0 +1,1 @@
+Mouse_rRNA Mouse_rRNA Mouse_rRNA /home/DATA/galaxy/galaxy-dist/data/indexes/bowtie_rrna_indexes/Mouse_rRNA/bowtie_rrna_indexes/mouse_rRNA_index
diff -r a2b0620733e3 -r 9e5052835e34 bowtie_remove_rrna_wrapper/bowtie_remove_rrna_wrapper.xml
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/bowtie_remove_rrna_wrapper/bowtie_remove_rrna_wrapper.xml Wed Feb 23 13:57:30 2022 +0000
@@ -0,0 +1,681 @@
+
+
+ bowtie
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+ ((
+ singlePaired['sPaired'] == "single" and
+ singlePaired['sParams']['sSettingsType'] == "full" and
+ singlePaired['sParams']['sMaxFile'] is True
+ ) or (
+ singlePaired['sPaired'] == "paired" and
+ singlePaired['pParams']['pSettingsType'] == "full" and
+ singlePaired['pParams']['pMaxFile'] is True
+ ))
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+ singlePaired['sPaired'] == "paired"
+ singlePaired['pParams']['pSettingsType'] == "full"
+ singlePaired['pParams']['pMaxFile'] is True
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+ ((
+ singlePaired['sPaired'] == "single" and
+ singlePaired['sParams']['sSettingsType'] == "full" and
+ singlePaired['sParams']['sUnmappedFile'] is True
+ ) or (
+ singlePaired['sPaired'] == "paired" and
+ singlePaired['pParams']['pSettingsType'] == "full" and
+ singlePaired['pParams']['pUnmappedFile'] is True
+ ))
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+ singlePaired['sPaired'] == "paired"
+ singlePaired['pParams']['pSettingsType'] == "full"
+ singlePaired['pParams']['pUnmappedFile'] is True
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+@misc{githubbowtie,
+ author = {LastTODO, FirstTODO},
+ year = {TODO},
+ title = {bowtie},
+ publisher = {GitHub},
+ journal = {GitHub repository},
+ url = {https://github.com/BenLangmead/bowtie},
+}
+
+
diff -r a2b0620733e3 -r 9e5052835e34 bowtie_remove_rrna_wrapper/bowtie_wrapper.py
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/bowtie_remove_rrna_wrapper/bowtie_wrapper.py Wed Feb 23 13:57:30 2022 +0000
@@ -0,0 +1,469 @@
+#!/usr/bin/env python
+
+"""
+Runs Bowtie on single-end or paired-end data.
+For use with Bowtie v. 0.12.7
+
+usage: bowtie_wrapper.py [options]
+ -t, --threads=t: The number of threads to run
+ -o, --output=o: The output file
+ --output_unmapped_reads=: File name for unmapped reads (single-end)
+ --output_unmapped_reads_l=: File name for unmapped reads (left, paired-end)
+ --output_unmapped_reads_r=: File name for unmapped reads (right, paired-end)
+ --output_suppressed_reads=: File name for suppressed reads because of max setting (single-end)
+ --output_suppressed_reads_l=: File name for suppressed reads because of max setting (left, paired-end)
+ --output_suppressed_reads_r=: File name for suppressed reads because of max setting (right, paired-end)
+ -i, --input1=i: The (forward or single-end) reads file in Sanger FASTQ format
+ -I, --input2=I: The reverse reads file in Sanger FASTQ format
+ -4, --dataType=4: The type of data (SOLiD or Solexa)
+ -2, --paired=2: Whether the data is single- or paired-end
+ -g, --genomeSource=g: The type of reference provided
+ -r, --ref=r: The reference genome to use or index
+ -s, --skip=s: Skip the first n reads
+ -a, --alignLimit=a: Only align the first n reads
+ -T, --trimH=T: Trim n bases from high-quality (left) end of each read before alignment
+ -L, --trimL=L: Trim n bases from low-quality (right) end of each read before alignment
+ -m, --mismatchSeed=m: Maximum number of mismatches permitted in the seed
+ -M, --mismatchQual=M: Maximum permitted total of quality values at mismatched read positions
+ -l, --seedLen=l: Seed length
+ -n, --rounding=n: Whether or not to round to the nearest 10 and saturating at 30
+ -P, --maqSoapAlign=P: Choose MAQ- or SOAP-like alignment policy
+ -w, --tryHard=: Whether or not to try as hard as possible to find valid alignments when they exist
+ -v, --valAlign=v: Report up to n valid arguments per read
+ -V, --allValAligns=V: Whether or not to report all valid alignments per read
+ -G, --suppressAlign=G: Suppress all alignments for a read if more than n reportable alignments exist
+ -b, --best=b: Whether or not to make Bowtie guarantee that reported singleton alignments are 'best' in terms of stratum and in terms of the quality values at the mismatched positions
+ -B, --maxBacktracks=B: Maximum number of backtracks permitted when aligning a read
+ -R, --strata=R: Whether or not to report only those alignments that fall in the best stratum if many valid alignments exist and are reportable
+ -j, --minInsert=j: Minimum insert size for valid paired-end alignments
+ -J, --maxInsert=J: Maximum insert size for valid paired-end alignments
+ -O, --mateOrient=O: The upstream/downstream mate orientation for valid paired-end alignment against the forward reference strand
+ -A, --maxAlignAttempt=A: Maximum number of attempts Bowtie will make to match an alignment for one mate with an alignment for the opposite mate
+ -f, --forwardAlign=f: Whether or not to attempt to align the forward reference strand
+ -E, --reverseAlign=E: Whether or not to attempt to align the reverse-complement reference strand
+ -F, --offrate=F: Override the offrate of the index to n
+ -8, --snpphred=8: SNP penalty on Phred scale
+ -6, --snpfrac=6: Fraction of sites expected to be SNP sites
+ -7, --keepends=7: Keep extreme-end nucleotides and qualities
+ -S, --seed=S: Seed for pseudo-random number generator
+ -C, --params=C: Whether to use default or specified parameters
+ -u, --iautoB=u: Automatic or specified behavior
+ -K, --ipacked=K: Whether or not to use a packed representation for DNA strings
+ -Q, --ibmax=Q: Maximum number of suffixes allowed in a block
+ -Y, --ibmaxdivn=Y: Maximum number of suffixes allowed in a block as a fraction of the length of the reference
+ -D, --idcv=D: The period for the difference-cover sample
+ -U, --inodc=U: Whether or not to disable the use of the difference-cover sample
+ -y, --inoref=y: Whether or not to build the part of the reference index used only in paired-end alignment
+ -z, --ioffrate=z: How many rows get marked during annotation of some or all of the Burrows-Wheeler rows
+ -W, --iftab=W: The size of the lookup table used to calculate an initial Burrows-Wheeler range with respect to the first n characters of the query
+ -X, --intoa=X: Whether or not to convert Ns in the reference sequence to As
+ -N, --iendian=N: Endianness to use when serializing integers to the index file
+ -Z, --iseed=Z: Seed for the pseudorandom number generator
+ -c, --icutoff=c: Number of first bases of the reference sequence to index
+ -x, --indexSettings=x: Whether or not indexing options are to be set
+ -H, --suppressHeader=H: Suppress header
+ --do_not_build_index: Flag to specify that provided file is already indexed and to just use 'as is'
+"""
+
+import optparse, os, shutil, subprocess, sys, tempfile
+
+#Allow more than Sanger encoded variants
+DEFAULT_ASCII_ENCODING = '--phred33-quals'
+GALAXY_FORMAT_TO_QUALITY_SCORE_ENCODING_ARG = { 'fastqsanger':'--phred33-quals', 'fastqillumina':'--phred64-quals', 'fastqsolexa':'--solexa-quals' }
+#FIXME: Integer quality scores are supported only when the '--integer-quals' argument is specified to bowtie; this is not currently able to be set in the tool/wrapper/config
+
+def stop_err( msg ):
+ sys.stderr.write( '%s\n' % msg )
+ sys.exit()
+
+def __main__():
+ #Parse Command Line
+ parser = optparse.OptionParser()
+ parser.add_option( '-t', '--threads', dest='threads', help='The number of threads to run' )
+ parser.add_option( '-o', '--output', dest='output', help='The output file' )
+ parser.add_option( '', '--output_unmapped_reads', dest='output_unmapped_reads', help='File name for unmapped reads (single-end)' )
+ parser.add_option( '', '--output_unmapped_reads_l', dest='output_unmapped_reads_l', help='File name for unmapped reads (left, paired-end)' )
+ parser.add_option( '', '--output_unmapped_reads_r', dest='output_unmapped_reads_r', help='File name for unmapped reads (right, paired-end)' )
+ parser.add_option( '', '--output_suppressed_reads', dest='output_suppressed_reads', help='File name for suppressed reads because of max setting (single-end)' )
+ parser.add_option( '', '--output_suppressed_reads_l', dest='output_suppressed_reads_l', help='File name for suppressed reads because of max setting (left, paired-end)' )
+ parser.add_option( '', '--output_suppressed_reads_r', dest='output_suppressed_reads_r', help='File name for suppressed reads because of max setting (right, paired-end)' )
+ parser.add_option( '-4', '--dataType', dest='dataType', help='The type of data (SOLiD or Solexa)' )
+ parser.add_option( '-i', '--input1', dest='input1', help='The (forward or single-end) reads file in Sanger FASTQ format' )
+ parser.add_option( '-I', '--input2', dest='input2', help='The reverse reads file in Sanger FASTQ format' )
+ parser.add_option( '-2', '--paired', dest='paired', help='Whether the data is single- or paired-end' )
+ parser.add_option( '-g', '--genomeSource', dest='genomeSource', help='The type of reference provided' )
+ parser.add_option( '-r', '--ref', dest='ref', help='The reference genome to use or index' )
+ parser.add_option( '-s', '--skip', dest='skip', help='Skip the first n reads' )
+ parser.add_option( '-a', '--alignLimit', dest='alignLimit', help='Only align the first n reads' )
+ parser.add_option( '-T', '--trimH', dest='trimH', help='Trim n bases from high-quality (left) end of each read before alignment' )
+ parser.add_option( '-L', '--trimL', dest='trimL', help='Trim n bases from low-quality (right) end of each read before alignment' )
+ parser.add_option( '-m', '--mismatchSeed', dest='mismatchSeed', help='Maximum number of mismatches permitted in the seed' )
+ parser.add_option( '-M', '--mismatchQual', dest='mismatchQual', help='Maximum permitted total of quality values at mismatched read positions' )
+ parser.add_option( '-l', '--seedLen', dest='seedLen', help='Seed length' )
+ parser.add_option( '-n', '--rounding', dest='rounding', help='Whether or not to round to the nearest 10 and saturating at 30' )
+ parser.add_option( '-P', '--maqSoapAlign', dest='maqSoapAlign', help='Choose MAQ- or SOAP-like alignment policy' )
+ parser.add_option( '-w', '--tryHard', dest='tryHard', help='Whether or not to try as hard as possible to find valid alignments when they exist' )
+ parser.add_option( '-v', '--valAlign', dest='valAlign', help='Report up to n valid arguments per read' )
+ parser.add_option( '-V', '--allValAligns', dest='allValAligns', help='Whether or not to report all valid alignments per read' )
+ parser.add_option( '-G', '--suppressAlign', dest='suppressAlign', help='Suppress all alignments for a read if more than n reportable alignments exist' )
+ parser.add_option( '-b', '--best', dest='best', help="Whether or not to make Bowtie guarantee that reported singleton alignments are 'best' in terms of stratum and in terms of the quality values at the mismatched positions" )
+ parser.add_option( '-B', '--maxBacktracks', dest='maxBacktracks', help='Maximum number of backtracks permitted when aligning a read' )
+ parser.add_option( '-R', '--strata', dest='strata', help='Whether or not to report only those alignments that fall in the best stratum if many valid alignments exist and are reportable' )
+ parser.add_option( '-j', '--minInsert', dest='minInsert', help='Minimum insert size for valid paired-end alignments' )
+ parser.add_option( '-J', '--maxInsert', dest='maxInsert', help='Maximum insert size for valid paired-end alignments' )
+ parser.add_option( '-O', '--mateOrient', dest='mateOrient', help='The upstream/downstream mate orientation for valid paired-end alignment against the forward reference strand' )
+ parser.add_option( '-A', '--maxAlignAttempt', dest='maxAlignAttempt', help='Maximum number of attempts Bowtie will make to match an alignment for one mate with an alignment for the opposite mate' )
+ parser.add_option( '-f', '--forwardAlign', dest='forwardAlign', help='Whether or not to attempt to align the forward reference strand' )
+ parser.add_option( '-E', '--reverseAlign', dest='reverseAlign', help='Whether or not to attempt to align the reverse-complement reference strand' )
+ parser.add_option( '-F', '--offrate', dest='offrate', help='Override the offrate of the index to n' )
+ parser.add_option( '-S', '--seed', dest='seed', help='Seed for pseudo-random number generator' )
+ parser.add_option( '-8', '--snpphred', dest='snpphred', help='SNP penalty on Phred scale' )
+ parser.add_option( '-6', '--snpfrac', dest='snpfrac', help='Fraction of sites expected to be SNP sites' )
+ parser.add_option( '-7', '--keepends', dest='keepends', help='Keep extreme-end nucleotides and qualities' )
+ parser.add_option( '-C', '--params', dest='params', help='Whether to use default or specified parameters' )
+ parser.add_option( '-u', '--iautoB', dest='iautoB', help='Automatic or specified behavior' )
+ parser.add_option( '-K', '--ipacked', dest='ipacked', help='Whether or not to use a packed representation for DNA strings' )
+ parser.add_option( '-Q', '--ibmax', dest='ibmax', help='Maximum number of suffixes allowed in a block' )
+ parser.add_option( '-Y', '--ibmaxdivn', dest='ibmaxdivn', help='Maximum number of suffixes allowed in a block as a fraction of the length of the reference' )
+ parser.add_option( '-D', '--idcv', dest='idcv', help='The period for the difference-cover sample' )
+ parser.add_option( '-U', '--inodc', dest='inodc', help='Whether or not to disable the use of the difference-cover sample' )
+ parser.add_option( '-y', '--inoref', dest='inoref', help='Whether or not to build the part of the reference index used only in paired-end alignment' )
+ parser.add_option( '-z', '--ioffrate', dest='ioffrate', help='How many rows get marked during annotation of some or all of the Burrows-Wheeler rows' )
+ parser.add_option( '-W', '--iftab', dest='iftab', help='The size of the lookup table used to calculate an initial Burrows-Wheeler range with respect to the first n characters of the query' )
+ parser.add_option( '-X', '--intoa', dest='intoa', help='Whether or not to convert Ns in the reference sequence to As' )
+ parser.add_option( '-N', '--iendian', dest='iendian', help='Endianness to use when serializing integers to the index file' )
+ parser.add_option( '-Z', '--iseed', dest='iseed', help='Seed for the pseudorandom number generator' )
+ parser.add_option( '-c', '--icutoff', dest='icutoff', help='Number of first bases of the reference sequence to index' )
+ parser.add_option( '-x', '--indexSettings', dest='index_settings', help='Whether or not indexing options are to be set' )
+ parser.add_option( '-H', '--suppressHeader', dest='suppressHeader', help='Suppress header' )
+ parser.add_option( '--galaxy_input_format', dest='galaxy_input_format', default="fastqsanger", help='galaxy input format' )
+ parser.add_option( '--do_not_build_index', dest='do_not_build_index', action="store_true", default=False, help='Flag to specify that provided file is already indexed, use as is' )
+ (options, args) = parser.parse_args()
+ stdout = ''
+
+ # make temp directory for placement of indices and copy reference file there if necessary
+ tmp_index_dir = tempfile.mkdtemp()
+ # get type of data (solid or solexa)
+ if options.dataType == 'solid':
+ colorspace = '-C'
+ else:
+ colorspace = ''
+ # index if necessary
+ if options.genomeSource == 'history' and not options.do_not_build_index:
+ # set up commands
+ if options.index_settings =='indexPreSet':
+ indexing_cmds = '%s' % colorspace
+ else:
+ try:
+ if options.iautoB and options.iautoB == 'set':
+ iautoB = '--noauto'
+ else:
+ iautoB = ''
+ if options. ipacked and options.ipacked == 'packed':
+ ipacked = '--packed'
+ else:
+ ipacked = ''
+ if options.ibmax and int( options.ibmax ) >= 1:
+ ibmax = '--bmax %s' % options.ibmax
+ else:
+ ibmax = ''
+ if options.ibmaxdivn and int( options.ibmaxdivn ) >= 0:
+ ibmaxdivn = '--bmaxdivn %s' % options.ibmaxdivn
+ else:
+ ibmaxdivn = ''
+ if options.idcv and int( options.idcv ) > 0:
+ idcv = '--dcv %s' % options.idcv
+ else:
+ idcv = ''
+ if options.inodc and options.inodc == 'nodc':
+ inodc = '--nodc'
+ else:
+ inodc = ''
+ if options.inoref and options.inoref == 'noref':
+ inoref = '--noref'
+ else:
+ inoref = ''
+ if options.iftab and int( options.iftab ) >= 0:
+ iftab = '--ftabchars %s' % options.iftab
+ else:
+ iftab = ''
+ if options.intoa and options.intoa == 'yes':
+ intoa = '--ntoa'
+ else:
+ intoa = ''
+ if options.iendian and options.iendian == 'big':
+ iendian = '--big'
+ else:
+ iendian = '--little'
+ if options.iseed and int( options.iseed ) > 0:
+ iseed = '--seed %s' % options.iseed
+ else:
+ iseed = ''
+ if options.icutoff and int( options.icutoff ) > 0:
+ icutoff = '--cutoff %s' % options.icutoff
+ else:
+ icutoff = ''
+ indexing_cmds = '%s %s %s %s %s %s %s --offrate %s %s %s %s %s %s %s' % \
+ ( iautoB, ipacked, ibmax, ibmaxdivn, idcv, inodc,
+ inoref, options.ioffrate, iftab, intoa, iendian,
+ iseed, icutoff, colorspace )
+ except ValueError, e:
+ # clean up temp dir
+ if os.path.exists( tmp_index_dir ):
+ shutil.rmtree( tmp_index_dir )
+ stop_err( "Something is wrong with the indexing parameters and the indexing and alignment could not be run. Make sure you don't have any non-numeric values where they should be numeric.\n" + str( e ) )
+ ref_file = tempfile.NamedTemporaryFile( dir=tmp_index_dir )
+ ref_file_name = ref_file.name
+ ref_file.close()
+ os.symlink( options.ref, ref_file_name )
+ cmd1 = 'bowtie-build %s -f %s %s' % ( indexing_cmds, ref_file_name, ref_file_name )
+ try:
+ tmp = tempfile.NamedTemporaryFile( dir=tmp_index_dir ).name
+ tmp_stderr = open( tmp, 'wb' )
+ proc = subprocess.Popen( args=cmd1, shell=True, cwd=tmp_index_dir, stderr=tmp_stderr.fileno() )
+ returncode = proc.wait()
+ tmp_stderr.close()
+ # get stderr, allowing for case where it's very large
+ tmp_stderr = open( tmp, 'rb' )
+ stderr = ''
+ buffsize = 1048576
+ try:
+ while True:
+ stderr += tmp_stderr.read( buffsize )
+ if not stderr or len( stderr ) % buffsize != 0:
+ break
+ except OverflowError:
+ pass
+ tmp_stderr.close()
+ if returncode != 0:
+ raise (Exception, stderr)
+ except Exception, e:
+ # clean up temp dir
+ if os.path.exists( tmp_index_dir ):
+ shutil.rmtree( tmp_index_dir )
+ stop_err( 'Error indexing reference sequence\n' + str( e ) )
+ stdout += 'File indexed. '
+ else:
+ ref_file_name = options.ref
+ # set up aligning and generate aligning command options
+ # automatically set threads in both cases
+ tmp_suppressed_file_name = None
+ tmp_unmapped_file_name = None
+ if options.suppressHeader == 'true':
+ suppressHeader = '--sam-nohead'
+ else:
+ suppressHeader = ''
+ if options.maxInsert and int( options.maxInsert ) > 0:
+ maxInsert = '-X %s' % options.maxInsert
+ else:
+ maxInsert = ''
+ if options.mateOrient:
+ mateOrient = '--%s' % options.mateOrient
+ else:
+ mateOrient = ''
+ quality_score_encoding = GALAXY_FORMAT_TO_QUALITY_SCORE_ENCODING_ARG.get( options.galaxy_input_format, DEFAULT_ASCII_ENCODING )
+ if options.params == 'preSet':
+ aligning_cmds = '-q %s %s -p %s -S %s %s %s ' % \
+ ( maxInsert, mateOrient, options.threads, suppressHeader, colorspace, quality_score_encoding )
+ else:
+ try:
+ if options.skip and int( options.skip ) > 0:
+ skip = '-s %s' % options.skip
+ else:
+ skip = ''
+ if options.alignLimit and int( options.alignLimit ) >= 0:
+ alignLimit = '-u %s' % options.alignLimit
+ else:
+ alignLimit = ''
+ if options.trimH and int( options.trimH ) > 0:
+ trimH = '-5 %s' % options.trimH
+ else:
+ trimH = ''
+ if options.trimL and int( options.trimL ) > 0:
+ trimL = '-3 %s' % options.trimL
+ else:
+ trimL = ''
+ if options.maqSoapAlign != '-1' and int( options.maqSoapAlign ) >= 0:
+ maqSoapAlign = '-v %s' % options.maqSoapAlign
+ else:
+ maqSoapAlign = ''
+ if options.mismatchSeed and (options.mismatchSeed == '0' or options.mismatchSeed == '1' \
+ or options.mismatchSeed == '2' or options.mismatchSeed == '3'):
+ mismatchSeed = '-n %s' % options.mismatchSeed
+ else:
+ mismatchSeed = ''
+ if options.mismatchQual and int( options.mismatchQual ) >= 0:
+ mismatchQual = '-e %s' % options.mismatchQual
+ else:
+ mismatchQual = ''
+ if options.seedLen and int( options.seedLen ) >= 5:
+ seedLen = '-l %s' % options.seedLen
+ else:
+ seedLen = ''
+ if options.rounding == 'noRound':
+ rounding = '--nomaqround'
+ else:
+ rounding = ''
+ if options.minInsert and int( options.minInsert ) > 0:
+ minInsert = '-I %s' % options.minInsert
+ else:
+ minInsert = ''
+ if options.maxAlignAttempt and int( options.maxAlignAttempt ) >= 0:
+ maxAlignAttempt = '--pairtries %s' % options.maxAlignAttempt
+ else:
+ maxAlignAttempt = ''
+ if options.forwardAlign == 'noForward':
+ forwardAlign = '--nofw'
+ else:
+ forwardAlign = ''
+ if options.reverseAlign == 'noReverse':
+ reverseAlign = '--norc'
+ else:
+ reverseAlign = ''
+ if options.maxBacktracks and int( options.maxBacktracks ) > 0 and \
+ ( options.mismatchSeed == '2' or options.mismatchSeed == '3' ):
+ maxBacktracks = '--maxbts %s' % options.maxBacktracks
+ else:
+ maxBacktracks = ''
+ if options.tryHard == 'doTryHard':
+ tryHard = '-y'
+ else:
+ tryHard = ''
+ if options.valAlign and int( options.valAlign ) >= 0:
+ valAlign = '-k %s' % options.valAlign
+ else:
+ valAlign = ''
+ if options.allValAligns == 'doAllValAligns':
+ allValAligns = '-a'
+ else:
+ allValAligns = ''
+ if options.suppressAlign and int( options.suppressAlign ) >= 0:
+ suppressAlign = '-m %s' % options.suppressAlign
+ else:
+ suppressAlign = ''
+ if options.best == 'doBest':
+ best = '--best'
+ else:
+ best = ''
+ if options.strata == 'doStrata':
+ strata = '--strata'
+ else:
+ strata = ''
+ if options.offrate and int( options.offrate ) >= 0:
+ offrate = '-o %s' % options.offrate
+ else:
+ offrate = ''
+ if options.seed and int( options.seed ) >= 0:
+ seed = '--seed %s' % options.seed
+ else:
+ seed = ''
+ if options.paired == 'paired':
+ if options.output_unmapped_reads_l and options.output_unmapped_reads_r:
+ tmp_unmapped_file = tempfile.NamedTemporaryFile( dir=tmp_index_dir, suffix='.fastq' )
+ tmp_unmapped_file_name = tmp_unmapped_file.name
+ tmp_unmapped_file.close()
+ output_unmapped_reads = '--un %s' % tmp_unmapped_file_name
+ else:
+ output_unmapped_reads = ''
+ if options.output_suppressed_reads:
+ tmp_suppressed_file = tempfile.NamedTemporaryFile( dir=tmp_index_dir, suffix='.fastq' )
+ tmp_suppressed_file_name = tmp_suppressed_file.name
+ tmp_suppressed_file.close()
+ output_suppressed_reads = '--max %s' % tmp_suppressed_file_name
+ else:
+ output_suppressed_reads = ''
+ else:
+ if options.output_unmapped_reads:
+ output_unmapped_reads = '--un %s' % options.output_unmapped_reads
+ else:
+ output_unmapped_reads = ''
+ if options.output_suppressed_reads:
+ output_suppressed_reads = '--max %s' % options.output_suppressed_reads
+ else:
+ output_suppressed_reads = ''
+ snpfrac = ''
+ if options.snpphred and int( options.snpphred ) >= 0:
+ snpphred = '--snpphred %s' % options.snpphred
+ else:
+ snpphred = ''
+ if options.snpfrac and float( options.snpfrac ) >= 0:
+ snpfrac = '--snpfrac %s' % options.snpfrac
+ if options.keepends and options.keepends == 'doKeepends':
+ keepends = '--col-keepends'
+ else:
+ keepends = ''
+ aligning_cmds = '-q %s %s -p %s -S %s %s %s %s %s %s %s %s %s %s %s %s ' \
+ '%s %s %s %s %s %s %s %s %s %s %s %s %s %s %s %s %s %s ' % \
+ ( maxInsert, mateOrient, options.threads, suppressHeader,
+ colorspace, skip, alignLimit, trimH, trimL, maqSoapAlign,
+ mismatchSeed, mismatchQual, seedLen, rounding, minInsert,
+ maxAlignAttempt, forwardAlign, reverseAlign, maxBacktracks,
+ tryHard, valAlign, allValAligns, suppressAlign, best,
+ strata, offrate, seed, snpphred, snpfrac, keepends,
+ output_unmapped_reads, output_suppressed_reads,
+ quality_score_encoding )
+ except ValueError, e:
+ # clean up temp dir
+ if os.path.exists( tmp_index_dir ):
+ shutil.rmtree( tmp_index_dir )
+ stop_err( 'Something is wrong with the alignment parameters and the alignment could not be run\n' + str( e ) )
+ try:
+ # have to nest try-except in try-finally to handle 2.4
+ try:
+ # prepare actual mapping commands
+ if options.paired == 'paired':
+ cmd2 = 'bowtie %s %s -1 %s -2 %s > %s' % ( aligning_cmds, ref_file_name, options.input1, options.input2, options.output )
+ else:
+ cmd2 = 'bowtie %s %s %s > %s' % ( aligning_cmds, ref_file_name, options.input1, options.output )
+ # align
+ tmp = tempfile.NamedTemporaryFile( dir=tmp_index_dir ).name
+ tmp_stderr = open( tmp, 'wb' )
+ proc = subprocess.Popen( args=cmd2, shell=True, cwd=tmp_index_dir, stderr=tmp_stderr.fileno() )
+ returncode = proc.wait()
+ tmp_stderr.close()
+ # get stderr, allowing for case where it's very large
+ tmp_stderr = open( tmp, 'rb' )
+ stderr = ''
+ buffsize = 1048576
+ try:
+ while True:
+ stderr += tmp_stderr.read( buffsize )
+ if not stderr or len( stderr ) % buffsize != 0:
+ break
+ except OverflowError:
+ pass
+ tmp_stderr.close()
+ if returncode != 0:
+ raise (Exception, stderr)
+ # get suppressed and unmapped reads output files in place if appropriate
+ if options.paired == 'paired' and tmp_suppressed_file_name and \
+ options.output_suppressed_reads_l and options.output_suppressed_reads_r:
+ try:
+ left = tmp_suppressed_file_name.replace( '.fastq', '_1.fastq' )
+ right = tmp_suppressed_file_name.replace( '.fastq', '_1.fastq' )
+ shutil.move( left, options.output_suppressed_reads_l )
+ shutil.move( right, options.output_suppressed_reads_r )
+ except Exception, e:
+ sys.stdout.write( 'Error producing the suppressed output file.\n' )
+ if options.paired == 'paired' and tmp_unmapped_file_name and \
+ options.output_unmapped_reads_l and options.output_unmapped_reads_r:
+ try:
+ left = tmp_unmapped_file_name.replace( '.fastq', '_1.fastq' )
+ right = tmp_unmapped_file_name.replace( '.fastq', '_2.fastq' )
+ shutil.move( left, options.output_unmapped_reads_l )
+ shutil.move( right, options.output_unmapped_reads_r )
+ except Exception, e:
+ sys.stdout.write( 'Error producing the unmapped output file.\n' )
+ # check that there are results in the output file
+ if os.path.getsize( options.output ) == 0:
+ raise (Exception, 'The output file is empty, there may be an error with your input file or settings.')
+ except Exception, e:
+ stop_err( 'Error aligning sequence. ' + str( e ) )
+ finally:
+ # clean up temp dir
+ if os.path.exists( tmp_index_dir ):
+ shutil.rmtree( tmp_index_dir )
+ stdout += 'Sequence file aligned.\n'
+ sys.stdout.write( stdout )
+
+if __name__=="__main__": __main__()
diff -r a2b0620733e3 -r 9e5052835e34 bowtie_remove_rrna_wrapper/bowtie_wrapper_py3.py
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/bowtie_remove_rrna_wrapper/bowtie_wrapper_py3.py Wed Feb 23 13:57:30 2022 +0000
@@ -0,0 +1,469 @@
+#!/usr/bin/env python
+
+"""
+Runs Bowtie on single-end or paired-end data.
+For use with Bowtie v. 0.12.7
+
+usage: bowtie_wrapper.py [options]
+ -t, --threads=t: The number of threads to run
+ -o, --output=o: The output file
+ --output_unmapped_reads=: File name for unmapped reads (single-end)
+ --output_unmapped_reads_l=: File name for unmapped reads (left, paired-end)
+ --output_unmapped_reads_r=: File name for unmapped reads (right, paired-end)
+ --output_suppressed_reads=: File name for suppressed reads because of max setting (single-end)
+ --output_suppressed_reads_l=: File name for suppressed reads because of max setting (left, paired-end)
+ --output_suppressed_reads_r=: File name for suppressed reads because of max setting (right, paired-end)
+ -i, --input1=i: The (forward or single-end) reads file in Sanger FASTQ format
+ -I, --input2=I: The reverse reads file in Sanger FASTQ format
+ -4, --dataType=4: The type of data (SOLiD or Solexa)
+ -2, --paired=2: Whether the data is single- or paired-end
+ -g, --genomeSource=g: The type of reference provided
+ -r, --ref=r: The reference genome to use or index
+ -s, --skip=s: Skip the first n reads
+ -a, --alignLimit=a: Only align the first n reads
+ -T, --trimH=T: Trim n bases from high-quality (left) end of each read before alignment
+ -L, --trimL=L: Trim n bases from low-quality (right) end of each read before alignment
+ -m, --mismatchSeed=m: Maximum number of mismatches permitted in the seed
+ -M, --mismatchQual=M: Maximum permitted total of quality values at mismatched read positions
+ -l, --seedLen=l: Seed length
+ -n, --rounding=n: Whether or not to round to the nearest 10 and saturating at 30
+ -P, --maqSoapAlign=P: Choose MAQ- or SOAP-like alignment policy
+ -w, --tryHard=: Whether or not to try as hard as possible to find valid alignments when they exist
+ -v, --valAlign=v: Report up to n valid arguments per read
+ -V, --allValAligns=V: Whether or not to report all valid alignments per read
+ -G, --suppressAlign=G: Suppress all alignments for a read if more than n reportable alignments exist
+ -b, --best=b: Whether or not to make Bowtie guarantee that reported singleton alignments are 'best' in terms of stratum and in terms of the quality values at the mismatched positions
+ -B, --maxBacktracks=B: Maximum number of backtracks permitted when aligning a read
+ -R, --strata=R: Whether or not to report only those alignments that fall in the best stratum if many valid alignments exist and are reportable
+ -j, --minInsert=j: Minimum insert size for valid paired-end alignments
+ -J, --maxInsert=J: Maximum insert size for valid paired-end alignments
+ -O, --mateOrient=O: The upstream/downstream mate orientation for valid paired-end alignment against the forward reference strand
+ -A, --maxAlignAttempt=A: Maximum number of attempts Bowtie will make to match an alignment for one mate with an alignment for the opposite mate
+ -f, --forwardAlign=f: Whether or not to attempt to align the forward reference strand
+ -E, --reverseAlign=E: Whether or not to attempt to align the reverse-complement reference strand
+ -F, --offrate=F: Override the offrate of the index to n
+ -8, --snpphred=8: SNP penalty on Phred scale
+ -6, --snpfrac=6: Fraction of sites expected to be SNP sites
+ -7, --keepends=7: Keep extreme-end nucleotides and qualities
+ -S, --seed=S: Seed for pseudo-random number generator
+ -C, --params=C: Whether to use default or specified parameters
+ -u, --iautoB=u: Automatic or specified behavior
+ -K, --ipacked=K: Whether or not to use a packed representation for DNA strings
+ -Q, --ibmax=Q: Maximum number of suffixes allowed in a block
+ -Y, --ibmaxdivn=Y: Maximum number of suffixes allowed in a block as a fraction of the length of the reference
+ -D, --idcv=D: The period for the difference-cover sample
+ -U, --inodc=U: Whether or not to disable the use of the difference-cover sample
+ -y, --inoref=y: Whether or not to build the part of the reference index used only in paired-end alignment
+ -z, --ioffrate=z: How many rows get marked during annotation of some or all of the Burrows-Wheeler rows
+ -W, --iftab=W: The size of the lookup table used to calculate an initial Burrows-Wheeler range with respect to the first n characters of the query
+ -X, --intoa=X: Whether or not to convert Ns in the reference sequence to As
+ -N, --iendian=N: Endianness to use when serializing integers to the index file
+ -Z, --iseed=Z: Seed for the pseudorandom number generator
+ -c, --icutoff=c: Number of first bases of the reference sequence to index
+ -x, --indexSettings=x: Whether or not indexing options are to be set
+ -H, --suppressHeader=H: Suppress header
+ --do_not_build_index: Flag to specify that provided file is already indexed and to just use 'as is'
+"""
+
+import optparse, os, shutil, subprocess, sys, tempfile
+
+#Allow more than Sanger encoded variants
+DEFAULT_ASCII_ENCODING = '--phred33-quals'
+GALAXY_FORMAT_TO_QUALITY_SCORE_ENCODING_ARG = { 'fastqsanger':'--phred33-quals', 'fastqillumina':'--phred64-quals', 'fastqsolexa':'--solexa-quals' }
+#FIXME: Integer quality scores are supported only when the '--integer-quals' argument is specified to bowtie; this is not currently able to be set in the tool/wrapper/config
+
+def stop_err( msg ):
+ sys.stderr.write( '%s\n' % msg )
+ sys.exit()
+
+def __main__():
+ #Parse Command Line
+ parser = optparse.OptionParser()
+ parser.add_option( '-t', '--threads', dest='threads', help='The number of threads to run' )
+ parser.add_option( '-o', '--output', dest='output', help='The output file' )
+ parser.add_option( '', '--output_unmapped_reads', dest='output_unmapped_reads', help='File name for unmapped reads (single-end)' )
+ parser.add_option( '', '--output_unmapped_reads_l', dest='output_unmapped_reads_l', help='File name for unmapped reads (left, paired-end)' )
+ parser.add_option( '', '--output_unmapped_reads_r', dest='output_unmapped_reads_r', help='File name for unmapped reads (right, paired-end)' )
+ parser.add_option( '', '--output_suppressed_reads', dest='output_suppressed_reads', help='File name for suppressed reads because of max setting (single-end)' )
+ parser.add_option( '', '--output_suppressed_reads_l', dest='output_suppressed_reads_l', help='File name for suppressed reads because of max setting (left, paired-end)' )
+ parser.add_option( '', '--output_suppressed_reads_r', dest='output_suppressed_reads_r', help='File name for suppressed reads because of max setting (right, paired-end)' )
+ parser.add_option( '-4', '--dataType', dest='dataType', help='The type of data (SOLiD or Solexa)' )
+ parser.add_option( '-i', '--input1', dest='input1', help='The (forward or single-end) reads file in Sanger FASTQ format' )
+ parser.add_option( '-I', '--input2', dest='input2', help='The reverse reads file in Sanger FASTQ format' )
+ parser.add_option( '-2', '--paired', dest='paired', help='Whether the data is single- or paired-end' )
+ parser.add_option( '-g', '--genomeSource', dest='genomeSource', help='The type of reference provided' )
+ parser.add_option( '-r', '--ref', dest='ref', help='The reference genome to use or index' )
+ parser.add_option( '-s', '--skip', dest='skip', help='Skip the first n reads' )
+ parser.add_option( '-a', '--alignLimit', dest='alignLimit', help='Only align the first n reads' )
+ parser.add_option( '-T', '--trimH', dest='trimH', help='Trim n bases from high-quality (left) end of each read before alignment' )
+ parser.add_option( '-L', '--trimL', dest='trimL', help='Trim n bases from low-quality (right) end of each read before alignment' )
+ parser.add_option( '-m', '--mismatchSeed', dest='mismatchSeed', help='Maximum number of mismatches permitted in the seed' )
+ parser.add_option( '-M', '--mismatchQual', dest='mismatchQual', help='Maximum permitted total of quality values at mismatched read positions' )
+ parser.add_option( '-l', '--seedLen', dest='seedLen', help='Seed length' )
+ parser.add_option( '-n', '--rounding', dest='rounding', help='Whether or not to round to the nearest 10 and saturating at 30' )
+ parser.add_option( '-P', '--maqSoapAlign', dest='maqSoapAlign', help='Choose MAQ- or SOAP-like alignment policy' )
+ parser.add_option( '-w', '--tryHard', dest='tryHard', help='Whether or not to try as hard as possible to find valid alignments when they exist' )
+ parser.add_option( '-v', '--valAlign', dest='valAlign', help='Report up to n valid arguments per read' )
+ parser.add_option( '-V', '--allValAligns', dest='allValAligns', help='Whether or not to report all valid alignments per read' )
+ parser.add_option( '-G', '--suppressAlign', dest='suppressAlign', help='Suppress all alignments for a read if more than n reportable alignments exist' )
+ parser.add_option( '-b', '--best', dest='best', help="Whether or not to make Bowtie guarantee that reported singleton alignments are 'best' in terms of stratum and in terms of the quality values at the mismatched positions" )
+ parser.add_option( '-B', '--maxBacktracks', dest='maxBacktracks', help='Maximum number of backtracks permitted when aligning a read' )
+ parser.add_option( '-R', '--strata', dest='strata', help='Whether or not to report only those alignments that fall in the best stratum if many valid alignments exist and are reportable' )
+ parser.add_option( '-j', '--minInsert', dest='minInsert', help='Minimum insert size for valid paired-end alignments' )
+ parser.add_option( '-J', '--maxInsert', dest='maxInsert', help='Maximum insert size for valid paired-end alignments' )
+ parser.add_option( '-O', '--mateOrient', dest='mateOrient', help='The upstream/downstream mate orientation for valid paired-end alignment against the forward reference strand' )
+ parser.add_option( '-A', '--maxAlignAttempt', dest='maxAlignAttempt', help='Maximum number of attempts Bowtie will make to match an alignment for one mate with an alignment for the opposite mate' )
+ parser.add_option( '-f', '--forwardAlign', dest='forwardAlign', help='Whether or not to attempt to align the forward reference strand' )
+ parser.add_option( '-E', '--reverseAlign', dest='reverseAlign', help='Whether or not to attempt to align the reverse-complement reference strand' )
+ parser.add_option( '-F', '--offrate', dest='offrate', help='Override the offrate of the index to n' )
+ parser.add_option( '-S', '--seed', dest='seed', help='Seed for pseudo-random number generator' )
+ parser.add_option( '-8', '--snpphred', dest='snpphred', help='SNP penalty on Phred scale' )
+ parser.add_option( '-6', '--snpfrac', dest='snpfrac', help='Fraction of sites expected to be SNP sites' )
+ parser.add_option( '-7', '--keepends', dest='keepends', help='Keep extreme-end nucleotides and qualities' )
+ parser.add_option( '-C', '--params', dest='params', help='Whether to use default or specified parameters' )
+ parser.add_option( '-u', '--iautoB', dest='iautoB', help='Automatic or specified behavior' )
+ parser.add_option( '-K', '--ipacked', dest='ipacked', help='Whether or not to use a packed representation for DNA strings' )
+ parser.add_option( '-Q', '--ibmax', dest='ibmax', help='Maximum number of suffixes allowed in a block' )
+ parser.add_option( '-Y', '--ibmaxdivn', dest='ibmaxdivn', help='Maximum number of suffixes allowed in a block as a fraction of the length of the reference' )
+ parser.add_option( '-D', '--idcv', dest='idcv', help='The period for the difference-cover sample' )
+ parser.add_option( '-U', '--inodc', dest='inodc', help='Whether or not to disable the use of the difference-cover sample' )
+ parser.add_option( '-y', '--inoref', dest='inoref', help='Whether or not to build the part of the reference index used only in paired-end alignment' )
+ parser.add_option( '-z', '--ioffrate', dest='ioffrate', help='How many rows get marked during annotation of some or all of the Burrows-Wheeler rows' )
+ parser.add_option( '-W', '--iftab', dest='iftab', help='The size of the lookup table used to calculate an initial Burrows-Wheeler range with respect to the first n characters of the query' )
+ parser.add_option( '-X', '--intoa', dest='intoa', help='Whether or not to convert Ns in the reference sequence to As' )
+ parser.add_option( '-N', '--iendian', dest='iendian', help='Endianness to use when serializing integers to the index file' )
+ parser.add_option( '-Z', '--iseed', dest='iseed', help='Seed for the pseudorandom number generator' )
+ parser.add_option( '-c', '--icutoff', dest='icutoff', help='Number of first bases of the reference sequence to index' )
+ parser.add_option( '-x', '--indexSettings', dest='index_settings', help='Whether or not indexing options are to be set' )
+ parser.add_option( '-H', '--suppressHeader', dest='suppressHeader', help='Suppress header' )
+ parser.add_option( '--galaxy_input_format', dest='galaxy_input_format', default="fastqsanger", help='galaxy input format' )
+ parser.add_option( '--do_not_build_index', dest='do_not_build_index', action="store_true", default=False, help='Flag to specify that provided file is already indexed, use as is' )
+ (options, args) = parser.parse_args()
+ stdout = ''
+
+ # make temp directory for placement of indices and copy reference file there if necessary
+ tmp_index_dir = tempfile.mkdtemp()
+ # get type of data (solid or solexa)
+ if options.dataType == 'solid':
+ colorspace = '-C'
+ else:
+ colorspace = ''
+ # index if necessary
+ if options.genomeSource == 'history' and not options.do_not_build_index:
+ # set up commands
+ if options.index_settings =='indexPreSet':
+ indexing_cmds = '%s' % colorspace
+ else:
+ try:
+ if options.iautoB and options.iautoB == 'set':
+ iautoB = '--noauto'
+ else:
+ iautoB = ''
+ if options. ipacked and options.ipacked == 'packed':
+ ipacked = '--packed'
+ else:
+ ipacked = ''
+ if options.ibmax and int( options.ibmax ) >= 1:
+ ibmax = '--bmax %s' % options.ibmax
+ else:
+ ibmax = ''
+ if options.ibmaxdivn and int( options.ibmaxdivn ) >= 0:
+ ibmaxdivn = '--bmaxdivn %s' % options.ibmaxdivn
+ else:
+ ibmaxdivn = ''
+ if options.idcv and int( options.idcv ) > 0:
+ idcv = '--dcv %s' % options.idcv
+ else:
+ idcv = ''
+ if options.inodc and options.inodc == 'nodc':
+ inodc = '--nodc'
+ else:
+ inodc = ''
+ if options.inoref and options.inoref == 'noref':
+ inoref = '--noref'
+ else:
+ inoref = ''
+ if options.iftab and int( options.iftab ) >= 0:
+ iftab = '--ftabchars %s' % options.iftab
+ else:
+ iftab = ''
+ if options.intoa and options.intoa == 'yes':
+ intoa = '--ntoa'
+ else:
+ intoa = ''
+ if options.iendian and options.iendian == 'big':
+ iendian = '--big'
+ else:
+ iendian = '--little'
+ if options.iseed and int( options.iseed ) > 0:
+ iseed = '--seed %s' % options.iseed
+ else:
+ iseed = ''
+ if options.icutoff and int( options.icutoff ) > 0:
+ icutoff = '--cutoff %s' % options.icutoff
+ else:
+ icutoff = ''
+ indexing_cmds = '%s %s %s %s %s %s %s --offrate %s %s %s %s %s %s %s' % \
+ ( iautoB, ipacked, ibmax, ibmaxdivn, idcv, inodc,
+ inoref, options.ioffrate, iftab, intoa, iendian,
+ iseed, icutoff, colorspace )
+ except (ValueError, e):
+ # clean up temp dir
+ if os.path.exists( tmp_index_dir ):
+ shutil.rmtree( tmp_index_dir )
+ stop_err( "Something is wrong with the indexing parameters and the indexing and alignment could not be run. Make sure you don't have any non-numeric values where they should be numeric.\n" + str( e ) )
+ ref_file = tempfile.NamedTemporaryFile( dir=tmp_index_dir )
+ ref_file_name = ref_file.name
+ ref_file.close()
+ os.symlink( options.ref, ref_file_name )
+ cmd1 = 'bowtie-build %s -f %s %s' % ( indexing_cmds, ref_file_name, ref_file_name )
+ try:
+ tmp = tempfile.NamedTemporaryFile( dir=tmp_index_dir ).name
+ tmp_stderr = open( tmp, 'wb' )
+ proc = subprocess.Popen( args=cmd1, shell=True, cwd=tmp_index_dir, stderr=tmp_stderr.fileno() )
+ returncode = proc.wait()
+ tmp_stderr.close()
+ # get stderr, allowing for case where it's very large
+ tmp_stderr = open( tmp, 'rb' )
+ stderr = ''
+ buffsize = 1048576
+ try:
+ while True:
+ stderr += tmp_stderr.read( buffsize )
+ if not stderr or len( stderr ) % buffsize != 0:
+ break
+ except OverflowError:
+ pass
+ tmp_stderr.close()
+ if returncode != 0:
+ raise (Exception, stderr)
+ except Exception as e:
+ # clean up temp dir
+ if os.path.exists( tmp_index_dir ):
+ shutil.rmtree( tmp_index_dir )
+ stop_err( 'Error indexing reference sequence\n' + str( e ) )
+ stdout += 'File indexed. '
+ else:
+ ref_file_name = options.ref
+ # set up aligning and generate aligning command options
+ # automatically set threads in both cases
+ tmp_suppressed_file_name = None
+ tmp_unmapped_file_name = None
+ if options.suppressHeader == 'true':
+ suppressHeader = '--sam-nohead'
+ else:
+ suppressHeader = ''
+ if options.maxInsert and int( options.maxInsert ) > 0:
+ maxInsert = '-X %s' % options.maxInsert
+ else:
+ maxInsert = ''
+ if options.mateOrient:
+ mateOrient = '--%s' % options.mateOrient
+ else:
+ mateOrient = ''
+ quality_score_encoding = GALAXY_FORMAT_TO_QUALITY_SCORE_ENCODING_ARG.get( options.galaxy_input_format, DEFAULT_ASCII_ENCODING )
+ if options.params == 'preSet':
+ aligning_cmds = '-q %s %s -p %s -S %s %s %s ' % \
+ ( maxInsert, mateOrient, options.threads, suppressHeader, colorspace, quality_score_encoding )
+ else:
+ try:
+ if options.skip and int( options.skip ) > 0:
+ skip = '-s %s' % options.skip
+ else:
+ skip = ''
+ if options.alignLimit and int( options.alignLimit ) >= 0:
+ alignLimit = '-u %s' % options.alignLimit
+ else:
+ alignLimit = ''
+ if options.trimH and int( options.trimH ) > 0:
+ trimH = '-5 %s' % options.trimH
+ else:
+ trimH = ''
+ if options.trimL and int( options.trimL ) > 0:
+ trimL = '-3 %s' % options.trimL
+ else:
+ trimL = ''
+ if options.maqSoapAlign != '-1' and int( options.maqSoapAlign ) >= 0:
+ maqSoapAlign = '-v %s' % options.maqSoapAlign
+ else:
+ maqSoapAlign = ''
+ if options.mismatchSeed and (options.mismatchSeed == '0' or options.mismatchSeed == '1' \
+ or options.mismatchSeed == '2' or options.mismatchSeed == '3'):
+ mismatchSeed = '-n %s' % options.mismatchSeed
+ else:
+ mismatchSeed = ''
+ if options.mismatchQual and int( options.mismatchQual ) >= 0:
+ mismatchQual = '-e %s' % options.mismatchQual
+ else:
+ mismatchQual = ''
+ if options.seedLen and int( options.seedLen ) >= 5:
+ seedLen = '-l %s' % options.seedLen
+ else:
+ seedLen = ''
+ if options.rounding == 'noRound':
+ rounding = '--nomaqround'
+ else:
+ rounding = ''
+ if options.minInsert and int( options.minInsert ) > 0:
+ minInsert = '-I %s' % options.minInsert
+ else:
+ minInsert = ''
+ if options.maxAlignAttempt and int( options.maxAlignAttempt ) >= 0:
+ maxAlignAttempt = '--pairtries %s' % options.maxAlignAttempt
+ else:
+ maxAlignAttempt = ''
+ if options.forwardAlign == 'noForward':
+ forwardAlign = '--nofw'
+ else:
+ forwardAlign = ''
+ if options.reverseAlign == 'noReverse':
+ reverseAlign = '--norc'
+ else:
+ reverseAlign = ''
+ if options.maxBacktracks and int( options.maxBacktracks ) > 0 and \
+ ( options.mismatchSeed == '2' or options.mismatchSeed == '3' ):
+ maxBacktracks = '--maxbts %s' % options.maxBacktracks
+ else:
+ maxBacktracks = ''
+ if options.tryHard == 'doTryHard':
+ tryHard = '-y'
+ else:
+ tryHard = ''
+ if options.valAlign and int( options.valAlign ) >= 0:
+ valAlign = '-k %s' % options.valAlign
+ else:
+ valAlign = ''
+ if options.allValAligns == 'doAllValAligns':
+ allValAligns = '-a'
+ else:
+ allValAligns = ''
+ if options.suppressAlign and int( options.suppressAlign ) >= 0:
+ suppressAlign = '-m %s' % options.suppressAlign
+ else:
+ suppressAlign = ''
+ if options.best == 'doBest':
+ best = '--best'
+ else:
+ best = ''
+ if options.strata == 'doStrata':
+ strata = '--strata'
+ else:
+ strata = ''
+ if options.offrate and int( options.offrate ) >= 0:
+ offrate = '-o %s' % options.offrate
+ else:
+ offrate = ''
+ if options.seed and int( options.seed ) >= 0:
+ seed = '--seed %s' % options.seed
+ else:
+ seed = ''
+ if options.paired == 'paired':
+ if options.output_unmapped_reads_l and options.output_unmapped_reads_r:
+ tmp_unmapped_file = tempfile.NamedTemporaryFile( dir=tmp_index_dir, suffix='.fastq' )
+ tmp_unmapped_file_name = tmp_unmapped_file.name
+ tmp_unmapped_file.close()
+ output_unmapped_reads = '--un %s' % tmp_unmapped_file_name
+ else:
+ output_unmapped_reads = ''
+ if options.output_suppressed_reads:
+ tmp_suppressed_file = tempfile.NamedTemporaryFile( dir=tmp_index_dir, suffix='.fastq' )
+ tmp_suppressed_file_name = tmp_suppressed_file.name
+ tmp_suppressed_file.close()
+ output_suppressed_reads = '--max %s' % tmp_suppressed_file_name
+ else:
+ output_suppressed_reads = ''
+ else:
+ if options.output_unmapped_reads:
+ output_unmapped_reads = '--un %s' % options.output_unmapped_reads
+ else:
+ output_unmapped_reads = ''
+ if options.output_suppressed_reads:
+ output_suppressed_reads = '--max %s' % options.output_suppressed_reads
+ else:
+ output_suppressed_reads = ''
+ snpfrac = ''
+ if options.snpphred and int( options.snpphred ) >= 0:
+ snpphred = '--snpphred %s' % options.snpphred
+ else:
+ snpphred = ''
+ if options.snpfrac and float( options.snpfrac ) >= 0:
+ snpfrac = '--snpfrac %s' % options.snpfrac
+ if options.keepends and options.keepends == 'doKeepends':
+ keepends = '--col-keepends'
+ else:
+ keepends = ''
+ aligning_cmds = '-q %s %s -p %s -S %s %s %s %s %s %s %s %s %s %s %s %s ' \
+ '%s %s %s %s %s %s %s %s %s %s %s %s %s %s %s %s %s %s ' % \
+ ( maxInsert, mateOrient, options.threads, suppressHeader,
+ colorspace, skip, alignLimit, trimH, trimL, maqSoapAlign,
+ mismatchSeed, mismatchQual, seedLen, rounding, minInsert,
+ maxAlignAttempt, forwardAlign, reverseAlign, maxBacktracks,
+ tryHard, valAlign, allValAligns, suppressAlign, best,
+ strata, offrate, seed, snpphred, snpfrac, keepends,
+ output_unmapped_reads, output_suppressed_reads,
+ quality_score_encoding )
+ except (ValueError):
+ # clean up temp dir
+ if os.path.exists( tmp_index_dir ):
+ shutil.rmtree( tmp_index_dir )
+ stop_err( 'Something is wrong with the alignment parameters and the alignment could not be run\n' + str( e ) )
+ try:
+ # have to nest try-except in try-finally to handle 2.4
+ try:
+ # prepare actual mapping commands
+ if options.paired == 'paired':
+ cmd2 = 'bowtie %s %s -1 %s -2 %s > %s' % ( aligning_cmds, ref_file_name, options.input1, options.input2, options.output )
+ else:
+ cmd2 = 'bowtie %s %s %s > %s' % ( aligning_cmds, ref_file_name, options.input1, options.output )
+ # align
+ tmp = tempfile.NamedTemporaryFile( dir=tmp_index_dir ).name
+ tmp_stderr = open( tmp, 'wb' )
+ proc = subprocess.Popen( args=cmd2, shell=True, cwd=tmp_index_dir, stderr=tmp_stderr.fileno() )
+ returncode = proc.wait()
+ tmp_stderr.close()
+ # get stderr, allowing for case where it's very large
+ tmp_stderr = open( tmp, 'rb' )
+ stderr = ''
+ buffsize = 1048576
+ try:
+ while True:
+ stderr += tmp_stderr.read( buffsize )
+ if not stderr or len( stderr ) % buffsize != 0:
+ break
+ except OverflowError:
+ pass
+ tmp_stderr.close()
+ if returncode != 0:
+ raise (Exception, stderr)
+ # get suppressed and unmapped reads output files in place if appropriate
+ if options.paired == 'paired' and tmp_suppressed_file_name and \
+ options.output_suppressed_reads_l and options.output_suppressed_reads_r:
+ try:
+ left = tmp_suppressed_file_name.replace( '.fastq', '_1.fastq' )
+ right = tmp_suppressed_file_name.replace( '.fastq', '_1.fastq' )
+ shutil.move( left, options.output_suppressed_reads_l )
+ shutil.move( right, options.output_suppressed_reads_r )
+ except Exception as e:
+ sys.stdout.write( 'Error producing the suppressed output file.\n' )
+ if options.paired == 'paired' and tmp_unmapped_file_name and \
+ options.output_unmapped_reads_l and options.output_unmapped_reads_r:
+ try:
+ left = tmp_unmapped_file_name.replace( '.fastq', '_1.fastq' )
+ right = tmp_unmapped_file_name.replace( '.fastq', '_2.fastq' )
+ shutil.move( left, options.output_unmapped_reads_l )
+ shutil.move( right, options.output_unmapped_reads_r )
+ except Exception as e:
+ sys.stdout.write( 'Error producing the unmapped output file.\n' )
+ # check that there are results in the output file
+ if os.path.getsize( options.output ) == 0:
+ raise (Exception, 'The output file is empty, there may be an error with your input file or settings.')
+ except Exception as e:
+ stop_err( 'Error aligning sequence. ' + str( e ) )
+ finally:
+ # clean up temp dir
+ if os.path.exists( tmp_index_dir ):
+ shutil.rmtree( tmp_index_dir )
+ stdout += 'Sequence file aligned.\n'
+ sys.stdout.write( stdout )
+
+if __name__=="__main__": __main__()
diff -r a2b0620733e3 -r 9e5052835e34 bowtie_remove_rrna_wrapper/test-data/bowtie_in2.fastqsanger
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/bowtie_remove_rrna_wrapper/test-data/bowtie_in2.fastqsanger Wed Feb 23 13:57:30 2022 +0000
@@ -0,0 +1,104 @@
+@HWI-EAS91_1_30788AAXX:1:1:1513:715/1
+GTTTTTTGGGCATAGATGTTTAGTTGTGGTAGTCAG
++
+IIIIIII""IIIIIIIIIIIIIIIIIIIDI?II-+I
+@HWI-EAS91_1_30788AAXX:1:1:1698:516/1
+GTTGTTAGGGAGAGGAGTTGAACCTCTGAGTGTAAA
++
+IIIIIII""IIIIIIIIIIIIIIIIIII5IIIII9I
+@HWI-EAS91_1_30788AAXX:1:1:1491:637/1
+GCTAGCAGGATGGATCCGGCAATTGGGGCTTCTACA
++
+IIIIIII""IIIIIIIIIIIIFIIIIIIIIIIIABD
+@HWI-EAS91_1_30788AAXX:1:1:1711:249/1
+GGAAGTAGGGGCCTGCGTTCAGGCGTTCTGTTTGGT
++
+IIIIIII""IIIIIIIIIIIIIIIIIIIIIIIIIII
+@HWI-EAS91_1_30788AAXX:1:1:1634:211/1
+GAAGCAGGGGCTTGATACTGACACTTCGTCGACGTA
++
+IIIIIII""IIIIIIIIIIIIIIIIIIIIII9IIDF
+@HWI-EAS91_1_30788AAXX:1:1:1218:141/1
+GTTAAATATTGGGAGTGGGGGGGGGGGGGAGTTTTG
++
+IIIIIII""IIIIIIIIIIIIIIIIIIII1IIII+I
+@HWI-EAS91_1_30788AAXX:1:1:1398:854/1
+GTGAAGAGGAGGGGATTTATTAGTACGGGAAGGGTG
++
+IIIIIII""IIIIIBIIIIIIIIIIIIIIA=IIIII
+@HWI-EAS91_1_30788AAXX:1:1:1310:991/1
+GAATAGTGGTAGTATTATTCCTTCTAGGCATAGGAG
++
+IIIIIII""IIIIIIIIII4IIIIIIDII:IEI2:I
+@HWI-EAS91_1_30788AAXX:1:1:1716:413/1
+GATCCAAGGCTTTATCAACACCTATTCTGATTCTTC
++
+IIIIIII""IIIIIIIIIIIIIIIIIIIIIIIIIII
+@HWI-EAS91_1_30788AAXX:1:1:1630:59/1
+GGAGCGGGGGGTTGGTAAGGTTGGGGTCGAGTATGA
++
+IIIIIII""IIIIIIIIIIIIIIIIIIII;IIHIIF
+@HWI-EAS91_1_30788AAXX:1:1:1601:805/1
+GAAAACAGGAAAACAATCCAGTCACTTACCCTATGC
++
+IIIIIII""IIIIIIIIIIIIIIIIIIIIIII@III
+@HWI-EAS91_1_30788AAXX:1:1:1663:724/1
+GTTTGCCGGCGCCATCCTACGCTCCATTCCCAACAA
++
+IIIIIII""IIII8IIIIIIHIIII6IIIII1CI=3
+@HWI-EAS91_1_30788AAXX:1:1:1454:975/1
+GCTAGGCGGGAGTGGTAAAAGGCTCAGAAGAAGCCA
++
+IIIIIII""IIIIIIIIIIIIIIIIEIG;IIIIIII
+@HWI-EAS91_1_30788AAXX:1:1:1461:255/1
+GTACACCGGCGCCTGAGCCCTACTAATAACTCTCAT
++
+IIIIIII""IIIIII9IIIIIIEI(II9.I4III,I
+@HWI-EAS91_1_30788AAXX:1:1:1775:764/1
+GCATCCCGGTAGATCTAATTTTCTAAATCTGTCAAC
++
+IIIIIII""III@IIII+IIIIII8H8IIIIIIICI
+@HWI-EAS91_1_30788AAXX:1:1:1269:520/1
+GGAGTATGGAATAAGTGATTTTAGATCGGTTTGTCG
++
+IIIIIII""IIIIIIIIIIIIIIIIIIIIIIIIIII
+@HWI-EAS91_1_30788AAXX:1:1:1303:1162/1
+GAGCAAGGGCAGGAGGAGGAGTCCTAGGATGTCTTT
++
+IIIIIII""IIIIFII4*IGIAI(IAII49',3I6I
+@HWI-EAS91_1_30788AAXX:1:1:1090:409/1
+GTTTGTTGGGAATGGAGCGTAGGATGGCGTAGGCAA
++
+IIIIIII""IIIIIIIIIIIIIIIIIIIII:IIA8I
+@HWI-EAS91_1_30788AAXX:1:1:1336:1000/1
+GGTAAATGGGAAATATTAAGTTTCTGTTTCTAGATC
++
+IIIIIII""IIIIIIIIIIIIIIIIIIIIIIII9II
+@HWI-EAS91_1_30788AAXX:1:1:1199:1376/1
+GTTTTCTGGAAAACCTTCACCTATTTATGGGGGTTT
++
+IIIIIII""IIIIIIIIIIIII;III3IIG&:/III
+@HWI-EAS91_1_30788AAXX:1:1:1598:1148/1
+GATCAATGGTTTGGATCAATAAGTGATTATATATTT
++
+IIIIIII""IIIIIDIIIIII?IIICII=IHIIIII
+@HWI-EAS91_1_30788AAXX:1:1:1723:1459/1
+GAAACCCGGACGTTTGGATGGGCCCGGAGCGAGGAT
++
+IIIIIII""IIIIIIIIDIIIIIIIII9HII-II=I
+@HWI-EAS91_1_30788AAXX:1:1:1442:1346/1
+TATCAAGGGGCTGCTTCGAATCCGAAGTGGTGGCTG
++
+IIIIIII""IIIIIDIIIII1I(I4IIphiX174
+GAGTTTTATCGCTTCCATGACGCAGAAGTTAACACTTTCGGATATTTCTGATGAGTCGAAAAATTATCTT
+GATAAAGCAGGAATTACTACTGCTTGTTTACGAATTAAATCGAAGTGGACTGCTGGCGGAAAATGAGAAA
+ATTCGACCTATCCTTGCGCAGCTCGAGAAGCTCTTACTTTGCGACCTTTCGCCATCAACTAACGATTCTG
+TCAAAAACTGACGCGTTGGATGAGGAGAAGTGGCTTAATATGCTTGGCACGTTCGTCAAGGACTGGTTTA
+GATATGAGTCACATTTTGTTCATGGTAGAGATTCTCTTGTTGACATTTTAAAAGAGCGTGGATTACTATC
+TGAGTCCGATGCTGTTCAACCACTAATAGGTAAGAAATCATGAGTCAAGTTACTGAACAATCCGTACGTT
+TCCAGACCGCTTTGGCCTCTATTAAGCTCATTCAGGCTTCTGCCGTTTTGGATTTAACCGAAGATGATTT
+CGATTTTCTGACGAGTAACAAAGTTTGGATTGCTACTGACCGCTCTCGTGCTCGTCGCTGCGTTGAGGCT
+TGCGTTTATGGTACGCTGGACTTTGTGGGATACCCTCGCTTTCCTGCTCCTGTTGAGTTTATTGCTGCCG
+TCATTGCTTATTATGTTCATCCCGTCAACATTCAAACGGCCTGTCTCATCATGGAAGGCGCTGAATTTAC
+GGAAAACATTATTAATGGCGTCGAGCGTCCGGTTAAAGCCGCTGAATTGTTCGCGTTTACCTTGCGTGTA
+CGCGCAGGAAACACTGACGTTCTTACTGACGCAGAAGAAAACGTGCGTCAAAAATTACGTGCAGAAGGAG
+TGATGTAATGTCTAAAGGTAAAAAACGTTCTGGCGCTCGCCCTGGTCGTCCGCAGCCGTTGCGAGGTACT
+AAAGGCAAGCGTAAAGGCGCTCGTCTTTGGTATGTAGGTGGTCAACAATTTTAATTGCAGGGGCTTCGGC
+CCCTTACTTGAGGATAAATTATGTCTAATATTCAAACTGGCGCCGAGCGTATGCCGCATGACCTTTCCCA
+TCTTGGCTTCCTTGCTGGTCAGATTGGTCGTCTTATTACCATTTCAACTACTCCGGTTATCGCTGGCGAC
+TCCTTCGAGATGGACGCCGTTGGCGCTCTCCGTCTTTCTCCATTGCGTCGTGGCCTTGCTATTGACTCTA
+CTGTAGACATTTTTACTTTTTATGTCCCTCATCGTCACGTTTATGGTGAACAGTGGATTAAGTTCATGAA
+GGATGGTGTTAATGCCACTCCTCTCCCGACTGTTAACACTACTGGTTATATTGACCATGCCGCTTTTCTT
+GGCACGATTAACCCTGATACCAATAAAATCCCTAAGCATTTGTTTCAGGGTTATTTGAATATCTATAACA
+ACTATTTTAAAGCGCCGTGGATGCCTGACCGTACCGAGGCTAACCCTAATGAGCTTAATCAAGATGATGC
+TCGTTATGGTTTCCGTTGCTGCCATCTCAAAAACATTTGGACTGCTCCGCTTCCTCCTGAGACTGAGCTT
+TCTCGCCAAATGACGACTTCTACCACATCTATTGACATTATGGGTCTGCAAGCTGCTTATGCTAATTTGC
+ATACTGACCAAGAACGTGATTACTTCATGCAGCGTTACCGTGATGTTATTTCTTCATTTGGAGGTAAAAC
+CTCTTATGACGCTGACAACCGTCCTTTACTTGTCATGCGCTCTAATCTCTGGGCATCTGGCTATGATGTT
+GATGGAACTGACCAAACGTCGTTAGGCCAGTTTTCTGGTCGTGTTCAACAGACCTATAAACATTCTGTGC
+CGCGTTTCTTTGTTCCTGAGCATGGCACTATGTTTACTCTTGCGCTTGTTCGTTTTCCGCCTACTGCGAC
+TAAAGAGATTCAGTACCTTAACGCTAAAGGTGCTTTGACTTATACCGATATTGCTGGCGACCCTGTTTTG
+TATGGCAACTTGCCGCCGCGTGAAATTTCTATGAAGGATGTTTTCCGTTCTGGTGATTCGTCTAAGAAGT
+TTAAGATTGCTGAGGGTCAGTGGTATCGTTATGCGCCTTCGTATGTTTCTCCTGCTTATCACCTTCTTGA
+AGGCTTCCCATTCATTCAGGAACCGCCTTCTGGTGATTTGCAAGAACGCGTACTTATTCGCCACCATGAT
+TATGACCAGTGTTTCCAGTCCGTTCAGTTGTTGCAGTGGAATAGTCAGGTTAAATTTAATGTGACCGTTT
+ATCGCAATCTGCCGACCACTCGCGATTCAATCATGACTTCGTGATAAAAGATTGAGTGTGAGGTTATAAC
+GCCGAAGCGGTAAAAATTTTAATTTTTGCCGCTGAGGGGTTGACCAAGCGAAGCGCGGTAGGTTTTCTGC
+TTAGGAGTTTAATCATGTTTCAGACTTTTATTTCTCGCCATAATTCAAACTTTTTTTCTGATAAGCTGGT
+TCTCACTTCTGTTACTCCAGCTTCTTCGGCACCTGTTTTACAGACACCTAAAGCTACATCGTCAACGTTA
+TATTTTGATAGTTTGACGGTTAATGCTGGTAATGGTGGTTTTCTTCATTGCATTCAGATGGATACATCTG
+TCAACGCCGCTAATCAGGTTGTTTCTGTTGGTGCTGATATTGCTTTTGATGCCGACCCTAAATTTTTTGC
+CTGTTTGGTTCGCTTTGAGTCTTCTTCGGTTCCGACTACCCTCCCGACTGCCTATGATGTTTATCCTTTG
+AATGGTCGCCATGATGGTGGTTATTATACCGTCAAGGACTGTGTGACTATTGACGTCCTTCCCCGTACGC
+CGGGCAATAATGTTTATGTTGGTTTCATGGTTTGGTCTAACTTTACCGCTACTAAATGCCGCGGATTGGT
+TTCGCTGAATCAGGTTATTAAAGAGATTATTTGTCTCCAGCCACTTAAGTGAGGTGATTTATGTTTGGTG
+CTATTGCTGGCGGTATTGCTTCTGCTCTTGCTGGTGGCGCCATGTCTAAATTGTTTGGAGGCGGTCAAAA
+AGCCGCCTCCGGTGGCATTCAAGGTGATGTGCTTGCTACCGATAACAATACTGTAGGCATGGGTGATGCT
+GGTATTAAATCTGCCATTCAAGGCTCTAATGTTCCTAACCCTGATGAGGCCGCCCCTAGTTTTGTTTCTG
+GTGCTATGGCTAAAGCTGGTAAAGGACTTCTTGAAGGTACGTTGCAGGCTGGCACTTCTGCCGTTTCTGA
+TAAGTTGCTTGATTTGGTTGGACTTGGTGGCAAGTCTGCCGCTGATAAAGGAAAGGATACTCGTGATTAT
+CTTGCTGCTGCATTTCCTGAGCTTAATGCTTGGGAGCGTGCTGGTGCTGATGCTTCCTCTGCTGGTATGG
+TTGACGCCGGATTTGAGAATCAAAAAGAGCTTACTAAAATGCAACTGGACAATCAGAAAGAGATTGCCGA
+GATGCAAAATGAGACTCAAAAAGAGATTGCTGGCATTCAGTCGGCGACTTCACGCCAGAATACGAAAGAC
+CAGGTATATGCACAAAATGAGATGCTTGCTTATCAACAGAAGGAGTCTACTGCTCGCGTTGCGTCTATTA
+TGGAAAACACCAATCTTTCCAAGCAACAGCAGGTTTCCGAGATTATGCGCCAAATGCTTACTCAAGCTCA
+AACGGCTGGTCAGTATTTTACCAATGACCAAATCAAAGAAATGACTCGCAAGGTTAGTGCTGAGGTTGAC
+TTAGTTCATCAGCAAACGCAGAATCAGCGGTATGGCTCTTCTCATATTGGCGCTACTGCAAAGGATATTT
+CTAATGTCGTCACTGATGCTGCTTCTGGTGTGGTTGATATTTTTCATGGTATTGATAAAGCTGTTGCCGA
+TACTTGGAACAATTTCTGGAAAGACGGTAAAGCTGATGGTATTGGCTCTAATTTGTCTAGGAAATAACCG
+TCAGGATTGACACCCTCCCAATTGTATGTTTTCATGCCTCCAAATCTTGGAGGCTTTTTTATGGTTCGTT
+CTTATTACCCTTCTGAATGTCACGCTGATTATTTTGACTTTGAGCGTATCGAGGCTCTTAAACCTGCTAT
+TGAGGCTTGTGGCATTTCTACTCTTTCTCAATCCCCAATGCTTGGCTTCCATAAGCAGATGGATAACCGC
+ATCAAGCTCTTGGAAGAGATTCTGTCTTTTCGTATGCAGGGCGTTGAGTTCGATAATGGTGATATGTATG
+TTGACGGCCATAAGGCTGCTTCTGACGTTCGTGATGAGTTTGTATCTGTTACTGAGAAGTTAATGGATGA
+ATTGGCACAATGCTACAATGTGCTCCCCCAACTTGATATTAATAACACTATAGACCACCGCCCCGAAGGG
+GACGAAAAATGGTTTTTAGAGAACGAGAAGACGGTTACGCAGTTTTGCCGCAAGCTGGCTGCTGAACGCC
+CTCTTAAGGATATTCGCGATGAGTATAATTACCCCAAAAAGAAAGGTATTAAGGATGAGTGTTCAAGATT
+GCTGGAGGCCTCCACTATGAAATCGCGTAGAGGCTTTACTATTCAGCGTTTGATGAATGCAATGCGACAG
+GCTCATGCTGATGGTTGGTTTATCGTTTTTGACACTCTCACGTTGGCTGACGACCGATTAGAGGCGTTTT
+ATGATAATCCCAATGCTTTGCGTGACTATTTTCGTGATATTGGTCGTATGGTTCTTGCTGCCGAGGGTCG
+CAAGGCTAATGATTCACACGCCGACTGCTATCAGTATTTTTGTGTGCCTGAGTATGGTACAGCTAATGGC
+CGTCTTCATTTCCATGCGGTGCATTTTATGCGGACACTTCCTACAGGTAGCGTTGACCCTAATTTTGGTC
+GTCGGGTACGCAATCGCCGCCAGTTAAATAGCTTGCAAAATACGTGGCCTTATGGTTACAGTATGCCCAT
+CGCAGTTCGCTACACGCAGGACGCTTTTTCACGTTCTGGTTGGTTGTGGCCTGTTGATGCTAAAGGTGAG
+CCGCTTAAAGCTACCAGTTATATGGCTGTTGGTTTCTATGTGGCTAAATACGTTAACAAAAAGTCAGATA
+TGGACCTTGCTGCTAAAGGTCTAGGAGCTAAAGAATGGAACAACTCACTAAAAACCAAGCTGTCGCTACT
+TCCCAAGAAGCTGTTCAGAATCAGAATGAGCCGCAACTTCGGGATGAAAATGCTCACAATGACAAATCTG
+TCCACGGAGTGCTTAATCCAACTTACCAAGCTGGGTTACGACGCGACGCCGTTCAACCAGATATTGAAGC
+AGAACGCAAAAAGAGAGATGAGATTGAGGCTGGGAAAAGTTACTGTAGCCGACGTTTTGGCGGCGCAACC
+TGTGACGACAAATCTGCTCAAATTTATGCGCGCTTCGATAAAAATGATTGGCGTATCCAACCTGCA
+
diff -r a2b0620733e3 -r 9e5052835e34 bowtie_remove_rrna_wrapper/tool-data/bowtie_indices.loc
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/bowtie_remove_rrna_wrapper/tool-data/bowtie_indices.loc Wed Feb 23 13:57:30 2022 +0000
@@ -0,0 +1,1 @@
+Mouse_rRNA Mouse_rRNA Mouse_rRNA /home/DATA/galaxy/galaxy-dist/data/indexes/bowtie_rrna_indexes/Mouse_rRNA/bowtie_rrna_indexes/mouse_rRNA_index
diff -r a2b0620733e3 -r 9e5052835e34 bowtie_remove_rrna_wrapper/tool_data_table_conf.xml.sample
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/bowtie_remove_rrna_wrapper/tool_data_table_conf.xml.sample Wed Feb 23 13:57:30 2022 +0000
@@ -0,0 +1,8 @@
+
+
+