# HG changeset patch # User triasteran # Date 1645624787 0 # Node ID ba9beeff5ad0fd99e662c16fb9e37efa9e237273 # Parent 88af3644020bf84bcfd050aecff6e6a0efd9dcb3 Uploaded diff -r 88af3644020b -r ba9beeff5ad0 bowtie_remove_rrna_wrapper/.hgignore --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/bowtie_remove_rrna_wrapper/.hgignore Wed Feb 23 13:59:47 2022 +0000 @@ -0,0 +1,2 @@ +syntax: glob +.idea diff -r 88af3644020b -r ba9beeff5ad0 bowtie_remove_rrna_wrapper/bowtie_indices.loc.sample --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/bowtie_remove_rrna_wrapper/bowtie_indices.loc.sample Wed Feb 23 13:59:47 2022 +0000 @@ -0,0 +1,1 @@ +Mouse_rRNA Mouse_rRNA Mouse_rRNA /home/DATA/galaxy/galaxy-dist/data/indexes/bowtie_rrna_indexes/Mouse_rRNA/bowtie_rrna_indexes/mouse_rRNA_index diff -r 88af3644020b -r ba9beeff5ad0 bowtie_remove_rrna_wrapper/bowtie_remove_rrna_wrapper.xml --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/bowtie_remove_rrna_wrapper/bowtie_remove_rrna_wrapper.xml Wed Feb 23 13:59:47 2022 +0000 @@ -0,0 +1,681 @@ + + + bowtie + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + (( + singlePaired['sPaired'] == "single" and + singlePaired['sParams']['sSettingsType'] == "full" and + singlePaired['sParams']['sMaxFile'] is True + ) or ( + singlePaired['sPaired'] == "paired" and + singlePaired['pParams']['pSettingsType'] == "full" and + singlePaired['pParams']['pMaxFile'] is True + )) + + + + + + + + + + + + + + + + singlePaired['sPaired'] == "paired" + singlePaired['pParams']['pSettingsType'] == "full" + singlePaired['pParams']['pMaxFile'] is True + + + + + + + + + + + + + + + + (( + singlePaired['sPaired'] == "single" and + singlePaired['sParams']['sSettingsType'] == "full" and + singlePaired['sParams']['sUnmappedFile'] is True + ) or ( + singlePaired['sPaired'] == "paired" and + singlePaired['pParams']['pSettingsType'] == "full" and + singlePaired['pParams']['pUnmappedFile'] is True + )) + + + + + + + + + + + + + + + + singlePaired['sPaired'] == "paired" + singlePaired['pParams']['pSettingsType'] == "full" + singlePaired['pParams']['pUnmappedFile'] is True + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + +@misc{githubbowtie, + author = {LastTODO, FirstTODO}, + year = {TODO}, + title = {bowtie}, + publisher = {GitHub}, + journal = {GitHub repository}, + url = {https://github.com/BenLangmead/bowtie}, +} + + diff -r 88af3644020b -r ba9beeff5ad0 bowtie_remove_rrna_wrapper/bowtie_wrapper.py --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/bowtie_remove_rrna_wrapper/bowtie_wrapper.py Wed Feb 23 13:59:47 2022 +0000 @@ -0,0 +1,469 @@ +#!/usr/bin/env python + +""" +Runs Bowtie on single-end or paired-end data. +For use with Bowtie v. 0.12.7 + +usage: bowtie_wrapper.py [options] + -t, --threads=t: The number of threads to run + -o, --output=o: The output file + --output_unmapped_reads=: File name for unmapped reads (single-end) + --output_unmapped_reads_l=: File name for unmapped reads (left, paired-end) + --output_unmapped_reads_r=: File name for unmapped reads (right, paired-end) + --output_suppressed_reads=: File name for suppressed reads because of max setting (single-end) + --output_suppressed_reads_l=: File name for suppressed reads because of max setting (left, paired-end) + --output_suppressed_reads_r=: File name for suppressed reads because of max setting (right, paired-end) + -i, --input1=i: The (forward or single-end) reads file in Sanger FASTQ format + -I, --input2=I: The reverse reads file in Sanger FASTQ format + -4, --dataType=4: The type of data (SOLiD or Solexa) + -2, --paired=2: Whether the data is single- or paired-end + -g, --genomeSource=g: The type of reference provided + -r, --ref=r: The reference genome to use or index + -s, --skip=s: Skip the first n reads + -a, --alignLimit=a: Only align the first n reads + -T, --trimH=T: Trim n bases from high-quality (left) end of each read before alignment + -L, --trimL=L: Trim n bases from low-quality (right) end of each read before alignment + -m, --mismatchSeed=m: Maximum number of mismatches permitted in the seed + -M, --mismatchQual=M: Maximum permitted total of quality values at mismatched read positions + -l, --seedLen=l: Seed length + -n, --rounding=n: Whether or not to round to the nearest 10 and saturating at 30 + -P, --maqSoapAlign=P: Choose MAQ- or SOAP-like alignment policy + -w, --tryHard=: Whether or not to try as hard as possible to find valid alignments when they exist + -v, --valAlign=v: Report up to n valid arguments per read + -V, --allValAligns=V: Whether or not to report all valid alignments per read + -G, --suppressAlign=G: Suppress all alignments for a read if more than n reportable alignments exist + -b, --best=b: Whether or not to make Bowtie guarantee that reported singleton alignments are 'best' in terms of stratum and in terms of the quality values at the mismatched positions + -B, --maxBacktracks=B: Maximum number of backtracks permitted when aligning a read + -R, --strata=R: Whether or not to report only those alignments that fall in the best stratum if many valid alignments exist and are reportable + -j, --minInsert=j: Minimum insert size for valid paired-end alignments + -J, --maxInsert=J: Maximum insert size for valid paired-end alignments + -O, --mateOrient=O: The upstream/downstream mate orientation for valid paired-end alignment against the forward reference strand + -A, --maxAlignAttempt=A: Maximum number of attempts Bowtie will make to match an alignment for one mate with an alignment for the opposite mate + -f, --forwardAlign=f: Whether or not to attempt to align the forward reference strand + -E, --reverseAlign=E: Whether or not to attempt to align the reverse-complement reference strand + -F, --offrate=F: Override the offrate of the index to n + -8, --snpphred=8: SNP penalty on Phred scale + -6, --snpfrac=6: Fraction of sites expected to be SNP sites + -7, --keepends=7: Keep extreme-end nucleotides and qualities + -S, --seed=S: Seed for pseudo-random number generator + -C, --params=C: Whether to use default or specified parameters + -u, --iautoB=u: Automatic or specified behavior + -K, --ipacked=K: Whether or not to use a packed representation for DNA strings + -Q, --ibmax=Q: Maximum number of suffixes allowed in a block + -Y, --ibmaxdivn=Y: Maximum number of suffixes allowed in a block as a fraction of the length of the reference + -D, --idcv=D: The period for the difference-cover sample + -U, --inodc=U: Whether or not to disable the use of the difference-cover sample + -y, --inoref=y: Whether or not to build the part of the reference index used only in paired-end alignment + -z, --ioffrate=z: How many rows get marked during annotation of some or all of the Burrows-Wheeler rows + -W, --iftab=W: The size of the lookup table used to calculate an initial Burrows-Wheeler range with respect to the first n characters of the query + -X, --intoa=X: Whether or not to convert Ns in the reference sequence to As + -N, --iendian=N: Endianness to use when serializing integers to the index file + -Z, --iseed=Z: Seed for the pseudorandom number generator + -c, --icutoff=c: Number of first bases of the reference sequence to index + -x, --indexSettings=x: Whether or not indexing options are to be set + -H, --suppressHeader=H: Suppress header + --do_not_build_index: Flag to specify that provided file is already indexed and to just use 'as is' +""" + +import optparse, os, shutil, subprocess, sys, tempfile + +#Allow more than Sanger encoded variants +DEFAULT_ASCII_ENCODING = '--phred33-quals' +GALAXY_FORMAT_TO_QUALITY_SCORE_ENCODING_ARG = { 'fastqsanger':'--phred33-quals', 'fastqillumina':'--phred64-quals', 'fastqsolexa':'--solexa-quals' } +#FIXME: Integer quality scores are supported only when the '--integer-quals' argument is specified to bowtie; this is not currently able to be set in the tool/wrapper/config + +def stop_err( msg ): + sys.stderr.write( '%s\n' % msg ) + sys.exit() + +def __main__(): + #Parse Command Line + parser = optparse.OptionParser() + parser.add_option( '-t', '--threads', dest='threads', help='The number of threads to run' ) + parser.add_option( '-o', '--output', dest='output', help='The output file' ) + parser.add_option( '', '--output_unmapped_reads', dest='output_unmapped_reads', help='File name for unmapped reads (single-end)' ) + parser.add_option( '', '--output_unmapped_reads_l', dest='output_unmapped_reads_l', help='File name for unmapped reads (left, paired-end)' ) + parser.add_option( '', '--output_unmapped_reads_r', dest='output_unmapped_reads_r', help='File name for unmapped reads (right, paired-end)' ) + parser.add_option( '', '--output_suppressed_reads', dest='output_suppressed_reads', help='File name for suppressed reads because of max setting (single-end)' ) + parser.add_option( '', '--output_suppressed_reads_l', dest='output_suppressed_reads_l', help='File name for suppressed reads because of max setting (left, paired-end)' ) + parser.add_option( '', '--output_suppressed_reads_r', dest='output_suppressed_reads_r', help='File name for suppressed reads because of max setting (right, paired-end)' ) + parser.add_option( '-4', '--dataType', dest='dataType', help='The type of data (SOLiD or Solexa)' ) + parser.add_option( '-i', '--input1', dest='input1', help='The (forward or single-end) reads file in Sanger FASTQ format' ) + parser.add_option( '-I', '--input2', dest='input2', help='The reverse reads file in Sanger FASTQ format' ) + parser.add_option( '-2', '--paired', dest='paired', help='Whether the data is single- or paired-end' ) + parser.add_option( '-g', '--genomeSource', dest='genomeSource', help='The type of reference provided' ) + parser.add_option( '-r', '--ref', dest='ref', help='The reference genome to use or index' ) + parser.add_option( '-s', '--skip', dest='skip', help='Skip the first n reads' ) + parser.add_option( '-a', '--alignLimit', dest='alignLimit', help='Only align the first n reads' ) + parser.add_option( '-T', '--trimH', dest='trimH', help='Trim n bases from high-quality (left) end of each read before alignment' ) + parser.add_option( '-L', '--trimL', dest='trimL', help='Trim n bases from low-quality (right) end of each read before alignment' ) + parser.add_option( '-m', '--mismatchSeed', dest='mismatchSeed', help='Maximum number of mismatches permitted in the seed' ) + parser.add_option( '-M', '--mismatchQual', dest='mismatchQual', help='Maximum permitted total of quality values at mismatched read positions' ) + parser.add_option( '-l', '--seedLen', dest='seedLen', help='Seed length' ) + parser.add_option( '-n', '--rounding', dest='rounding', help='Whether or not to round to the nearest 10 and saturating at 30' ) + parser.add_option( '-P', '--maqSoapAlign', dest='maqSoapAlign', help='Choose MAQ- or SOAP-like alignment policy' ) + parser.add_option( '-w', '--tryHard', dest='tryHard', help='Whether or not to try as hard as possible to find valid alignments when they exist' ) + parser.add_option( '-v', '--valAlign', dest='valAlign', help='Report up to n valid arguments per read' ) + parser.add_option( '-V', '--allValAligns', dest='allValAligns', help='Whether or not to report all valid alignments per read' ) + parser.add_option( '-G', '--suppressAlign', dest='suppressAlign', help='Suppress all alignments for a read if more than n reportable alignments exist' ) + parser.add_option( '-b', '--best', dest='best', help="Whether or not to make Bowtie guarantee that reported singleton alignments are 'best' in terms of stratum and in terms of the quality values at the mismatched positions" ) + parser.add_option( '-B', '--maxBacktracks', dest='maxBacktracks', help='Maximum number of backtracks permitted when aligning a read' ) + parser.add_option( '-R', '--strata', dest='strata', help='Whether or not to report only those alignments that fall in the best stratum if many valid alignments exist and are reportable' ) + parser.add_option( '-j', '--minInsert', dest='minInsert', help='Minimum insert size for valid paired-end alignments' ) + parser.add_option( '-J', '--maxInsert', dest='maxInsert', help='Maximum insert size for valid paired-end alignments' ) + parser.add_option( '-O', '--mateOrient', dest='mateOrient', help='The upstream/downstream mate orientation for valid paired-end alignment against the forward reference strand' ) + parser.add_option( '-A', '--maxAlignAttempt', dest='maxAlignAttempt', help='Maximum number of attempts Bowtie will make to match an alignment for one mate with an alignment for the opposite mate' ) + parser.add_option( '-f', '--forwardAlign', dest='forwardAlign', help='Whether or not to attempt to align the forward reference strand' ) + parser.add_option( '-E', '--reverseAlign', dest='reverseAlign', help='Whether or not to attempt to align the reverse-complement reference strand' ) + parser.add_option( '-F', '--offrate', dest='offrate', help='Override the offrate of the index to n' ) + parser.add_option( '-S', '--seed', dest='seed', help='Seed for pseudo-random number generator' ) + parser.add_option( '-8', '--snpphred', dest='snpphred', help='SNP penalty on Phred scale' ) + parser.add_option( '-6', '--snpfrac', dest='snpfrac', help='Fraction of sites expected to be SNP sites' ) + parser.add_option( '-7', '--keepends', dest='keepends', help='Keep extreme-end nucleotides and qualities' ) + parser.add_option( '-C', '--params', dest='params', help='Whether to use default or specified parameters' ) + parser.add_option( '-u', '--iautoB', dest='iautoB', help='Automatic or specified behavior' ) + parser.add_option( '-K', '--ipacked', dest='ipacked', help='Whether or not to use a packed representation for DNA strings' ) + parser.add_option( '-Q', '--ibmax', dest='ibmax', help='Maximum number of suffixes allowed in a block' ) + parser.add_option( '-Y', '--ibmaxdivn', dest='ibmaxdivn', help='Maximum number of suffixes allowed in a block as a fraction of the length of the reference' ) + parser.add_option( '-D', '--idcv', dest='idcv', help='The period for the difference-cover sample' ) + parser.add_option( '-U', '--inodc', dest='inodc', help='Whether or not to disable the use of the difference-cover sample' ) + parser.add_option( '-y', '--inoref', dest='inoref', help='Whether or not to build the part of the reference index used only in paired-end alignment' ) + parser.add_option( '-z', '--ioffrate', dest='ioffrate', help='How many rows get marked during annotation of some or all of the Burrows-Wheeler rows' ) + parser.add_option( '-W', '--iftab', dest='iftab', help='The size of the lookup table used to calculate an initial Burrows-Wheeler range with respect to the first n characters of the query' ) + parser.add_option( '-X', '--intoa', dest='intoa', help='Whether or not to convert Ns in the reference sequence to As' ) + parser.add_option( '-N', '--iendian', dest='iendian', help='Endianness to use when serializing integers to the index file' ) + parser.add_option( '-Z', '--iseed', dest='iseed', help='Seed for the pseudorandom number generator' ) + parser.add_option( '-c', '--icutoff', dest='icutoff', help='Number of first bases of the reference sequence to index' ) + parser.add_option( '-x', '--indexSettings', dest='index_settings', help='Whether or not indexing options are to be set' ) + parser.add_option( '-H', '--suppressHeader', dest='suppressHeader', help='Suppress header' ) + parser.add_option( '--galaxy_input_format', dest='galaxy_input_format', default="fastqsanger", help='galaxy input format' ) + parser.add_option( '--do_not_build_index', dest='do_not_build_index', action="store_true", default=False, help='Flag to specify that provided file is already indexed, use as is' ) + (options, args) = parser.parse_args() + stdout = '' + + # make temp directory for placement of indices and copy reference file there if necessary + tmp_index_dir = tempfile.mkdtemp() + # get type of data (solid or solexa) + if options.dataType == 'solid': + colorspace = '-C' + else: + colorspace = '' + # index if necessary + if options.genomeSource == 'history' and not options.do_not_build_index: + # set up commands + if options.index_settings =='indexPreSet': + indexing_cmds = '%s' % colorspace + else: + try: + if options.iautoB and options.iautoB == 'set': + iautoB = '--noauto' + else: + iautoB = '' + if options. ipacked and options.ipacked == 'packed': + ipacked = '--packed' + else: + ipacked = '' + if options.ibmax and int( options.ibmax ) >= 1: + ibmax = '--bmax %s' % options.ibmax + else: + ibmax = '' + if options.ibmaxdivn and int( options.ibmaxdivn ) >= 0: + ibmaxdivn = '--bmaxdivn %s' % options.ibmaxdivn + else: + ibmaxdivn = '' + if options.idcv and int( options.idcv ) > 0: + idcv = '--dcv %s' % options.idcv + else: + idcv = '' + if options.inodc and options.inodc == 'nodc': + inodc = '--nodc' + else: + inodc = '' + if options.inoref and options.inoref == 'noref': + inoref = '--noref' + else: + inoref = '' + if options.iftab and int( options.iftab ) >= 0: + iftab = '--ftabchars %s' % options.iftab + else: + iftab = '' + if options.intoa and options.intoa == 'yes': + intoa = '--ntoa' + else: + intoa = '' + if options.iendian and options.iendian == 'big': + iendian = '--big' + else: + iendian = '--little' + if options.iseed and int( options.iseed ) > 0: + iseed = '--seed %s' % options.iseed + else: + iseed = '' + if options.icutoff and int( options.icutoff ) > 0: + icutoff = '--cutoff %s' % options.icutoff + else: + icutoff = '' + indexing_cmds = '%s %s %s %s %s %s %s --offrate %s %s %s %s %s %s %s' % \ + ( iautoB, ipacked, ibmax, ibmaxdivn, idcv, inodc, + inoref, options.ioffrate, iftab, intoa, iendian, + iseed, icutoff, colorspace ) + except ValueError, e: + # clean up temp dir + if os.path.exists( tmp_index_dir ): + shutil.rmtree( tmp_index_dir ) + stop_err( "Something is wrong with the indexing parameters and the indexing and alignment could not be run. Make sure you don't have any non-numeric values where they should be numeric.\n" + str( e ) ) + ref_file = tempfile.NamedTemporaryFile( dir=tmp_index_dir ) + ref_file_name = ref_file.name + ref_file.close() + os.symlink( options.ref, ref_file_name ) + cmd1 = 'bowtie-build %s -f %s %s' % ( indexing_cmds, ref_file_name, ref_file_name ) + try: + tmp = tempfile.NamedTemporaryFile( dir=tmp_index_dir ).name + tmp_stderr = open( tmp, 'wb' ) + proc = subprocess.Popen( args=cmd1, shell=True, cwd=tmp_index_dir, stderr=tmp_stderr.fileno() ) + returncode = proc.wait() + tmp_stderr.close() + # get stderr, allowing for case where it's very large + tmp_stderr = open( tmp, 'rb' ) + stderr = '' + buffsize = 1048576 + try: + while True: + stderr += tmp_stderr.read( buffsize ) + if not stderr or len( stderr ) % buffsize != 0: + break + except OverflowError: + pass + tmp_stderr.close() + if returncode != 0: + raise (Exception, stderr) + except Exception, e: + # clean up temp dir + if os.path.exists( tmp_index_dir ): + shutil.rmtree( tmp_index_dir ) + stop_err( 'Error indexing reference sequence\n' + str( e ) ) + stdout += 'File indexed. ' + else: + ref_file_name = options.ref + # set up aligning and generate aligning command options + # automatically set threads in both cases + tmp_suppressed_file_name = None + tmp_unmapped_file_name = None + if options.suppressHeader == 'true': + suppressHeader = '--sam-nohead' + else: + suppressHeader = '' + if options.maxInsert and int( options.maxInsert ) > 0: + maxInsert = '-X %s' % options.maxInsert + else: + maxInsert = '' + if options.mateOrient: + mateOrient = '--%s' % options.mateOrient + else: + mateOrient = '' + quality_score_encoding = GALAXY_FORMAT_TO_QUALITY_SCORE_ENCODING_ARG.get( options.galaxy_input_format, DEFAULT_ASCII_ENCODING ) + if options.params == 'preSet': + aligning_cmds = '-q %s %s -p %s -S %s %s %s ' % \ + ( maxInsert, mateOrient, options.threads, suppressHeader, colorspace, quality_score_encoding ) + else: + try: + if options.skip and int( options.skip ) > 0: + skip = '-s %s' % options.skip + else: + skip = '' + if options.alignLimit and int( options.alignLimit ) >= 0: + alignLimit = '-u %s' % options.alignLimit + else: + alignLimit = '' + if options.trimH and int( options.trimH ) > 0: + trimH = '-5 %s' % options.trimH + else: + trimH = '' + if options.trimL and int( options.trimL ) > 0: + trimL = '-3 %s' % options.trimL + else: + trimL = '' + if options.maqSoapAlign != '-1' and int( options.maqSoapAlign ) >= 0: + maqSoapAlign = '-v %s' % options.maqSoapAlign + else: + maqSoapAlign = '' + if options.mismatchSeed and (options.mismatchSeed == '0' or options.mismatchSeed == '1' \ + or options.mismatchSeed == '2' or options.mismatchSeed == '3'): + mismatchSeed = '-n %s' % options.mismatchSeed + else: + mismatchSeed = '' + if options.mismatchQual and int( options.mismatchQual ) >= 0: + mismatchQual = '-e %s' % options.mismatchQual + else: + mismatchQual = '' + if options.seedLen and int( options.seedLen ) >= 5: + seedLen = '-l %s' % options.seedLen + else: + seedLen = '' + if options.rounding == 'noRound': + rounding = '--nomaqround' + else: + rounding = '' + if options.minInsert and int( options.minInsert ) > 0: + minInsert = '-I %s' % options.minInsert + else: + minInsert = '' + if options.maxAlignAttempt and int( options.maxAlignAttempt ) >= 0: + maxAlignAttempt = '--pairtries %s' % options.maxAlignAttempt + else: + maxAlignAttempt = '' + if options.forwardAlign == 'noForward': + forwardAlign = '--nofw' + else: + forwardAlign = '' + if options.reverseAlign == 'noReverse': + reverseAlign = '--norc' + else: + reverseAlign = '' + if options.maxBacktracks and int( options.maxBacktracks ) > 0 and \ + ( options.mismatchSeed == '2' or options.mismatchSeed == '3' ): + maxBacktracks = '--maxbts %s' % options.maxBacktracks + else: + maxBacktracks = '' + if options.tryHard == 'doTryHard': + tryHard = '-y' + else: + tryHard = '' + if options.valAlign and int( options.valAlign ) >= 0: + valAlign = '-k %s' % options.valAlign + else: + valAlign = '' + if options.allValAligns == 'doAllValAligns': + allValAligns = '-a' + else: + allValAligns = '' + if options.suppressAlign and int( options.suppressAlign ) >= 0: + suppressAlign = '-m %s' % options.suppressAlign + else: + suppressAlign = '' + if options.best == 'doBest': + best = '--best' + else: + best = '' + if options.strata == 'doStrata': + strata = '--strata' + else: + strata = '' + if options.offrate and int( options.offrate ) >= 0: + offrate = '-o %s' % options.offrate + else: + offrate = '' + if options.seed and int( options.seed ) >= 0: + seed = '--seed %s' % options.seed + else: + seed = '' + if options.paired == 'paired': + if options.output_unmapped_reads_l and options.output_unmapped_reads_r: + tmp_unmapped_file = tempfile.NamedTemporaryFile( dir=tmp_index_dir, suffix='.fastq' ) + tmp_unmapped_file_name = tmp_unmapped_file.name + tmp_unmapped_file.close() + output_unmapped_reads = '--un %s' % tmp_unmapped_file_name + else: + output_unmapped_reads = '' + if options.output_suppressed_reads: + tmp_suppressed_file = tempfile.NamedTemporaryFile( dir=tmp_index_dir, suffix='.fastq' ) + tmp_suppressed_file_name = tmp_suppressed_file.name + tmp_suppressed_file.close() + output_suppressed_reads = '--max %s' % tmp_suppressed_file_name + else: + output_suppressed_reads = '' + else: + if options.output_unmapped_reads: + output_unmapped_reads = '--un %s' % options.output_unmapped_reads + else: + output_unmapped_reads = '' + if options.output_suppressed_reads: + output_suppressed_reads = '--max %s' % options.output_suppressed_reads + else: + output_suppressed_reads = '' + snpfrac = '' + if options.snpphred and int( options.snpphred ) >= 0: + snpphred = '--snpphred %s' % options.snpphred + else: + snpphred = '' + if options.snpfrac and float( options.snpfrac ) >= 0: + snpfrac = '--snpfrac %s' % options.snpfrac + if options.keepends and options.keepends == 'doKeepends': + keepends = '--col-keepends' + else: + keepends = '' + aligning_cmds = '-q %s %s -p %s -S %s %s %s %s %s %s %s %s %s %s %s %s ' \ + '%s %s %s %s %s %s %s %s %s %s %s %s %s %s %s %s %s %s ' % \ + ( maxInsert, mateOrient, options.threads, suppressHeader, + colorspace, skip, alignLimit, trimH, trimL, maqSoapAlign, + mismatchSeed, mismatchQual, seedLen, rounding, minInsert, + maxAlignAttempt, forwardAlign, reverseAlign, maxBacktracks, + tryHard, valAlign, allValAligns, suppressAlign, best, + strata, offrate, seed, snpphred, snpfrac, keepends, + output_unmapped_reads, output_suppressed_reads, + quality_score_encoding ) + except ValueError, e: + # clean up temp dir + if os.path.exists( tmp_index_dir ): + shutil.rmtree( tmp_index_dir ) + stop_err( 'Something is wrong with the alignment parameters and the alignment could not be run\n' + str( e ) ) + try: + # have to nest try-except in try-finally to handle 2.4 + try: + # prepare actual mapping commands + if options.paired == 'paired': + cmd2 = 'bowtie %s %s -1 %s -2 %s > %s' % ( aligning_cmds, ref_file_name, options.input1, options.input2, options.output ) + else: + cmd2 = 'bowtie %s %s %s > %s' % ( aligning_cmds, ref_file_name, options.input1, options.output ) + # align + tmp = tempfile.NamedTemporaryFile( dir=tmp_index_dir ).name + tmp_stderr = open( tmp, 'wb' ) + proc = subprocess.Popen( args=cmd2, shell=True, cwd=tmp_index_dir, stderr=tmp_stderr.fileno() ) + returncode = proc.wait() + tmp_stderr.close() + # get stderr, allowing for case where it's very large + tmp_stderr = open( tmp, 'rb' ) + stderr = '' + buffsize = 1048576 + try: + while True: + stderr += tmp_stderr.read( buffsize ) + if not stderr or len( stderr ) % buffsize != 0: + break + except OverflowError: + pass + tmp_stderr.close() + if returncode != 0: + raise (Exception, stderr) + # get suppressed and unmapped reads output files in place if appropriate + if options.paired == 'paired' and tmp_suppressed_file_name and \ + options.output_suppressed_reads_l and options.output_suppressed_reads_r: + try: + left = tmp_suppressed_file_name.replace( '.fastq', '_1.fastq' ) + right = tmp_suppressed_file_name.replace( '.fastq', '_1.fastq' ) + shutil.move( left, options.output_suppressed_reads_l ) + shutil.move( right, options.output_suppressed_reads_r ) + except Exception, e: + sys.stdout.write( 'Error producing the suppressed output file.\n' ) + if options.paired == 'paired' and tmp_unmapped_file_name and \ + options.output_unmapped_reads_l and options.output_unmapped_reads_r: + try: + left = tmp_unmapped_file_name.replace( '.fastq', '_1.fastq' ) + right = tmp_unmapped_file_name.replace( '.fastq', '_2.fastq' ) + shutil.move( left, options.output_unmapped_reads_l ) + shutil.move( right, options.output_unmapped_reads_r ) + except Exception, e: + sys.stdout.write( 'Error producing the unmapped output file.\n' ) + # check that there are results in the output file + if os.path.getsize( options.output ) == 0: + raise (Exception, 'The output file is empty, there may be an error with your input file or settings.') + except Exception, e: + stop_err( 'Error aligning sequence. ' + str( e ) ) + finally: + # clean up temp dir + if os.path.exists( tmp_index_dir ): + shutil.rmtree( tmp_index_dir ) + stdout += 'Sequence file aligned.\n' + sys.stdout.write( stdout ) + +if __name__=="__main__": __main__() diff -r 88af3644020b -r ba9beeff5ad0 bowtie_remove_rrna_wrapper/bowtie_wrapper_py3.py --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/bowtie_remove_rrna_wrapper/bowtie_wrapper_py3.py Wed Feb 23 13:59:47 2022 +0000 @@ -0,0 +1,469 @@ +#!/usr/bin/env python + +""" +Runs Bowtie on single-end or paired-end data. +For use with Bowtie v. 0.12.7 + +usage: bowtie_wrapper.py [options] + -t, --threads=t: The number of threads to run + -o, --output=o: The output file + --output_unmapped_reads=: File name for unmapped reads (single-end) + --output_unmapped_reads_l=: File name for unmapped reads (left, paired-end) + --output_unmapped_reads_r=: File name for unmapped reads (right, paired-end) + --output_suppressed_reads=: File name for suppressed reads because of max setting (single-end) + --output_suppressed_reads_l=: File name for suppressed reads because of max setting (left, paired-end) + --output_suppressed_reads_r=: File name for suppressed reads because of max setting (right, paired-end) + -i, --input1=i: The (forward or single-end) reads file in Sanger FASTQ format + -I, --input2=I: The reverse reads file in Sanger FASTQ format + -4, --dataType=4: The type of data (SOLiD or Solexa) + -2, --paired=2: Whether the data is single- or paired-end + -g, --genomeSource=g: The type of reference provided + -r, --ref=r: The reference genome to use or index + -s, --skip=s: Skip the first n reads + -a, --alignLimit=a: Only align the first n reads + -T, --trimH=T: Trim n bases from high-quality (left) end of each read before alignment + -L, --trimL=L: Trim n bases from low-quality (right) end of each read before alignment + -m, --mismatchSeed=m: Maximum number of mismatches permitted in the seed + -M, --mismatchQual=M: Maximum permitted total of quality values at mismatched read positions + -l, --seedLen=l: Seed length + -n, --rounding=n: Whether or not to round to the nearest 10 and saturating at 30 + -P, --maqSoapAlign=P: Choose MAQ- or SOAP-like alignment policy + -w, --tryHard=: Whether or not to try as hard as possible to find valid alignments when they exist + -v, --valAlign=v: Report up to n valid arguments per read + -V, --allValAligns=V: Whether or not to report all valid alignments per read + -G, --suppressAlign=G: Suppress all alignments for a read if more than n reportable alignments exist + -b, --best=b: Whether or not to make Bowtie guarantee that reported singleton alignments are 'best' in terms of stratum and in terms of the quality values at the mismatched positions + -B, --maxBacktracks=B: Maximum number of backtracks permitted when aligning a read + -R, --strata=R: Whether or not to report only those alignments that fall in the best stratum if many valid alignments exist and are reportable + -j, --minInsert=j: Minimum insert size for valid paired-end alignments + -J, --maxInsert=J: Maximum insert size for valid paired-end alignments + -O, --mateOrient=O: The upstream/downstream mate orientation for valid paired-end alignment against the forward reference strand + -A, --maxAlignAttempt=A: Maximum number of attempts Bowtie will make to match an alignment for one mate with an alignment for the opposite mate + -f, --forwardAlign=f: Whether or not to attempt to align the forward reference strand + -E, --reverseAlign=E: Whether or not to attempt to align the reverse-complement reference strand + -F, --offrate=F: Override the offrate of the index to n + -8, --snpphred=8: SNP penalty on Phred scale + -6, --snpfrac=6: Fraction of sites expected to be SNP sites + -7, --keepends=7: Keep extreme-end nucleotides and qualities + -S, --seed=S: Seed for pseudo-random number generator + -C, --params=C: Whether to use default or specified parameters + -u, --iautoB=u: Automatic or specified behavior + -K, --ipacked=K: Whether or not to use a packed representation for DNA strings + -Q, --ibmax=Q: Maximum number of suffixes allowed in a block + -Y, --ibmaxdivn=Y: Maximum number of suffixes allowed in a block as a fraction of the length of the reference + -D, --idcv=D: The period for the difference-cover sample + -U, --inodc=U: Whether or not to disable the use of the difference-cover sample + -y, --inoref=y: Whether or not to build the part of the reference index used only in paired-end alignment + -z, --ioffrate=z: How many rows get marked during annotation of some or all of the Burrows-Wheeler rows + -W, --iftab=W: The size of the lookup table used to calculate an initial Burrows-Wheeler range with respect to the first n characters of the query + -X, --intoa=X: Whether or not to convert Ns in the reference sequence to As + -N, --iendian=N: Endianness to use when serializing integers to the index file + -Z, --iseed=Z: Seed for the pseudorandom number generator + -c, --icutoff=c: Number of first bases of the reference sequence to index + -x, --indexSettings=x: Whether or not indexing options are to be set + -H, --suppressHeader=H: Suppress header + --do_not_build_index: Flag to specify that provided file is already indexed and to just use 'as is' +""" + +import optparse, os, shutil, subprocess, sys, tempfile + +#Allow more than Sanger encoded variants +DEFAULT_ASCII_ENCODING = '--phred33-quals' +GALAXY_FORMAT_TO_QUALITY_SCORE_ENCODING_ARG = { 'fastqsanger':'--phred33-quals', 'fastqillumina':'--phred64-quals', 'fastqsolexa':'--solexa-quals' } +#FIXME: Integer quality scores are supported only when the '--integer-quals' argument is specified to bowtie; this is not currently able to be set in the tool/wrapper/config + +def stop_err( msg ): + sys.stderr.write( '%s\n' % msg ) + sys.exit() + +def __main__(): + #Parse Command Line + parser = optparse.OptionParser() + parser.add_option( '-t', '--threads', dest='threads', help='The number of threads to run' ) + parser.add_option( '-o', '--output', dest='output', help='The output file' ) + parser.add_option( '', '--output_unmapped_reads', dest='output_unmapped_reads', help='File name for unmapped reads (single-end)' ) + parser.add_option( '', '--output_unmapped_reads_l', dest='output_unmapped_reads_l', help='File name for unmapped reads (left, paired-end)' ) + parser.add_option( '', '--output_unmapped_reads_r', dest='output_unmapped_reads_r', help='File name for unmapped reads (right, paired-end)' ) + parser.add_option( '', '--output_suppressed_reads', dest='output_suppressed_reads', help='File name for suppressed reads because of max setting (single-end)' ) + parser.add_option( '', '--output_suppressed_reads_l', dest='output_suppressed_reads_l', help='File name for suppressed reads because of max setting (left, paired-end)' ) + parser.add_option( '', '--output_suppressed_reads_r', dest='output_suppressed_reads_r', help='File name for suppressed reads because of max setting (right, paired-end)' ) + parser.add_option( '-4', '--dataType', dest='dataType', help='The type of data (SOLiD or Solexa)' ) + parser.add_option( '-i', '--input1', dest='input1', help='The (forward or single-end) reads file in Sanger FASTQ format' ) + parser.add_option( '-I', '--input2', dest='input2', help='The reverse reads file in Sanger FASTQ format' ) + parser.add_option( '-2', '--paired', dest='paired', help='Whether the data is single- or paired-end' ) + parser.add_option( '-g', '--genomeSource', dest='genomeSource', help='The type of reference provided' ) + parser.add_option( '-r', '--ref', dest='ref', help='The reference genome to use or index' ) + parser.add_option( '-s', '--skip', dest='skip', help='Skip the first n reads' ) + parser.add_option( '-a', '--alignLimit', dest='alignLimit', help='Only align the first n reads' ) + parser.add_option( '-T', '--trimH', dest='trimH', help='Trim n bases from high-quality (left) end of each read before alignment' ) + parser.add_option( '-L', '--trimL', dest='trimL', help='Trim n bases from low-quality (right) end of each read before alignment' ) + parser.add_option( '-m', '--mismatchSeed', dest='mismatchSeed', help='Maximum number of mismatches permitted in the seed' ) + parser.add_option( '-M', '--mismatchQual', dest='mismatchQual', help='Maximum permitted total of quality values at mismatched read positions' ) + parser.add_option( '-l', '--seedLen', dest='seedLen', help='Seed length' ) + parser.add_option( '-n', '--rounding', dest='rounding', help='Whether or not to round to the nearest 10 and saturating at 30' ) + parser.add_option( '-P', '--maqSoapAlign', dest='maqSoapAlign', help='Choose MAQ- or SOAP-like alignment policy' ) + parser.add_option( '-w', '--tryHard', dest='tryHard', help='Whether or not to try as hard as possible to find valid alignments when they exist' ) + parser.add_option( '-v', '--valAlign', dest='valAlign', help='Report up to n valid arguments per read' ) + parser.add_option( '-V', '--allValAligns', dest='allValAligns', help='Whether or not to report all valid alignments per read' ) + parser.add_option( '-G', '--suppressAlign', dest='suppressAlign', help='Suppress all alignments for a read if more than n reportable alignments exist' ) + parser.add_option( '-b', '--best', dest='best', help="Whether or not to make Bowtie guarantee that reported singleton alignments are 'best' in terms of stratum and in terms of the quality values at the mismatched positions" ) + parser.add_option( '-B', '--maxBacktracks', dest='maxBacktracks', help='Maximum number of backtracks permitted when aligning a read' ) + parser.add_option( '-R', '--strata', dest='strata', help='Whether or not to report only those alignments that fall in the best stratum if many valid alignments exist and are reportable' ) + parser.add_option( '-j', '--minInsert', dest='minInsert', help='Minimum insert size for valid paired-end alignments' ) + parser.add_option( '-J', '--maxInsert', dest='maxInsert', help='Maximum insert size for valid paired-end alignments' ) + parser.add_option( '-O', '--mateOrient', dest='mateOrient', help='The upstream/downstream mate orientation for valid paired-end alignment against the forward reference strand' ) + parser.add_option( '-A', '--maxAlignAttempt', dest='maxAlignAttempt', help='Maximum number of attempts Bowtie will make to match an alignment for one mate with an alignment for the opposite mate' ) + parser.add_option( '-f', '--forwardAlign', dest='forwardAlign', help='Whether or not to attempt to align the forward reference strand' ) + parser.add_option( '-E', '--reverseAlign', dest='reverseAlign', help='Whether or not to attempt to align the reverse-complement reference strand' ) + parser.add_option( '-F', '--offrate', dest='offrate', help='Override the offrate of the index to n' ) + parser.add_option( '-S', '--seed', dest='seed', help='Seed for pseudo-random number generator' ) + parser.add_option( '-8', '--snpphred', dest='snpphred', help='SNP penalty on Phred scale' ) + parser.add_option( '-6', '--snpfrac', dest='snpfrac', help='Fraction of sites expected to be SNP sites' ) + parser.add_option( '-7', '--keepends', dest='keepends', help='Keep extreme-end nucleotides and qualities' ) + parser.add_option( '-C', '--params', dest='params', help='Whether to use default or specified parameters' ) + parser.add_option( '-u', '--iautoB', dest='iautoB', help='Automatic or specified behavior' ) + parser.add_option( '-K', '--ipacked', dest='ipacked', help='Whether or not to use a packed representation for DNA strings' ) + parser.add_option( '-Q', '--ibmax', dest='ibmax', help='Maximum number of suffixes allowed in a block' ) + parser.add_option( '-Y', '--ibmaxdivn', dest='ibmaxdivn', help='Maximum number of suffixes allowed in a block as a fraction of the length of the reference' ) + parser.add_option( '-D', '--idcv', dest='idcv', help='The period for the difference-cover sample' ) + parser.add_option( '-U', '--inodc', dest='inodc', help='Whether or not to disable the use of the difference-cover sample' ) + parser.add_option( '-y', '--inoref', dest='inoref', help='Whether or not to build the part of the reference index used only in paired-end alignment' ) + parser.add_option( '-z', '--ioffrate', dest='ioffrate', help='How many rows get marked during annotation of some or all of the Burrows-Wheeler rows' ) + parser.add_option( '-W', '--iftab', dest='iftab', help='The size of the lookup table used to calculate an initial Burrows-Wheeler range with respect to the first n characters of the query' ) + parser.add_option( '-X', '--intoa', dest='intoa', help='Whether or not to convert Ns in the reference sequence to As' ) + parser.add_option( '-N', '--iendian', dest='iendian', help='Endianness to use when serializing integers to the index file' ) + parser.add_option( '-Z', '--iseed', dest='iseed', help='Seed for the pseudorandom number generator' ) + parser.add_option( '-c', '--icutoff', dest='icutoff', help='Number of first bases of the reference sequence to index' ) + parser.add_option( '-x', '--indexSettings', dest='index_settings', help='Whether or not indexing options are to be set' ) + parser.add_option( '-H', '--suppressHeader', dest='suppressHeader', help='Suppress header' ) + parser.add_option( '--galaxy_input_format', dest='galaxy_input_format', default="fastqsanger", help='galaxy input format' ) + parser.add_option( '--do_not_build_index', dest='do_not_build_index', action="store_true", default=False, help='Flag to specify that provided file is already indexed, use as is' ) + (options, args) = parser.parse_args() + stdout = '' + + # make temp directory for placement of indices and copy reference file there if necessary + tmp_index_dir = tempfile.mkdtemp() + # get type of data (solid or solexa) + if options.dataType == 'solid': + colorspace = '-C' + else: + colorspace = '' + # index if necessary + if options.genomeSource == 'history' and not options.do_not_build_index: + # set up commands + if options.index_settings =='indexPreSet': + indexing_cmds = '%s' % colorspace + else: + try: + if options.iautoB and options.iautoB == 'set': + iautoB = '--noauto' + else: + iautoB = '' + if options. ipacked and options.ipacked == 'packed': + ipacked = '--packed' + else: + ipacked = '' + if options.ibmax and int( options.ibmax ) >= 1: + ibmax = '--bmax %s' % options.ibmax + else: + ibmax = '' + if options.ibmaxdivn and int( options.ibmaxdivn ) >= 0: + ibmaxdivn = '--bmaxdivn %s' % options.ibmaxdivn + else: + ibmaxdivn = '' + if options.idcv and int( options.idcv ) > 0: + idcv = '--dcv %s' % options.idcv + else: + idcv = '' + if options.inodc and options.inodc == 'nodc': + inodc = '--nodc' + else: + inodc = '' + if options.inoref and options.inoref == 'noref': + inoref = '--noref' + else: + inoref = '' + if options.iftab and int( options.iftab ) >= 0: + iftab = '--ftabchars %s' % options.iftab + else: + iftab = '' + if options.intoa and options.intoa == 'yes': + intoa = '--ntoa' + else: + intoa = '' + if options.iendian and options.iendian == 'big': + iendian = '--big' + else: + iendian = '--little' + if options.iseed and int( options.iseed ) > 0: + iseed = '--seed %s' % options.iseed + else: + iseed = '' + if options.icutoff and int( options.icutoff ) > 0: + icutoff = '--cutoff %s' % options.icutoff + else: + icutoff = '' + indexing_cmds = '%s %s %s %s %s %s %s --offrate %s %s %s %s %s %s %s' % \ + ( iautoB, ipacked, ibmax, ibmaxdivn, idcv, inodc, + inoref, options.ioffrate, iftab, intoa, iendian, + iseed, icutoff, colorspace ) + except (ValueError, e): + # clean up temp dir + if os.path.exists( tmp_index_dir ): + shutil.rmtree( tmp_index_dir ) + stop_err( "Something is wrong with the indexing parameters and the indexing and alignment could not be run. Make sure you don't have any non-numeric values where they should be numeric.\n" + str( e ) ) + ref_file = tempfile.NamedTemporaryFile( dir=tmp_index_dir ) + ref_file_name = ref_file.name + ref_file.close() + os.symlink( options.ref, ref_file_name ) + cmd1 = 'bowtie-build %s -f %s %s' % ( indexing_cmds, ref_file_name, ref_file_name ) + try: + tmp = tempfile.NamedTemporaryFile( dir=tmp_index_dir ).name + tmp_stderr = open( tmp, 'wb' ) + proc = subprocess.Popen( args=cmd1, shell=True, cwd=tmp_index_dir, stderr=tmp_stderr.fileno() ) + returncode = proc.wait() + tmp_stderr.close() + # get stderr, allowing for case where it's very large + tmp_stderr = open( tmp, 'rb' ) + stderr = '' + buffsize = 1048576 + try: + while True: + stderr += tmp_stderr.read( buffsize ) + if not stderr or len( stderr ) % buffsize != 0: + break + except OverflowError: + pass + tmp_stderr.close() + if returncode != 0: + raise (Exception, stderr) + except Exception as e: + # clean up temp dir + if os.path.exists( tmp_index_dir ): + shutil.rmtree( tmp_index_dir ) + stop_err( 'Error indexing reference sequence\n' + str( e ) ) + stdout += 'File indexed. ' + else: + ref_file_name = options.ref + # set up aligning and generate aligning command options + # automatically set threads in both cases + tmp_suppressed_file_name = None + tmp_unmapped_file_name = None + if options.suppressHeader == 'true': + suppressHeader = '--sam-nohead' + else: + suppressHeader = '' + if options.maxInsert and int( options.maxInsert ) > 0: + maxInsert = '-X %s' % options.maxInsert + else: + maxInsert = '' + if options.mateOrient: + mateOrient = '--%s' % options.mateOrient + else: + mateOrient = '' + quality_score_encoding = GALAXY_FORMAT_TO_QUALITY_SCORE_ENCODING_ARG.get( options.galaxy_input_format, DEFAULT_ASCII_ENCODING ) + if options.params == 'preSet': + aligning_cmds = '-q %s %s -p %s -S %s %s %s ' % \ + ( maxInsert, mateOrient, options.threads, suppressHeader, colorspace, quality_score_encoding ) + else: + try: + if options.skip and int( options.skip ) > 0: + skip = '-s %s' % options.skip + else: + skip = '' + if options.alignLimit and int( options.alignLimit ) >= 0: + alignLimit = '-u %s' % options.alignLimit + else: + alignLimit = '' + if options.trimH and int( options.trimH ) > 0: + trimH = '-5 %s' % options.trimH + else: + trimH = '' + if options.trimL and int( options.trimL ) > 0: + trimL = '-3 %s' % options.trimL + else: + trimL = '' + if options.maqSoapAlign != '-1' and int( options.maqSoapAlign ) >= 0: + maqSoapAlign = '-v %s' % options.maqSoapAlign + else: + maqSoapAlign = '' + if options.mismatchSeed and (options.mismatchSeed == '0' or options.mismatchSeed == '1' \ + or options.mismatchSeed == '2' or options.mismatchSeed == '3'): + mismatchSeed = '-n %s' % options.mismatchSeed + else: + mismatchSeed = '' + if options.mismatchQual and int( options.mismatchQual ) >= 0: + mismatchQual = '-e %s' % options.mismatchQual + else: + mismatchQual = '' + if options.seedLen and int( options.seedLen ) >= 5: + seedLen = '-l %s' % options.seedLen + else: + seedLen = '' + if options.rounding == 'noRound': + rounding = '--nomaqround' + else: + rounding = '' + if options.minInsert and int( options.minInsert ) > 0: + minInsert = '-I %s' % options.minInsert + else: + minInsert = '' + if options.maxAlignAttempt and int( options.maxAlignAttempt ) >= 0: + maxAlignAttempt = '--pairtries %s' % options.maxAlignAttempt + else: + maxAlignAttempt = '' + if options.forwardAlign == 'noForward': + forwardAlign = '--nofw' + else: + forwardAlign = '' + if options.reverseAlign == 'noReverse': + reverseAlign = '--norc' + else: + reverseAlign = '' + if options.maxBacktracks and int( options.maxBacktracks ) > 0 and \ + ( options.mismatchSeed == '2' or options.mismatchSeed == '3' ): + maxBacktracks = '--maxbts %s' % options.maxBacktracks + else: + maxBacktracks = '' + if options.tryHard == 'doTryHard': + tryHard = '-y' + else: + tryHard = '' + if options.valAlign and int( options.valAlign ) >= 0: + valAlign = '-k %s' % options.valAlign + else: + valAlign = '' + if options.allValAligns == 'doAllValAligns': + allValAligns = '-a' + else: + allValAligns = '' + if options.suppressAlign and int( options.suppressAlign ) >= 0: + suppressAlign = '-m %s' % options.suppressAlign + else: + suppressAlign = '' + if options.best == 'doBest': + best = '--best' + else: + best = '' + if options.strata == 'doStrata': + strata = '--strata' + else: + strata = '' + if options.offrate and int( options.offrate ) >= 0: + offrate = '-o %s' % options.offrate + else: + offrate = '' + if options.seed and int( options.seed ) >= 0: + seed = '--seed %s' % options.seed + else: + seed = '' + if options.paired == 'paired': + if options.output_unmapped_reads_l and options.output_unmapped_reads_r: + tmp_unmapped_file = tempfile.NamedTemporaryFile( dir=tmp_index_dir, suffix='.fastq' ) + tmp_unmapped_file_name = tmp_unmapped_file.name + tmp_unmapped_file.close() + output_unmapped_reads = '--un %s' % tmp_unmapped_file_name + else: + output_unmapped_reads = '' + if options.output_suppressed_reads: + tmp_suppressed_file = tempfile.NamedTemporaryFile( dir=tmp_index_dir, suffix='.fastq' ) + tmp_suppressed_file_name = tmp_suppressed_file.name + tmp_suppressed_file.close() + output_suppressed_reads = '--max %s' % tmp_suppressed_file_name + else: + output_suppressed_reads = '' + else: + if options.output_unmapped_reads: + output_unmapped_reads = '--un %s' % options.output_unmapped_reads + else: + output_unmapped_reads = '' + if options.output_suppressed_reads: + output_suppressed_reads = '--max %s' % options.output_suppressed_reads + else: + output_suppressed_reads = '' + snpfrac = '' + if options.snpphred and int( options.snpphred ) >= 0: + snpphred = '--snpphred %s' % options.snpphred + else: + snpphred = '' + if options.snpfrac and float( options.snpfrac ) >= 0: + snpfrac = '--snpfrac %s' % options.snpfrac + if options.keepends and options.keepends == 'doKeepends': + keepends = '--col-keepends' + else: + keepends = '' + aligning_cmds = '-q %s %s -p %s -S %s %s %s %s %s %s %s %s %s %s %s %s ' \ + '%s %s %s %s %s %s %s %s %s %s %s %s %s %s %s %s %s %s ' % \ + ( maxInsert, mateOrient, options.threads, suppressHeader, + colorspace, skip, alignLimit, trimH, trimL, maqSoapAlign, + mismatchSeed, mismatchQual, seedLen, rounding, minInsert, + maxAlignAttempt, forwardAlign, reverseAlign, maxBacktracks, + tryHard, valAlign, allValAligns, suppressAlign, best, + strata, offrate, seed, snpphred, snpfrac, keepends, + output_unmapped_reads, output_suppressed_reads, + quality_score_encoding ) + except (ValueError): + # clean up temp dir + if os.path.exists( tmp_index_dir ): + shutil.rmtree( tmp_index_dir ) + stop_err( 'Something is wrong with the alignment parameters and the alignment could not be run\n' + str( e ) ) + try: + # have to nest try-except in try-finally to handle 2.4 + try: + # prepare actual mapping commands + if options.paired == 'paired': + cmd2 = 'bowtie %s %s -1 %s -2 %s > %s' % ( aligning_cmds, ref_file_name, options.input1, options.input2, options.output ) + else: + cmd2 = 'bowtie %s %s %s > %s' % ( aligning_cmds, ref_file_name, options.input1, options.output ) + # align + tmp = tempfile.NamedTemporaryFile( dir=tmp_index_dir ).name + tmp_stderr = open( tmp, 'wb' ) + proc = subprocess.Popen( args=cmd2, shell=True, cwd=tmp_index_dir, stderr=tmp_stderr.fileno() ) + returncode = proc.wait() + tmp_stderr.close() + # get stderr, allowing for case where it's very large + tmp_stderr = open( tmp, 'rb' ) + stderr = '' + buffsize = 1048576 + try: + while True: + stderr += tmp_stderr.read( buffsize ) + if not stderr or len( stderr ) % buffsize != 0: + break + except OverflowError: + pass + tmp_stderr.close() + if returncode != 0: + raise (Exception, stderr) + # get suppressed and unmapped reads output files in place if appropriate + if options.paired == 'paired' and tmp_suppressed_file_name and \ + options.output_suppressed_reads_l and options.output_suppressed_reads_r: + try: + left = tmp_suppressed_file_name.replace( '.fastq', '_1.fastq' ) + right = tmp_suppressed_file_name.replace( '.fastq', '_1.fastq' ) + shutil.move( left, options.output_suppressed_reads_l ) + shutil.move( right, options.output_suppressed_reads_r ) + except Exception as e: + sys.stdout.write( 'Error producing the suppressed output file.\n' ) + if options.paired == 'paired' and tmp_unmapped_file_name and \ + options.output_unmapped_reads_l and options.output_unmapped_reads_r: + try: + left = tmp_unmapped_file_name.replace( '.fastq', '_1.fastq' ) + right = tmp_unmapped_file_name.replace( '.fastq', '_2.fastq' ) + shutil.move( left, options.output_unmapped_reads_l ) + shutil.move( right, options.output_unmapped_reads_r ) + except Exception as e: + sys.stdout.write( 'Error producing the unmapped output file.\n' ) + # check that there are results in the output file + if os.path.getsize( options.output ) == 0: + raise (Exception, 'The output file is empty, there may be an error with your input file or settings.') + except Exception as e: + stop_err( 'Error aligning sequence. ' + str( e ) ) + finally: + # clean up temp dir + if os.path.exists( tmp_index_dir ): + shutil.rmtree( tmp_index_dir ) + stdout += 'Sequence file aligned.\n' + sys.stdout.write( stdout ) + +if __name__=="__main__": __main__() diff -r 88af3644020b -r ba9beeff5ad0 bowtie_remove_rrna_wrapper/test-data/bowtie_in2.fastqsanger --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/bowtie_remove_rrna_wrapper/test-data/bowtie_in2.fastqsanger Wed Feb 23 13:59:47 2022 +0000 @@ -0,0 +1,104 @@ +@HWI-EAS91_1_30788AAXX:1:1:1513:715/1 +GTTTTTTGGGCATAGATGTTTAGTTGTGGTAGTCAG ++ +IIIIIII""IIIIIIIIIIIIIIIIIIIDI?II-+I +@HWI-EAS91_1_30788AAXX:1:1:1698:516/1 +GTTGTTAGGGAGAGGAGTTGAACCTCTGAGTGTAAA ++ +IIIIIII""IIIIIIIIIIIIIIIIIII5IIIII9I +@HWI-EAS91_1_30788AAXX:1:1:1491:637/1 +GCTAGCAGGATGGATCCGGCAATTGGGGCTTCTACA ++ +IIIIIII""IIIIIIIIIIIIFIIIIIIIIIIIABD +@HWI-EAS91_1_30788AAXX:1:1:1711:249/1 +GGAAGTAGGGGCCTGCGTTCAGGCGTTCTGTTTGGT ++ +IIIIIII""IIIIIIIIIIIIIIIIIIIIIIIIIII +@HWI-EAS91_1_30788AAXX:1:1:1634:211/1 +GAAGCAGGGGCTTGATACTGACACTTCGTCGACGTA ++ +IIIIIII""IIIIIIIIIIIIIIIIIIIIII9IIDF +@HWI-EAS91_1_30788AAXX:1:1:1218:141/1 +GTTAAATATTGGGAGTGGGGGGGGGGGGGAGTTTTG ++ +IIIIIII""IIIIIIIIIIIIIIIIIIII1IIII+I +@HWI-EAS91_1_30788AAXX:1:1:1398:854/1 +GTGAAGAGGAGGGGATTTATTAGTACGGGAAGGGTG ++ +IIIIIII""IIIIIBIIIIIIIIIIIIIIA=IIIII +@HWI-EAS91_1_30788AAXX:1:1:1310:991/1 +GAATAGTGGTAGTATTATTCCTTCTAGGCATAGGAG ++ +IIIIIII""IIIIIIIIII4IIIIIIDII:IEI2:I +@HWI-EAS91_1_30788AAXX:1:1:1716:413/1 +GATCCAAGGCTTTATCAACACCTATTCTGATTCTTC ++ +IIIIIII""IIIIIIIIIIIIIIIIIIIIIIIIIII +@HWI-EAS91_1_30788AAXX:1:1:1630:59/1 +GGAGCGGGGGGTTGGTAAGGTTGGGGTCGAGTATGA ++ +IIIIIII""IIIIIIIIIIIIIIIIIIII;IIHIIF +@HWI-EAS91_1_30788AAXX:1:1:1601:805/1 +GAAAACAGGAAAACAATCCAGTCACTTACCCTATGC ++ +IIIIIII""IIIIIIIIIIIIIIIIIIIIIII@III +@HWI-EAS91_1_30788AAXX:1:1:1663:724/1 +GTTTGCCGGCGCCATCCTACGCTCCATTCCCAACAA ++ +IIIIIII""IIII8IIIIIIHIIII6IIIII1CI=3 +@HWI-EAS91_1_30788AAXX:1:1:1454:975/1 +GCTAGGCGGGAGTGGTAAAAGGCTCAGAAGAAGCCA ++ +IIIIIII""IIIIIIIIIIIIIIIIEIG;IIIIIII +@HWI-EAS91_1_30788AAXX:1:1:1461:255/1 +GTACACCGGCGCCTGAGCCCTACTAATAACTCTCAT ++ +IIIIIII""IIIIII9IIIIIIEI(II9.I4III,I +@HWI-EAS91_1_30788AAXX:1:1:1775:764/1 +GCATCCCGGTAGATCTAATTTTCTAAATCTGTCAAC ++ +IIIIIII""III@IIII+IIIIII8H8IIIIIIICI +@HWI-EAS91_1_30788AAXX:1:1:1269:520/1 +GGAGTATGGAATAAGTGATTTTAGATCGGTTTGTCG ++ +IIIIIII""IIIIIIIIIIIIIIIIIIIIIIIIIII +@HWI-EAS91_1_30788AAXX:1:1:1303:1162/1 +GAGCAAGGGCAGGAGGAGGAGTCCTAGGATGTCTTT ++ +IIIIIII""IIIIFII4*IGIAI(IAII49',3I6I +@HWI-EAS91_1_30788AAXX:1:1:1090:409/1 +GTTTGTTGGGAATGGAGCGTAGGATGGCGTAGGCAA ++ +IIIIIII""IIIIIIIIIIIIIIIIIIIII:IIA8I +@HWI-EAS91_1_30788AAXX:1:1:1336:1000/1 +GGTAAATGGGAAATATTAAGTTTCTGTTTCTAGATC ++ +IIIIIII""IIIIIIIIIIIIIIIIIIIIIIII9II +@HWI-EAS91_1_30788AAXX:1:1:1199:1376/1 +GTTTTCTGGAAAACCTTCACCTATTTATGGGGGTTT ++ +IIIIIII""IIIIIIIIIIIII;III3IIG&:/III +@HWI-EAS91_1_30788AAXX:1:1:1598:1148/1 +GATCAATGGTTTGGATCAATAAGTGATTATATATTT ++ +IIIIIII""IIIIIDIIIIII?IIICII=IHIIIII +@HWI-EAS91_1_30788AAXX:1:1:1723:1459/1 +GAAACCCGGACGTTTGGATGGGCCCGGAGCGAGGAT ++ +IIIIIII""IIIIIIIIDIIIIIIIII9HII-II=I +@HWI-EAS91_1_30788AAXX:1:1:1442:1346/1 +TATCAAGGGGCTGCTTCGAATCCGAAGTGGTGGCTG ++ +IIIIIII""IIIIIDIIIII1I(I4IIphiX174 +GAGTTTTATCGCTTCCATGACGCAGAAGTTAACACTTTCGGATATTTCTGATGAGTCGAAAAATTATCTT +GATAAAGCAGGAATTACTACTGCTTGTTTACGAATTAAATCGAAGTGGACTGCTGGCGGAAAATGAGAAA +ATTCGACCTATCCTTGCGCAGCTCGAGAAGCTCTTACTTTGCGACCTTTCGCCATCAACTAACGATTCTG +TCAAAAACTGACGCGTTGGATGAGGAGAAGTGGCTTAATATGCTTGGCACGTTCGTCAAGGACTGGTTTA +GATATGAGTCACATTTTGTTCATGGTAGAGATTCTCTTGTTGACATTTTAAAAGAGCGTGGATTACTATC +TGAGTCCGATGCTGTTCAACCACTAATAGGTAAGAAATCATGAGTCAAGTTACTGAACAATCCGTACGTT +TCCAGACCGCTTTGGCCTCTATTAAGCTCATTCAGGCTTCTGCCGTTTTGGATTTAACCGAAGATGATTT +CGATTTTCTGACGAGTAACAAAGTTTGGATTGCTACTGACCGCTCTCGTGCTCGTCGCTGCGTTGAGGCT +TGCGTTTATGGTACGCTGGACTTTGTGGGATACCCTCGCTTTCCTGCTCCTGTTGAGTTTATTGCTGCCG +TCATTGCTTATTATGTTCATCCCGTCAACATTCAAACGGCCTGTCTCATCATGGAAGGCGCTGAATTTAC +GGAAAACATTATTAATGGCGTCGAGCGTCCGGTTAAAGCCGCTGAATTGTTCGCGTTTACCTTGCGTGTA +CGCGCAGGAAACACTGACGTTCTTACTGACGCAGAAGAAAACGTGCGTCAAAAATTACGTGCAGAAGGAG +TGATGTAATGTCTAAAGGTAAAAAACGTTCTGGCGCTCGCCCTGGTCGTCCGCAGCCGTTGCGAGGTACT +AAAGGCAAGCGTAAAGGCGCTCGTCTTTGGTATGTAGGTGGTCAACAATTTTAATTGCAGGGGCTTCGGC +CCCTTACTTGAGGATAAATTATGTCTAATATTCAAACTGGCGCCGAGCGTATGCCGCATGACCTTTCCCA +TCTTGGCTTCCTTGCTGGTCAGATTGGTCGTCTTATTACCATTTCAACTACTCCGGTTATCGCTGGCGAC +TCCTTCGAGATGGACGCCGTTGGCGCTCTCCGTCTTTCTCCATTGCGTCGTGGCCTTGCTATTGACTCTA +CTGTAGACATTTTTACTTTTTATGTCCCTCATCGTCACGTTTATGGTGAACAGTGGATTAAGTTCATGAA +GGATGGTGTTAATGCCACTCCTCTCCCGACTGTTAACACTACTGGTTATATTGACCATGCCGCTTTTCTT +GGCACGATTAACCCTGATACCAATAAAATCCCTAAGCATTTGTTTCAGGGTTATTTGAATATCTATAACA +ACTATTTTAAAGCGCCGTGGATGCCTGACCGTACCGAGGCTAACCCTAATGAGCTTAATCAAGATGATGC +TCGTTATGGTTTCCGTTGCTGCCATCTCAAAAACATTTGGACTGCTCCGCTTCCTCCTGAGACTGAGCTT +TCTCGCCAAATGACGACTTCTACCACATCTATTGACATTATGGGTCTGCAAGCTGCTTATGCTAATTTGC +ATACTGACCAAGAACGTGATTACTTCATGCAGCGTTACCGTGATGTTATTTCTTCATTTGGAGGTAAAAC +CTCTTATGACGCTGACAACCGTCCTTTACTTGTCATGCGCTCTAATCTCTGGGCATCTGGCTATGATGTT +GATGGAACTGACCAAACGTCGTTAGGCCAGTTTTCTGGTCGTGTTCAACAGACCTATAAACATTCTGTGC +CGCGTTTCTTTGTTCCTGAGCATGGCACTATGTTTACTCTTGCGCTTGTTCGTTTTCCGCCTACTGCGAC +TAAAGAGATTCAGTACCTTAACGCTAAAGGTGCTTTGACTTATACCGATATTGCTGGCGACCCTGTTTTG +TATGGCAACTTGCCGCCGCGTGAAATTTCTATGAAGGATGTTTTCCGTTCTGGTGATTCGTCTAAGAAGT +TTAAGATTGCTGAGGGTCAGTGGTATCGTTATGCGCCTTCGTATGTTTCTCCTGCTTATCACCTTCTTGA +AGGCTTCCCATTCATTCAGGAACCGCCTTCTGGTGATTTGCAAGAACGCGTACTTATTCGCCACCATGAT +TATGACCAGTGTTTCCAGTCCGTTCAGTTGTTGCAGTGGAATAGTCAGGTTAAATTTAATGTGACCGTTT +ATCGCAATCTGCCGACCACTCGCGATTCAATCATGACTTCGTGATAAAAGATTGAGTGTGAGGTTATAAC +GCCGAAGCGGTAAAAATTTTAATTTTTGCCGCTGAGGGGTTGACCAAGCGAAGCGCGGTAGGTTTTCTGC +TTAGGAGTTTAATCATGTTTCAGACTTTTATTTCTCGCCATAATTCAAACTTTTTTTCTGATAAGCTGGT +TCTCACTTCTGTTACTCCAGCTTCTTCGGCACCTGTTTTACAGACACCTAAAGCTACATCGTCAACGTTA +TATTTTGATAGTTTGACGGTTAATGCTGGTAATGGTGGTTTTCTTCATTGCATTCAGATGGATACATCTG +TCAACGCCGCTAATCAGGTTGTTTCTGTTGGTGCTGATATTGCTTTTGATGCCGACCCTAAATTTTTTGC +CTGTTTGGTTCGCTTTGAGTCTTCTTCGGTTCCGACTACCCTCCCGACTGCCTATGATGTTTATCCTTTG +AATGGTCGCCATGATGGTGGTTATTATACCGTCAAGGACTGTGTGACTATTGACGTCCTTCCCCGTACGC +CGGGCAATAATGTTTATGTTGGTTTCATGGTTTGGTCTAACTTTACCGCTACTAAATGCCGCGGATTGGT +TTCGCTGAATCAGGTTATTAAAGAGATTATTTGTCTCCAGCCACTTAAGTGAGGTGATTTATGTTTGGTG +CTATTGCTGGCGGTATTGCTTCTGCTCTTGCTGGTGGCGCCATGTCTAAATTGTTTGGAGGCGGTCAAAA +AGCCGCCTCCGGTGGCATTCAAGGTGATGTGCTTGCTACCGATAACAATACTGTAGGCATGGGTGATGCT +GGTATTAAATCTGCCATTCAAGGCTCTAATGTTCCTAACCCTGATGAGGCCGCCCCTAGTTTTGTTTCTG +GTGCTATGGCTAAAGCTGGTAAAGGACTTCTTGAAGGTACGTTGCAGGCTGGCACTTCTGCCGTTTCTGA +TAAGTTGCTTGATTTGGTTGGACTTGGTGGCAAGTCTGCCGCTGATAAAGGAAAGGATACTCGTGATTAT +CTTGCTGCTGCATTTCCTGAGCTTAATGCTTGGGAGCGTGCTGGTGCTGATGCTTCCTCTGCTGGTATGG +TTGACGCCGGATTTGAGAATCAAAAAGAGCTTACTAAAATGCAACTGGACAATCAGAAAGAGATTGCCGA +GATGCAAAATGAGACTCAAAAAGAGATTGCTGGCATTCAGTCGGCGACTTCACGCCAGAATACGAAAGAC +CAGGTATATGCACAAAATGAGATGCTTGCTTATCAACAGAAGGAGTCTACTGCTCGCGTTGCGTCTATTA +TGGAAAACACCAATCTTTCCAAGCAACAGCAGGTTTCCGAGATTATGCGCCAAATGCTTACTCAAGCTCA +AACGGCTGGTCAGTATTTTACCAATGACCAAATCAAAGAAATGACTCGCAAGGTTAGTGCTGAGGTTGAC +TTAGTTCATCAGCAAACGCAGAATCAGCGGTATGGCTCTTCTCATATTGGCGCTACTGCAAAGGATATTT +CTAATGTCGTCACTGATGCTGCTTCTGGTGTGGTTGATATTTTTCATGGTATTGATAAAGCTGTTGCCGA +TACTTGGAACAATTTCTGGAAAGACGGTAAAGCTGATGGTATTGGCTCTAATTTGTCTAGGAAATAACCG +TCAGGATTGACACCCTCCCAATTGTATGTTTTCATGCCTCCAAATCTTGGAGGCTTTTTTATGGTTCGTT +CTTATTACCCTTCTGAATGTCACGCTGATTATTTTGACTTTGAGCGTATCGAGGCTCTTAAACCTGCTAT +TGAGGCTTGTGGCATTTCTACTCTTTCTCAATCCCCAATGCTTGGCTTCCATAAGCAGATGGATAACCGC +ATCAAGCTCTTGGAAGAGATTCTGTCTTTTCGTATGCAGGGCGTTGAGTTCGATAATGGTGATATGTATG +TTGACGGCCATAAGGCTGCTTCTGACGTTCGTGATGAGTTTGTATCTGTTACTGAGAAGTTAATGGATGA +ATTGGCACAATGCTACAATGTGCTCCCCCAACTTGATATTAATAACACTATAGACCACCGCCCCGAAGGG +GACGAAAAATGGTTTTTAGAGAACGAGAAGACGGTTACGCAGTTTTGCCGCAAGCTGGCTGCTGAACGCC +CTCTTAAGGATATTCGCGATGAGTATAATTACCCCAAAAAGAAAGGTATTAAGGATGAGTGTTCAAGATT +GCTGGAGGCCTCCACTATGAAATCGCGTAGAGGCTTTACTATTCAGCGTTTGATGAATGCAATGCGACAG +GCTCATGCTGATGGTTGGTTTATCGTTTTTGACACTCTCACGTTGGCTGACGACCGATTAGAGGCGTTTT +ATGATAATCCCAATGCTTTGCGTGACTATTTTCGTGATATTGGTCGTATGGTTCTTGCTGCCGAGGGTCG +CAAGGCTAATGATTCACACGCCGACTGCTATCAGTATTTTTGTGTGCCTGAGTATGGTACAGCTAATGGC +CGTCTTCATTTCCATGCGGTGCATTTTATGCGGACACTTCCTACAGGTAGCGTTGACCCTAATTTTGGTC +GTCGGGTACGCAATCGCCGCCAGTTAAATAGCTTGCAAAATACGTGGCCTTATGGTTACAGTATGCCCAT +CGCAGTTCGCTACACGCAGGACGCTTTTTCACGTTCTGGTTGGTTGTGGCCTGTTGATGCTAAAGGTGAG +CCGCTTAAAGCTACCAGTTATATGGCTGTTGGTTTCTATGTGGCTAAATACGTTAACAAAAAGTCAGATA +TGGACCTTGCTGCTAAAGGTCTAGGAGCTAAAGAATGGAACAACTCACTAAAAACCAAGCTGTCGCTACT +TCCCAAGAAGCTGTTCAGAATCAGAATGAGCCGCAACTTCGGGATGAAAATGCTCACAATGACAAATCTG +TCCACGGAGTGCTTAATCCAACTTACCAAGCTGGGTTACGACGCGACGCCGTTCAACCAGATATTGAAGC +AGAACGCAAAAAGAGAGATGAGATTGAGGCTGGGAAAAGTTACTGTAGCCGACGTTTTGGCGGCGCAACC +TGTGACGACAAATCTGCTCAAATTTATGCGCGCTTCGATAAAAATGATTGGCGTATCCAACCTGCA + diff -r 88af3644020b -r ba9beeff5ad0 bowtie_remove_rrna_wrapper/tool-data/bowtie_indices.loc --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/bowtie_remove_rrna_wrapper/tool-data/bowtie_indices.loc Wed Feb 23 13:59:47 2022 +0000 @@ -0,0 +1,1 @@ +Mouse_rRNA Mouse_rRNA Mouse_rRNA /home/DATA/galaxy/galaxy-dist/data/indexes/bowtie_rrna_indexes/Mouse_rRNA/bowtie_rrna_indexes/mouse_rRNA_index diff -r 88af3644020b -r ba9beeff5ad0 bowtie_remove_rrna_wrapper/tool_data_table_conf.xml.sample --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/bowtie_remove_rrna_wrapper/tool_data_table_conf.xml.sample Wed Feb 23 13:59:47 2022 +0000 @@ -0,0 +1,8 @@ + + + + value, dbkey, name, path + +
+
+