# HG changeset patch # User triasteran # Date 1645624631 0 # Node ID a2b0620733e37ac54dfbf609ad8681fbdd6a075f # Parent c0267c5fbc65811985647bea57dbfcf437b49092 Deleted selected files diff -r c0267c5fbc65 -r a2b0620733e3 bowtie_remove_rrna_wrapper/.hgignore --- a/bowtie_remove_rrna_wrapper/.hgignore Wed Feb 23 13:30:20 2022 +0000 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,2 +0,0 @@ -syntax: glob -.idea diff -r c0267c5fbc65 -r a2b0620733e3 bowtie_remove_rrna_wrapper/bowtie_indices.loc.sample --- a/bowtie_remove_rrna_wrapper/bowtie_indices.loc.sample Wed Feb 23 13:30:20 2022 +0000 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,1 +0,0 @@ -Mouse_rRNA Mouse_rRNA Mouse_rRNA /home/DATA/galaxy/galaxy-dist/data/indexes/bowtie_rrna_indexes/Mouse_rRNA/bowtie_rrna_indexes/mouse_rRNA_index diff -r c0267c5fbc65 -r a2b0620733e3 bowtie_remove_rrna_wrapper/bowtie_remove_rrna_wrapper.xml --- a/bowtie_remove_rrna_wrapper/bowtie_remove_rrna_wrapper.xml Wed Feb 23 13:30:20 2022 +0000 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,681 +0,0 @@ - - - bowtie - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - (( - singlePaired['sPaired'] == "single" and - singlePaired['sParams']['sSettingsType'] == "full" and - singlePaired['sParams']['sMaxFile'] is True - ) or ( - singlePaired['sPaired'] == "paired" and - singlePaired['pParams']['pSettingsType'] == "full" and - singlePaired['pParams']['pMaxFile'] is True - )) - - - - - - - - - - - - - - - - singlePaired['sPaired'] == "paired" - singlePaired['pParams']['pSettingsType'] == "full" - singlePaired['pParams']['pMaxFile'] is True - - - - - - - - - - - - - - - - (( - singlePaired['sPaired'] == "single" and - singlePaired['sParams']['sSettingsType'] == "full" and - singlePaired['sParams']['sUnmappedFile'] is True - ) or ( - singlePaired['sPaired'] == "paired" and - singlePaired['pParams']['pSettingsType'] == "full" and - singlePaired['pParams']['pUnmappedFile'] is True - )) - - - - - - - - - - - - - - - - singlePaired['sPaired'] == "paired" - singlePaired['pParams']['pSettingsType'] == "full" - singlePaired['pParams']['pUnmappedFile'] is True - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -@misc{githubbowtie, - author = {LastTODO, FirstTODO}, - year = {TODO}, - title = {bowtie}, - publisher = {GitHub}, - journal = {GitHub repository}, - url = {https://github.com/BenLangmead/bowtie}, -} - - diff -r c0267c5fbc65 -r a2b0620733e3 bowtie_remove_rrna_wrapper/bowtie_wrapper.py --- a/bowtie_remove_rrna_wrapper/bowtie_wrapper.py Wed Feb 23 13:30:20 2022 +0000 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,469 +0,0 @@ -#!/usr/bin/env python - -""" -Runs Bowtie on single-end or paired-end data. -For use with Bowtie v. 0.12.7 - -usage: bowtie_wrapper.py [options] - -t, --threads=t: The number of threads to run - -o, --output=o: The output file - --output_unmapped_reads=: File name for unmapped reads (single-end) - --output_unmapped_reads_l=: File name for unmapped reads (left, paired-end) - --output_unmapped_reads_r=: File name for unmapped reads (right, paired-end) - --output_suppressed_reads=: File name for suppressed reads because of max setting (single-end) - --output_suppressed_reads_l=: File name for suppressed reads because of max setting (left, paired-end) - --output_suppressed_reads_r=: File name for suppressed reads because of max setting (right, paired-end) - -i, --input1=i: The (forward or single-end) reads file in Sanger FASTQ format - -I, --input2=I: The reverse reads file in Sanger FASTQ format - -4, --dataType=4: The type of data (SOLiD or Solexa) - -2, --paired=2: Whether the data is single- or paired-end - -g, --genomeSource=g: The type of reference provided - -r, --ref=r: The reference genome to use or index - -s, --skip=s: Skip the first n reads - -a, --alignLimit=a: Only align the first n reads - -T, --trimH=T: Trim n bases from high-quality (left) end of each read before alignment - -L, --trimL=L: Trim n bases from low-quality (right) end of each read before alignment - -m, --mismatchSeed=m: Maximum number of mismatches permitted in the seed - -M, --mismatchQual=M: Maximum permitted total of quality values at mismatched read positions - -l, --seedLen=l: Seed length - -n, --rounding=n: Whether or not to round to the nearest 10 and saturating at 30 - -P, --maqSoapAlign=P: Choose MAQ- or SOAP-like alignment policy - -w, --tryHard=: Whether or not to try as hard as possible to find valid alignments when they exist - -v, --valAlign=v: Report up to n valid arguments per read - -V, --allValAligns=V: Whether or not to report all valid alignments per read - -G, --suppressAlign=G: Suppress all alignments for a read if more than n reportable alignments exist - -b, --best=b: Whether or not to make Bowtie guarantee that reported singleton alignments are 'best' in terms of stratum and in terms of the quality values at the mismatched positions - -B, --maxBacktracks=B: Maximum number of backtracks permitted when aligning a read - -R, --strata=R: Whether or not to report only those alignments that fall in the best stratum if many valid alignments exist and are reportable - -j, --minInsert=j: Minimum insert size for valid paired-end alignments - -J, --maxInsert=J: Maximum insert size for valid paired-end alignments - -O, --mateOrient=O: The upstream/downstream mate orientation for valid paired-end alignment against the forward reference strand - -A, --maxAlignAttempt=A: Maximum number of attempts Bowtie will make to match an alignment for one mate with an alignment for the opposite mate - -f, --forwardAlign=f: Whether or not to attempt to align the forward reference strand - -E, --reverseAlign=E: Whether or not to attempt to align the reverse-complement reference strand - -F, --offrate=F: Override the offrate of the index to n - -8, --snpphred=8: SNP penalty on Phred scale - -6, --snpfrac=6: Fraction of sites expected to be SNP sites - -7, --keepends=7: Keep extreme-end nucleotides and qualities - -S, --seed=S: Seed for pseudo-random number generator - -C, --params=C: Whether to use default or specified parameters - -u, --iautoB=u: Automatic or specified behavior - -K, --ipacked=K: Whether or not to use a packed representation for DNA strings - -Q, --ibmax=Q: Maximum number of suffixes allowed in a block - -Y, --ibmaxdivn=Y: Maximum number of suffixes allowed in a block as a fraction of the length of the reference - -D, --idcv=D: The period for the difference-cover sample - -U, --inodc=U: Whether or not to disable the use of the difference-cover sample - -y, --inoref=y: Whether or not to build the part of the reference index used only in paired-end alignment - -z, --ioffrate=z: How many rows get marked during annotation of some or all of the Burrows-Wheeler rows - -W, --iftab=W: The size of the lookup table used to calculate an initial Burrows-Wheeler range with respect to the first n characters of the query - -X, --intoa=X: Whether or not to convert Ns in the reference sequence to As - -N, --iendian=N: Endianness to use when serializing integers to the index file - -Z, --iseed=Z: Seed for the pseudorandom number generator - -c, --icutoff=c: Number of first bases of the reference sequence to index - -x, --indexSettings=x: Whether or not indexing options are to be set - -H, --suppressHeader=H: Suppress header - --do_not_build_index: Flag to specify that provided file is already indexed and to just use 'as is' -""" - -import optparse, os, shutil, subprocess, sys, tempfile - -#Allow more than Sanger encoded variants -DEFAULT_ASCII_ENCODING = '--phred33-quals' -GALAXY_FORMAT_TO_QUALITY_SCORE_ENCODING_ARG = { 'fastqsanger':'--phred33-quals', 'fastqillumina':'--phred64-quals', 'fastqsolexa':'--solexa-quals' } -#FIXME: Integer quality scores are supported only when the '--integer-quals' argument is specified to bowtie; this is not currently able to be set in the tool/wrapper/config - -def stop_err( msg ): - sys.stderr.write( '%s\n' % msg ) - sys.exit() - -def __main__(): - #Parse Command Line - parser = optparse.OptionParser() - parser.add_option( '-t', '--threads', dest='threads', help='The number of threads to run' ) - parser.add_option( '-o', '--output', dest='output', help='The output file' ) - parser.add_option( '', '--output_unmapped_reads', dest='output_unmapped_reads', help='File name for unmapped reads (single-end)' ) - parser.add_option( '', '--output_unmapped_reads_l', dest='output_unmapped_reads_l', help='File name for unmapped reads (left, paired-end)' ) - parser.add_option( '', '--output_unmapped_reads_r', dest='output_unmapped_reads_r', help='File name for unmapped reads (right, paired-end)' ) - parser.add_option( '', '--output_suppressed_reads', dest='output_suppressed_reads', help='File name for suppressed reads because of max setting (single-end)' ) - parser.add_option( '', '--output_suppressed_reads_l', dest='output_suppressed_reads_l', help='File name for suppressed reads because of max setting (left, paired-end)' ) - parser.add_option( '', '--output_suppressed_reads_r', dest='output_suppressed_reads_r', help='File name for suppressed reads because of max setting (right, paired-end)' ) - parser.add_option( '-4', '--dataType', dest='dataType', help='The type of data (SOLiD or Solexa)' ) - parser.add_option( '-i', '--input1', dest='input1', help='The (forward or single-end) reads file in Sanger FASTQ format' ) - parser.add_option( '-I', '--input2', dest='input2', help='The reverse reads file in Sanger FASTQ format' ) - parser.add_option( '-2', '--paired', dest='paired', help='Whether the data is single- or paired-end' ) - parser.add_option( '-g', '--genomeSource', dest='genomeSource', help='The type of reference provided' ) - parser.add_option( '-r', '--ref', dest='ref', help='The reference genome to use or index' ) - parser.add_option( '-s', '--skip', dest='skip', help='Skip the first n reads' ) - parser.add_option( '-a', '--alignLimit', dest='alignLimit', help='Only align the first n reads' ) - parser.add_option( '-T', '--trimH', dest='trimH', help='Trim n bases from high-quality (left) end of each read before alignment' ) - parser.add_option( '-L', '--trimL', dest='trimL', help='Trim n bases from low-quality (right) end of each read before alignment' ) - parser.add_option( '-m', '--mismatchSeed', dest='mismatchSeed', help='Maximum number of mismatches permitted in the seed' ) - parser.add_option( '-M', '--mismatchQual', dest='mismatchQual', help='Maximum permitted total of quality values at mismatched read positions' ) - parser.add_option( '-l', '--seedLen', dest='seedLen', help='Seed length' ) - parser.add_option( '-n', '--rounding', dest='rounding', help='Whether or not to round to the nearest 10 and saturating at 30' ) - parser.add_option( '-P', '--maqSoapAlign', dest='maqSoapAlign', help='Choose MAQ- or SOAP-like alignment policy' ) - parser.add_option( '-w', '--tryHard', dest='tryHard', help='Whether or not to try as hard as possible to find valid alignments when they exist' ) - parser.add_option( '-v', '--valAlign', dest='valAlign', help='Report up to n valid arguments per read' ) - parser.add_option( '-V', '--allValAligns', dest='allValAligns', help='Whether or not to report all valid alignments per read' ) - parser.add_option( '-G', '--suppressAlign', dest='suppressAlign', help='Suppress all alignments for a read if more than n reportable alignments exist' ) - parser.add_option( '-b', '--best', dest='best', help="Whether or not to make Bowtie guarantee that reported singleton alignments are 'best' in terms of stratum and in terms of the quality values at the mismatched positions" ) - parser.add_option( '-B', '--maxBacktracks', dest='maxBacktracks', help='Maximum number of backtracks permitted when aligning a read' ) - parser.add_option( '-R', '--strata', dest='strata', help='Whether or not to report only those alignments that fall in the best stratum if many valid alignments exist and are reportable' ) - parser.add_option( '-j', '--minInsert', dest='minInsert', help='Minimum insert size for valid paired-end alignments' ) - parser.add_option( '-J', '--maxInsert', dest='maxInsert', help='Maximum insert size for valid paired-end alignments' ) - parser.add_option( '-O', '--mateOrient', dest='mateOrient', help='The upstream/downstream mate orientation for valid paired-end alignment against the forward reference strand' ) - parser.add_option( '-A', '--maxAlignAttempt', dest='maxAlignAttempt', help='Maximum number of attempts Bowtie will make to match an alignment for one mate with an alignment for the opposite mate' ) - parser.add_option( '-f', '--forwardAlign', dest='forwardAlign', help='Whether or not to attempt to align the forward reference strand' ) - parser.add_option( '-E', '--reverseAlign', dest='reverseAlign', help='Whether or not to attempt to align the reverse-complement reference strand' ) - parser.add_option( '-F', '--offrate', dest='offrate', help='Override the offrate of the index to n' ) - parser.add_option( '-S', '--seed', dest='seed', help='Seed for pseudo-random number generator' ) - parser.add_option( '-8', '--snpphred', dest='snpphred', help='SNP penalty on Phred scale' ) - parser.add_option( '-6', '--snpfrac', dest='snpfrac', help='Fraction of sites expected to be SNP sites' ) - parser.add_option( '-7', '--keepends', dest='keepends', help='Keep extreme-end nucleotides and qualities' ) - parser.add_option( '-C', '--params', dest='params', help='Whether to use default or specified parameters' ) - parser.add_option( '-u', '--iautoB', dest='iautoB', help='Automatic or specified behavior' ) - parser.add_option( '-K', '--ipacked', dest='ipacked', help='Whether or not to use a packed representation for DNA strings' ) - parser.add_option( '-Q', '--ibmax', dest='ibmax', help='Maximum number of suffixes allowed in a block' ) - parser.add_option( '-Y', '--ibmaxdivn', dest='ibmaxdivn', help='Maximum number of suffixes allowed in a block as a fraction of the length of the reference' ) - parser.add_option( '-D', '--idcv', dest='idcv', help='The period for the difference-cover sample' ) - parser.add_option( '-U', '--inodc', dest='inodc', help='Whether or not to disable the use of the difference-cover sample' ) - parser.add_option( '-y', '--inoref', dest='inoref', help='Whether or not to build the part of the reference index used only in paired-end alignment' ) - parser.add_option( '-z', '--ioffrate', dest='ioffrate', help='How many rows get marked during annotation of some or all of the Burrows-Wheeler rows' ) - parser.add_option( '-W', '--iftab', dest='iftab', help='The size of the lookup table used to calculate an initial Burrows-Wheeler range with respect to the first n characters of the query' ) - parser.add_option( '-X', '--intoa', dest='intoa', help='Whether or not to convert Ns in the reference sequence to As' ) - parser.add_option( '-N', '--iendian', dest='iendian', help='Endianness to use when serializing integers to the index file' ) - parser.add_option( '-Z', '--iseed', dest='iseed', help='Seed for the pseudorandom number generator' ) - parser.add_option( '-c', '--icutoff', dest='icutoff', help='Number of first bases of the reference sequence to index' ) - parser.add_option( '-x', '--indexSettings', dest='index_settings', help='Whether or not indexing options are to be set' ) - parser.add_option( '-H', '--suppressHeader', dest='suppressHeader', help='Suppress header' ) - parser.add_option( '--galaxy_input_format', dest='galaxy_input_format', default="fastqsanger", help='galaxy input format' ) - parser.add_option( '--do_not_build_index', dest='do_not_build_index', action="store_true", default=False, help='Flag to specify that provided file is already indexed, use as is' ) - (options, args) = parser.parse_args() - stdout = '' - - # make temp directory for placement of indices and copy reference file there if necessary - tmp_index_dir = tempfile.mkdtemp() - # get type of data (solid or solexa) - if options.dataType == 'solid': - colorspace = '-C' - else: - colorspace = '' - # index if necessary - if options.genomeSource == 'history' and not options.do_not_build_index: - # set up commands - if options.index_settings =='indexPreSet': - indexing_cmds = '%s' % colorspace - else: - try: - if options.iautoB and options.iautoB == 'set': - iautoB = '--noauto' - else: - iautoB = '' - if options. ipacked and options.ipacked == 'packed': - ipacked = '--packed' - else: - ipacked = '' - if options.ibmax and int( options.ibmax ) >= 1: - ibmax = '--bmax %s' % options.ibmax - else: - ibmax = '' - if options.ibmaxdivn and int( options.ibmaxdivn ) >= 0: - ibmaxdivn = '--bmaxdivn %s' % options.ibmaxdivn - else: - ibmaxdivn = '' - if options.idcv and int( options.idcv ) > 0: - idcv = '--dcv %s' % options.idcv - else: - idcv = '' - if options.inodc and options.inodc == 'nodc': - inodc = '--nodc' - else: - inodc = '' - if options.inoref and options.inoref == 'noref': - inoref = '--noref' - else: - inoref = '' - if options.iftab and int( options.iftab ) >= 0: - iftab = '--ftabchars %s' % options.iftab - else: - iftab = '' - if options.intoa and options.intoa == 'yes': - intoa = '--ntoa' - else: - intoa = '' - if options.iendian and options.iendian == 'big': - iendian = '--big' - else: - iendian = '--little' - if options.iseed and int( options.iseed ) > 0: - iseed = '--seed %s' % options.iseed - else: - iseed = '' - if options.icutoff and int( options.icutoff ) > 0: - icutoff = '--cutoff %s' % options.icutoff - else: - icutoff = '' - indexing_cmds = '%s %s %s %s %s %s %s --offrate %s %s %s %s %s %s %s' % \ - ( iautoB, ipacked, ibmax, ibmaxdivn, idcv, inodc, - inoref, options.ioffrate, iftab, intoa, iendian, - iseed, icutoff, colorspace ) - except ValueError, e: - # clean up temp dir - if os.path.exists( tmp_index_dir ): - shutil.rmtree( tmp_index_dir ) - stop_err( "Something is wrong with the indexing parameters and the indexing and alignment could not be run. Make sure you don't have any non-numeric values where they should be numeric.\n" + str( e ) ) - ref_file = tempfile.NamedTemporaryFile( dir=tmp_index_dir ) - ref_file_name = ref_file.name - ref_file.close() - os.symlink( options.ref, ref_file_name ) - cmd1 = 'bowtie-build %s -f %s %s' % ( indexing_cmds, ref_file_name, ref_file_name ) - try: - tmp = tempfile.NamedTemporaryFile( dir=tmp_index_dir ).name - tmp_stderr = open( tmp, 'wb' ) - proc = subprocess.Popen( args=cmd1, shell=True, cwd=tmp_index_dir, stderr=tmp_stderr.fileno() ) - returncode = proc.wait() - tmp_stderr.close() - # get stderr, allowing for case where it's very large - tmp_stderr = open( tmp, 'rb' ) - stderr = '' - buffsize = 1048576 - try: - while True: - stderr += tmp_stderr.read( buffsize ) - if not stderr or len( stderr ) % buffsize != 0: - break - except OverflowError: - pass - tmp_stderr.close() - if returncode != 0: - raise Exception, stderr - except Exception, e: - # clean up temp dir - if os.path.exists( tmp_index_dir ): - shutil.rmtree( tmp_index_dir ) - stop_err( 'Error indexing reference sequence\n' + str( e ) ) - stdout += 'File indexed. ' - else: - ref_file_name = options.ref - # set up aligning and generate aligning command options - # automatically set threads in both cases - tmp_suppressed_file_name = None - tmp_unmapped_file_name = None - if options.suppressHeader == 'true': - suppressHeader = '--sam-nohead' - else: - suppressHeader = '' - if options.maxInsert and int( options.maxInsert ) > 0: - maxInsert = '-X %s' % options.maxInsert - else: - maxInsert = '' - if options.mateOrient: - mateOrient = '--%s' % options.mateOrient - else: - mateOrient = '' - quality_score_encoding = GALAXY_FORMAT_TO_QUALITY_SCORE_ENCODING_ARG.get( options.galaxy_input_format, DEFAULT_ASCII_ENCODING ) - if options.params == 'preSet': - aligning_cmds = '-q %s %s -p %s -S %s %s %s ' % \ - ( maxInsert, mateOrient, options.threads, suppressHeader, colorspace, quality_score_encoding ) - else: - try: - if options.skip and int( options.skip ) > 0: - skip = '-s %s' % options.skip - else: - skip = '' - if options.alignLimit and int( options.alignLimit ) >= 0: - alignLimit = '-u %s' % options.alignLimit - else: - alignLimit = '' - if options.trimH and int( options.trimH ) > 0: - trimH = '-5 %s' % options.trimH - else: - trimH = '' - if options.trimL and int( options.trimL ) > 0: - trimL = '-3 %s' % options.trimL - else: - trimL = '' - if options.maqSoapAlign != '-1' and int( options.maqSoapAlign ) >= 0: - maqSoapAlign = '-v %s' % options.maqSoapAlign - else: - maqSoapAlign = '' - if options.mismatchSeed and (options.mismatchSeed == '0' or options.mismatchSeed == '1' \ - or options.mismatchSeed == '2' or options.mismatchSeed == '3'): - mismatchSeed = '-n %s' % options.mismatchSeed - else: - mismatchSeed = '' - if options.mismatchQual and int( options.mismatchQual ) >= 0: - mismatchQual = '-e %s' % options.mismatchQual - else: - mismatchQual = '' - if options.seedLen and int( options.seedLen ) >= 5: - seedLen = '-l %s' % options.seedLen - else: - seedLen = '' - if options.rounding == 'noRound': - rounding = '--nomaqround' - else: - rounding = '' - if options.minInsert and int( options.minInsert ) > 0: - minInsert = '-I %s' % options.minInsert - else: - minInsert = '' - if options.maxAlignAttempt and int( options.maxAlignAttempt ) >= 0: - maxAlignAttempt = '--pairtries %s' % options.maxAlignAttempt - else: - maxAlignAttempt = '' - if options.forwardAlign == 'noForward': - forwardAlign = '--nofw' - else: - forwardAlign = '' - if options.reverseAlign == 'noReverse': - reverseAlign = '--norc' - else: - reverseAlign = '' - if options.maxBacktracks and int( options.maxBacktracks ) > 0 and \ - ( options.mismatchSeed == '2' or options.mismatchSeed == '3' ): - maxBacktracks = '--maxbts %s' % options.maxBacktracks - else: - maxBacktracks = '' - if options.tryHard == 'doTryHard': - tryHard = '-y' - else: - tryHard = '' - if options.valAlign and int( options.valAlign ) >= 0: - valAlign = '-k %s' % options.valAlign - else: - valAlign = '' - if options.allValAligns == 'doAllValAligns': - allValAligns = '-a' - else: - allValAligns = '' - if options.suppressAlign and int( options.suppressAlign ) >= 0: - suppressAlign = '-m %s' % options.suppressAlign - else: - suppressAlign = '' - if options.best == 'doBest': - best = '--best' - else: - best = '' - if options.strata == 'doStrata': - strata = '--strata' - else: - strata = '' - if options.offrate and int( options.offrate ) >= 0: - offrate = '-o %s' % options.offrate - else: - offrate = '' - if options.seed and int( options.seed ) >= 0: - seed = '--seed %s' % options.seed - else: - seed = '' - if options.paired == 'paired': - if options.output_unmapped_reads_l and options.output_unmapped_reads_r: - tmp_unmapped_file = tempfile.NamedTemporaryFile( dir=tmp_index_dir, suffix='.fastq' ) - tmp_unmapped_file_name = tmp_unmapped_file.name - tmp_unmapped_file.close() - output_unmapped_reads = '--un %s' % tmp_unmapped_file_name - else: - output_unmapped_reads = '' - if options.output_suppressed_reads: - tmp_suppressed_file = tempfile.NamedTemporaryFile( dir=tmp_index_dir, suffix='.fastq' ) - tmp_suppressed_file_name = tmp_suppressed_file.name - tmp_suppressed_file.close() - output_suppressed_reads = '--max %s' % tmp_suppressed_file_name - else: - output_suppressed_reads = '' - else: - if options.output_unmapped_reads: - output_unmapped_reads = '--un %s' % options.output_unmapped_reads - else: - output_unmapped_reads = '' - if options.output_suppressed_reads: - output_suppressed_reads = '--max %s' % options.output_suppressed_reads - else: - output_suppressed_reads = '' - snpfrac = '' - if options.snpphred and int( options.snpphred ) >= 0: - snpphred = '--snpphred %s' % options.snpphred - else: - snpphred = '' - if options.snpfrac and float( options.snpfrac ) >= 0: - snpfrac = '--snpfrac %s' % options.snpfrac - if options.keepends and options.keepends == 'doKeepends': - keepends = '--col-keepends' - else: - keepends = '' - aligning_cmds = '-q %s %s -p %s -S %s %s %s %s %s %s %s %s %s %s %s %s ' \ - '%s %s %s %s %s %s %s %s %s %s %s %s %s %s %s %s %s %s ' % \ - ( maxInsert, mateOrient, options.threads, suppressHeader, - colorspace, skip, alignLimit, trimH, trimL, maqSoapAlign, - mismatchSeed, mismatchQual, seedLen, rounding, minInsert, - maxAlignAttempt, forwardAlign, reverseAlign, maxBacktracks, - tryHard, valAlign, allValAligns, suppressAlign, best, - strata, offrate, seed, snpphred, snpfrac, keepends, - output_unmapped_reads, output_suppressed_reads, - quality_score_encoding ) - except ValueError, e: - # clean up temp dir - if os.path.exists( tmp_index_dir ): - shutil.rmtree( tmp_index_dir ) - stop_err( 'Something is wrong with the alignment parameters and the alignment could not be run\n' + str( e ) ) - try: - # have to nest try-except in try-finally to handle 2.4 - try: - # prepare actual mapping commands - if options.paired == 'paired': - cmd2 = 'bowtie %s %s -1 %s -2 %s > %s' % ( aligning_cmds, ref_file_name, options.input1, options.input2, options.output ) - else: - cmd2 = 'bowtie %s %s %s > %s' % ( aligning_cmds, ref_file_name, options.input1, options.output ) - # align - tmp = tempfile.NamedTemporaryFile( dir=tmp_index_dir ).name - tmp_stderr = open( tmp, 'wb' ) - proc = subprocess.Popen( args=cmd2, shell=True, cwd=tmp_index_dir, stderr=tmp_stderr.fileno() ) - returncode = proc.wait() - tmp_stderr.close() - # get stderr, allowing for case where it's very large - tmp_stderr = open( tmp, 'rb' ) - stderr = '' - buffsize = 1048576 - try: - while True: - stderr += tmp_stderr.read( buffsize ) - if not stderr or len( stderr ) % buffsize != 0: - break - except OverflowError: - pass - tmp_stderr.close() - if returncode != 0: - raise Exception, stderr - # get suppressed and unmapped reads output files in place if appropriate - if options.paired == 'paired' and tmp_suppressed_file_name and \ - options.output_suppressed_reads_l and options.output_suppressed_reads_r: - try: - left = tmp_suppressed_file_name.replace( '.fastq', '_1.fastq' ) - right = tmp_suppressed_file_name.replace( '.fastq', '_1.fastq' ) - shutil.move( left, options.output_suppressed_reads_l ) - shutil.move( right, options.output_suppressed_reads_r ) - except Exception, e: - sys.stdout.write( 'Error producing the suppressed output file.\n' ) - if options.paired == 'paired' and tmp_unmapped_file_name and \ - options.output_unmapped_reads_l and options.output_unmapped_reads_r: - try: - left = tmp_unmapped_file_name.replace( '.fastq', '_1.fastq' ) - right = tmp_unmapped_file_name.replace( '.fastq', '_2.fastq' ) - shutil.move( left, options.output_unmapped_reads_l ) - shutil.move( right, options.output_unmapped_reads_r ) - except Exception, e: - sys.stdout.write( 'Error producing the unmapped output file.\n' ) - # check that there are results in the output file - if os.path.getsize( options.output ) == 0: - raise Exception, 'The output file is empty, there may be an error with your input file or settings.' - except Exception, e: - stop_err( 'Error aligning sequence. ' + str( e ) ) - finally: - # clean up temp dir - if os.path.exists( tmp_index_dir ): - shutil.rmtree( tmp_index_dir ) - stdout += 'Sequence file aligned.\n' - sys.stdout.write( stdout ) - -if __name__=="__main__": __main__() diff -r c0267c5fbc65 -r a2b0620733e3 bowtie_remove_rrna_wrapper/test-data/bowtie_in2.fastqsanger --- a/bowtie_remove_rrna_wrapper/test-data/bowtie_in2.fastqsanger Wed Feb 23 13:30:20 2022 +0000 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,104 +0,0 @@ -@HWI-EAS91_1_30788AAXX:1:1:1513:715/1 -GTTTTTTGGGCATAGATGTTTAGTTGTGGTAGTCAG -+ -IIIIIII""IIIIIIIIIIIIIIIIIIIDI?II-+I -@HWI-EAS91_1_30788AAXX:1:1:1698:516/1 -GTTGTTAGGGAGAGGAGTTGAACCTCTGAGTGTAAA -+ -IIIIIII""IIIIIIIIIIIIIIIIIII5IIIII9I -@HWI-EAS91_1_30788AAXX:1:1:1491:637/1 -GCTAGCAGGATGGATCCGGCAATTGGGGCTTCTACA -+ -IIIIIII""IIIIIIIIIIIIFIIIIIIIIIIIABD -@HWI-EAS91_1_30788AAXX:1:1:1711:249/1 -GGAAGTAGGGGCCTGCGTTCAGGCGTTCTGTTTGGT -+ -IIIIIII""IIIIIIIIIIIIIIIIIIIIIIIIIII -@HWI-EAS91_1_30788AAXX:1:1:1634:211/1 -GAAGCAGGGGCTTGATACTGACACTTCGTCGACGTA -+ -IIIIIII""IIIIIIIIIIIIIIIIIIIIII9IIDF -@HWI-EAS91_1_30788AAXX:1:1:1218:141/1 -GTTAAATATTGGGAGTGGGGGGGGGGGGGAGTTTTG -+ -IIIIIII""IIIIIIIIIIIIIIIIIIII1IIII+I -@HWI-EAS91_1_30788AAXX:1:1:1398:854/1 -GTGAAGAGGAGGGGATTTATTAGTACGGGAAGGGTG -+ -IIIIIII""IIIIIBIIIIIIIIIIIIIIA=IIIII -@HWI-EAS91_1_30788AAXX:1:1:1310:991/1 -GAATAGTGGTAGTATTATTCCTTCTAGGCATAGGAG -+ -IIIIIII""IIIIIIIIII4IIIIIIDII:IEI2:I -@HWI-EAS91_1_30788AAXX:1:1:1716:413/1 -GATCCAAGGCTTTATCAACACCTATTCTGATTCTTC -+ -IIIIIII""IIIIIIIIIIIIIIIIIIIIIIIIIII -@HWI-EAS91_1_30788AAXX:1:1:1630:59/1 -GGAGCGGGGGGTTGGTAAGGTTGGGGTCGAGTATGA -+ -IIIIIII""IIIIIIIIIIIIIIIIIIII;IIHIIF -@HWI-EAS91_1_30788AAXX:1:1:1601:805/1 -GAAAACAGGAAAACAATCCAGTCACTTACCCTATGC -+ -IIIIIII""IIIIIIIIIIIIIIIIIIIIIII@III -@HWI-EAS91_1_30788AAXX:1:1:1663:724/1 -GTTTGCCGGCGCCATCCTACGCTCCATTCCCAACAA -+ -IIIIIII""IIII8IIIIIIHIIII6IIIII1CI=3 -@HWI-EAS91_1_30788AAXX:1:1:1454:975/1 -GCTAGGCGGGAGTGGTAAAAGGCTCAGAAGAAGCCA -+ -IIIIIII""IIIIIIIIIIIIIIIIEIG;IIIIIII -@HWI-EAS91_1_30788AAXX:1:1:1461:255/1 -GTACACCGGCGCCTGAGCCCTACTAATAACTCTCAT -+ -IIIIIII""IIIIII9IIIIIIEI(II9.I4III,I -@HWI-EAS91_1_30788AAXX:1:1:1775:764/1 -GCATCCCGGTAGATCTAATTTTCTAAATCTGTCAAC -+ -IIIIIII""III@IIII+IIIIII8H8IIIIIIICI -@HWI-EAS91_1_30788AAXX:1:1:1269:520/1 -GGAGTATGGAATAAGTGATTTTAGATCGGTTTGTCG -+ -IIIIIII""IIIIIIIIIIIIIIIIIIIIIIIIIII -@HWI-EAS91_1_30788AAXX:1:1:1303:1162/1 -GAGCAAGGGCAGGAGGAGGAGTCCTAGGATGTCTTT -+ -IIIIIII""IIIIFII4*IGIAI(IAII49',3I6I -@HWI-EAS91_1_30788AAXX:1:1:1090:409/1 -GTTTGTTGGGAATGGAGCGTAGGATGGCGTAGGCAA -+ -IIIIIII""IIIIIIIIIIIIIIIIIIIII:IIA8I -@HWI-EAS91_1_30788AAXX:1:1:1336:1000/1 -GGTAAATGGGAAATATTAAGTTTCTGTTTCTAGATC -+ -IIIIIII""IIIIIIIIIIIIIIIIIIIIIIII9II -@HWI-EAS91_1_30788AAXX:1:1:1199:1376/1 -GTTTTCTGGAAAACCTTCACCTATTTATGGGGGTTT -+ -IIIIIII""IIIIIIIIIIIII;III3IIG&:/III -@HWI-EAS91_1_30788AAXX:1:1:1598:1148/1 -GATCAATGGTTTGGATCAATAAGTGATTATATATTT -+ -IIIIIII""IIIIIDIIIIII?IIICII=IHIIIII -@HWI-EAS91_1_30788AAXX:1:1:1723:1459/1 -GAAACCCGGACGTTTGGATGGGCCCGGAGCGAGGAT -+ -IIIIIII""IIIIIIIIDIIIIIIIII9HII-II=I -@HWI-EAS91_1_30788AAXX:1:1:1442:1346/1 -TATCAAGGGGCTGCTTCGAATCCGAAGTGGTGGCTG -+ -IIIIIII""IIIIIDIIIII1I(I4IIphiX174 -GAGTTTTATCGCTTCCATGACGCAGAAGTTAACACTTTCGGATATTTCTGATGAGTCGAAAAATTATCTT -GATAAAGCAGGAATTACTACTGCTTGTTTACGAATTAAATCGAAGTGGACTGCTGGCGGAAAATGAGAAA -ATTCGACCTATCCTTGCGCAGCTCGAGAAGCTCTTACTTTGCGACCTTTCGCCATCAACTAACGATTCTG -TCAAAAACTGACGCGTTGGATGAGGAGAAGTGGCTTAATATGCTTGGCACGTTCGTCAAGGACTGGTTTA -GATATGAGTCACATTTTGTTCATGGTAGAGATTCTCTTGTTGACATTTTAAAAGAGCGTGGATTACTATC -TGAGTCCGATGCTGTTCAACCACTAATAGGTAAGAAATCATGAGTCAAGTTACTGAACAATCCGTACGTT -TCCAGACCGCTTTGGCCTCTATTAAGCTCATTCAGGCTTCTGCCGTTTTGGATTTAACCGAAGATGATTT -CGATTTTCTGACGAGTAACAAAGTTTGGATTGCTACTGACCGCTCTCGTGCTCGTCGCTGCGTTGAGGCT -TGCGTTTATGGTACGCTGGACTTTGTGGGATACCCTCGCTTTCCTGCTCCTGTTGAGTTTATTGCTGCCG -TCATTGCTTATTATGTTCATCCCGTCAACATTCAAACGGCCTGTCTCATCATGGAAGGCGCTGAATTTAC -GGAAAACATTATTAATGGCGTCGAGCGTCCGGTTAAAGCCGCTGAATTGTTCGCGTTTACCTTGCGTGTA -CGCGCAGGAAACACTGACGTTCTTACTGACGCAGAAGAAAACGTGCGTCAAAAATTACGTGCAGAAGGAG -TGATGTAATGTCTAAAGGTAAAAAACGTTCTGGCGCTCGCCCTGGTCGTCCGCAGCCGTTGCGAGGTACT -AAAGGCAAGCGTAAAGGCGCTCGTCTTTGGTATGTAGGTGGTCAACAATTTTAATTGCAGGGGCTTCGGC -CCCTTACTTGAGGATAAATTATGTCTAATATTCAAACTGGCGCCGAGCGTATGCCGCATGACCTTTCCCA -TCTTGGCTTCCTTGCTGGTCAGATTGGTCGTCTTATTACCATTTCAACTACTCCGGTTATCGCTGGCGAC -TCCTTCGAGATGGACGCCGTTGGCGCTCTCCGTCTTTCTCCATTGCGTCGTGGCCTTGCTATTGACTCTA -CTGTAGACATTTTTACTTTTTATGTCCCTCATCGTCACGTTTATGGTGAACAGTGGATTAAGTTCATGAA -GGATGGTGTTAATGCCACTCCTCTCCCGACTGTTAACACTACTGGTTATATTGACCATGCCGCTTTTCTT -GGCACGATTAACCCTGATACCAATAAAATCCCTAAGCATTTGTTTCAGGGTTATTTGAATATCTATAACA -ACTATTTTAAAGCGCCGTGGATGCCTGACCGTACCGAGGCTAACCCTAATGAGCTTAATCAAGATGATGC -TCGTTATGGTTTCCGTTGCTGCCATCTCAAAAACATTTGGACTGCTCCGCTTCCTCCTGAGACTGAGCTT -TCTCGCCAAATGACGACTTCTACCACATCTATTGACATTATGGGTCTGCAAGCTGCTTATGCTAATTTGC -ATACTGACCAAGAACGTGATTACTTCATGCAGCGTTACCGTGATGTTATTTCTTCATTTGGAGGTAAAAC -CTCTTATGACGCTGACAACCGTCCTTTACTTGTCATGCGCTCTAATCTCTGGGCATCTGGCTATGATGTT -GATGGAACTGACCAAACGTCGTTAGGCCAGTTTTCTGGTCGTGTTCAACAGACCTATAAACATTCTGTGC -CGCGTTTCTTTGTTCCTGAGCATGGCACTATGTTTACTCTTGCGCTTGTTCGTTTTCCGCCTACTGCGAC -TAAAGAGATTCAGTACCTTAACGCTAAAGGTGCTTTGACTTATACCGATATTGCTGGCGACCCTGTTTTG -TATGGCAACTTGCCGCCGCGTGAAATTTCTATGAAGGATGTTTTCCGTTCTGGTGATTCGTCTAAGAAGT -TTAAGATTGCTGAGGGTCAGTGGTATCGTTATGCGCCTTCGTATGTTTCTCCTGCTTATCACCTTCTTGA -AGGCTTCCCATTCATTCAGGAACCGCCTTCTGGTGATTTGCAAGAACGCGTACTTATTCGCCACCATGAT -TATGACCAGTGTTTCCAGTCCGTTCAGTTGTTGCAGTGGAATAGTCAGGTTAAATTTAATGTGACCGTTT -ATCGCAATCTGCCGACCACTCGCGATTCAATCATGACTTCGTGATAAAAGATTGAGTGTGAGGTTATAAC -GCCGAAGCGGTAAAAATTTTAATTTTTGCCGCTGAGGGGTTGACCAAGCGAAGCGCGGTAGGTTTTCTGC -TTAGGAGTTTAATCATGTTTCAGACTTTTATTTCTCGCCATAATTCAAACTTTTTTTCTGATAAGCTGGT -TCTCACTTCTGTTACTCCAGCTTCTTCGGCACCTGTTTTACAGACACCTAAAGCTACATCGTCAACGTTA -TATTTTGATAGTTTGACGGTTAATGCTGGTAATGGTGGTTTTCTTCATTGCATTCAGATGGATACATCTG -TCAACGCCGCTAATCAGGTTGTTTCTGTTGGTGCTGATATTGCTTTTGATGCCGACCCTAAATTTTTTGC -CTGTTTGGTTCGCTTTGAGTCTTCTTCGGTTCCGACTACCCTCCCGACTGCCTATGATGTTTATCCTTTG -AATGGTCGCCATGATGGTGGTTATTATACCGTCAAGGACTGTGTGACTATTGACGTCCTTCCCCGTACGC -CGGGCAATAATGTTTATGTTGGTTTCATGGTTTGGTCTAACTTTACCGCTACTAAATGCCGCGGATTGGT -TTCGCTGAATCAGGTTATTAAAGAGATTATTTGTCTCCAGCCACTTAAGTGAGGTGATTTATGTTTGGTG -CTATTGCTGGCGGTATTGCTTCTGCTCTTGCTGGTGGCGCCATGTCTAAATTGTTTGGAGGCGGTCAAAA -AGCCGCCTCCGGTGGCATTCAAGGTGATGTGCTTGCTACCGATAACAATACTGTAGGCATGGGTGATGCT -GGTATTAAATCTGCCATTCAAGGCTCTAATGTTCCTAACCCTGATGAGGCCGCCCCTAGTTTTGTTTCTG -GTGCTATGGCTAAAGCTGGTAAAGGACTTCTTGAAGGTACGTTGCAGGCTGGCACTTCTGCCGTTTCTGA -TAAGTTGCTTGATTTGGTTGGACTTGGTGGCAAGTCTGCCGCTGATAAAGGAAAGGATACTCGTGATTAT -CTTGCTGCTGCATTTCCTGAGCTTAATGCTTGGGAGCGTGCTGGTGCTGATGCTTCCTCTGCTGGTATGG -TTGACGCCGGATTTGAGAATCAAAAAGAGCTTACTAAAATGCAACTGGACAATCAGAAAGAGATTGCCGA -GATGCAAAATGAGACTCAAAAAGAGATTGCTGGCATTCAGTCGGCGACTTCACGCCAGAATACGAAAGAC -CAGGTATATGCACAAAATGAGATGCTTGCTTATCAACAGAAGGAGTCTACTGCTCGCGTTGCGTCTATTA -TGGAAAACACCAATCTTTCCAAGCAACAGCAGGTTTCCGAGATTATGCGCCAAATGCTTACTCAAGCTCA -AACGGCTGGTCAGTATTTTACCAATGACCAAATCAAAGAAATGACTCGCAAGGTTAGTGCTGAGGTTGAC -TTAGTTCATCAGCAAACGCAGAATCAGCGGTATGGCTCTTCTCATATTGGCGCTACTGCAAAGGATATTT -CTAATGTCGTCACTGATGCTGCTTCTGGTGTGGTTGATATTTTTCATGGTATTGATAAAGCTGTTGCCGA -TACTTGGAACAATTTCTGGAAAGACGGTAAAGCTGATGGTATTGGCTCTAATTTGTCTAGGAAATAACCG -TCAGGATTGACACCCTCCCAATTGTATGTTTTCATGCCTCCAAATCTTGGAGGCTTTTTTATGGTTCGTT -CTTATTACCCTTCTGAATGTCACGCTGATTATTTTGACTTTGAGCGTATCGAGGCTCTTAAACCTGCTAT -TGAGGCTTGTGGCATTTCTACTCTTTCTCAATCCCCAATGCTTGGCTTCCATAAGCAGATGGATAACCGC -ATCAAGCTCTTGGAAGAGATTCTGTCTTTTCGTATGCAGGGCGTTGAGTTCGATAATGGTGATATGTATG -TTGACGGCCATAAGGCTGCTTCTGACGTTCGTGATGAGTTTGTATCTGTTACTGAGAAGTTAATGGATGA -ATTGGCACAATGCTACAATGTGCTCCCCCAACTTGATATTAATAACACTATAGACCACCGCCCCGAAGGG -GACGAAAAATGGTTTTTAGAGAACGAGAAGACGGTTACGCAGTTTTGCCGCAAGCTGGCTGCTGAACGCC -CTCTTAAGGATATTCGCGATGAGTATAATTACCCCAAAAAGAAAGGTATTAAGGATGAGTGTTCAAGATT -GCTGGAGGCCTCCACTATGAAATCGCGTAGAGGCTTTACTATTCAGCGTTTGATGAATGCAATGCGACAG -GCTCATGCTGATGGTTGGTTTATCGTTTTTGACACTCTCACGTTGGCTGACGACCGATTAGAGGCGTTTT -ATGATAATCCCAATGCTTTGCGTGACTATTTTCGTGATATTGGTCGTATGGTTCTTGCTGCCGAGGGTCG -CAAGGCTAATGATTCACACGCCGACTGCTATCAGTATTTTTGTGTGCCTGAGTATGGTACAGCTAATGGC -CGTCTTCATTTCCATGCGGTGCATTTTATGCGGACACTTCCTACAGGTAGCGTTGACCCTAATTTTGGTC -GTCGGGTACGCAATCGCCGCCAGTTAAATAGCTTGCAAAATACGTGGCCTTATGGTTACAGTATGCCCAT -CGCAGTTCGCTACACGCAGGACGCTTTTTCACGTTCTGGTTGGTTGTGGCCTGTTGATGCTAAAGGTGAG -CCGCTTAAAGCTACCAGTTATATGGCTGTTGGTTTCTATGTGGCTAAATACGTTAACAAAAAGTCAGATA -TGGACCTTGCTGCTAAAGGTCTAGGAGCTAAAGAATGGAACAACTCACTAAAAACCAAGCTGTCGCTACT -TCCCAAGAAGCTGTTCAGAATCAGAATGAGCCGCAACTTCGGGATGAAAATGCTCACAATGACAAATCTG -TCCACGGAGTGCTTAATCCAACTTACCAAGCTGGGTTACGACGCGACGCCGTTCAACCAGATATTGAAGC -AGAACGCAAAAAGAGAGATGAGATTGAGGCTGGGAAAAGTTACTGTAGCCGACGTTTTGGCGGCGCAACC -TGTGACGACAAATCTGCTCAAATTTATGCGCGCTTCGATAAAAATGATTGGCGTATCCAACCTGCA - diff -r c0267c5fbc65 -r a2b0620733e3 bowtie_remove_rrna_wrapper/tool-data/bowtie_indices.loc --- a/bowtie_remove_rrna_wrapper/tool-data/bowtie_indices.loc Wed Feb 23 13:30:20 2022 +0000 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,1 +0,0 @@ -Mouse_rRNA Mouse_rRNA Mouse_rRNA /home/DATA/galaxy/galaxy-dist/data/indexes/bowtie_rrna_indexes/Mouse_rRNA/bowtie_rrna_indexes/mouse_rRNA_index diff -r c0267c5fbc65 -r a2b0620733e3 bowtie_remove_rrna_wrapper/tool_data_table_conf.xml.sample --- a/bowtie_remove_rrna_wrapper/tool_data_table_conf.xml.sample Wed Feb 23 13:30:20 2022 +0000 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,8 +0,0 @@ - - - - value, dbkey, name, path - -
-
-