Mercurial > repos > trinity_ctat > ctat_lncrna

changeset 0:a940c4a36a43 draft default tip

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
Upload ctat tools.
author trinity_ctat
date Tue, 17 Jul 2018 11:49:16 -0400
parents
children
files ctat_lncrna.xml test-data/slncky/reads.simPE.browse.html test-data/slncky/reads.simPE.canonical_to_lncs.txt test-data/slncky/reads.simPE.canonical_to_lncs.txt.sorted test-data/slncky/reads.simPE.cluster_info.txt test-data/slncky/reads.simPE.cluster_info.txt.sorted test-data/slncky/reads.simPE.filtered_info.txt test-data/slncky/reads.simPE.filtered_info.txt.sorted test-data/slncky/reads.simPE.lncs.bed test-data/slncky/reads.simPE.lncs.bed.sorted test-data/slncky/reads.simPE.lncs.info.txt test-data/slncky/reads.simPE.lncs.info.txt.sorted test-data/slncky/reads.simPE.orfs.txt test-data/slncky/reads.simPE.orthologs.top.txt test-data/slncky/reads.simPE.orthologs.top.txt.sorted test-data/slncky/reads.simPE.orthologs.txt test-data/slncky/reads.simPE.orthologs.txt.sorted tool-data/ctat_lncrna_annotations.loc.sample tool_data_table_conf.xml.sample
diffstat 19 files changed, 550 insertions(+), 0 deletions(-) [+]
line wrap: on
line diff
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/ctat_lncrna.xml	Tue Jul 17 11:49:16 2018 -0400
@@ -0,0 +1,181 @@
+<tool id="ctat_lncrna" name="ctat_lncrna" version="1.0.0" profile="17.05">
+
+    <description>Filters a high-quality set of lncRNA from reconstructed RNA-seq data</description>
+    <requirements>
+    <requirement type="package" version="1.0.1">ctat-lncrna</requirement>
+    </requirements>
+    <command detect_errors="default">
+      <![CDATA[
+     #if str($bedfile) != "":
+     lncrna --bedfile $bedfile
+     --config "${assembly.fields.path}" 
+     #end if
+
+     #if str($assembly) != "":
+         --assembly "${assembly.fields.value}"
+     #end if
+
+     #if $min_overlap != "":
+         --min_overlap "$min_overlap"
+     #end if
+
+     #if str($min_cluster) != "":
+         --min_cluster "$min_cluster"
+     #end if
+
+     #if str($min_coding) != "":
+         --min_coding "$min_coding"
+     #end if
+
+    #if str($minMatch) != "":
+        --minMatch "$minMatch"
+    #end if
+
+    #if str($pad) != "":
+        --pad "$pad"
+    #end if
+
+    #if str($gap_open) != "":
+        --gap_open "$gap_open"
+    #end if
+
+    #if str($gap_extend) != "":
+        --gap_extend "$gap_extend"
+    #end if
+    --web 
+    && cp -r slncky.EvolutionBrowser $html_file.files_path
+]]>
+    </command>
+
+    <inputs>
+      <param name="bedfile" format="interval" type="data" value="bedfile" label="Bed File:" help="Reconstructed transcripts (ex. from StringTie or Trinity)"/>
+      <param name="min_overlap" type="float" value="0.0" label="Min overlap" help="Remove any transcript that overlap annotated coding gene greater than min_overlap" />
+      <param name="min_cluster" type="integer" value="2" label="Min cluster" help="Minimum size of duplication clusters to remove" />
+      <param name="min_coding" type="float" value="0.1" label="Min exonic identity to filter out transcript that aligns to orthologous coding gene" help="default is set by learning coding alignment distribution from data"/>
+      <param name="minMatch" type="float" value="0.1" label="Min match" help="Minimum match parameter for liftover" />
+      <param name="pad" type="integer" value="0" label="Pad" help="No. of basepairs to search up- and down-stream when lifting over lnc to ortholog" />
+      <param name="gap_open" type="integer" value="200" label="Gap open penalty to pass to lastz" help="Decreasing this parameter will increase sensitivity of orthology search"/>
+      <param name="gap_extend" type="integer" value="40" label="Gap extend penalty to pass to lastz" help="Decreasing this parameter will increase sensitivity of orthology search."/>
+      <param name="assembly" type="select" label="Choose annotation:" help="Select annotation">
+            <options from_data_table="ctat_lncrna_annotations" />
+      </param>
+    </inputs>
+
+    <outputs>
+           <data format="html" name="html_file" label="web_report" from_work_dir="slncky.EvolutionBrowser/browse.html"/>
+           <data format="tabular" name="canonical_to_lncs" label="canonical_to_lncs" from_work_dir="slncky.canonical_to_lncs.txt"/>
+           <data format="tabular" name="cluster_info" label="cluster_info" from_work_dir="slncky.cluster_info.txt"/>
+           <data format="tabular" name="filtered_info" label="filtered_info" from_work_dir="slncky.filtered_info.txt"/>
+           <data format="bed" name="lncs" label="lncs" from_work_dir="slncky.lncs.bed"/>
+           <data format="tabular" name="lncs_info" label="lncs.info" from_work_dir="slncky.lncs.info.txt"/>
+           <data format="tabular" name="orfs" label="orfs" from_work_dir="slncky.orfs.txt"/>
+           <data format="tabular" name="orthologs_top" label="orthologs.top" from_work_dir="slncky.orthologs.top.txt"/>
+           <data format="tabular" name="orthologs" label="orthologs" from_work_dir="slncky.orthologs.txt"/>
+    </outputs>
+
+    <stdio>
+          <exit_code range="1:" level="fatal" description="Error in SLNCky" />
+    </stdio>
+
+    <tests>
+        <test>
+            <param name="bedfile" value="reads.simPE.StringTie.transcripts.bed" />
+            <param name="assembly" value="hg19" /> 
+            <param name="min_overlap" value="0.0" />
+            <param name="min_cluster" value="2" />
+            <param name="min_coding" value="0.1" />
+            <param name="minMatch" value="0.1" />
+            <param name="pad" value="0" />
+            <param name="gap_open" value="200" />
+            <param name="gap_extend" value="40" />
+
+            <!-- <data format="html" name="html_file" label="web_report" from_work_dir="slncky.EvolutionBrowser/browse.html"/> -->
+            <output name="html_file" file="slncky/reads.simPE.browse.html" />
+
+            <!-- <data format="txt" name="canonical_to_lncs" label="canonical_to_lncs" from_work_dir="slncky.canonical_to_lncs.txt"/> -->
+            <output name="canonical_to_lncs" file="slncky/reads.simPE.canonical_to_lncs.txt" />
+ 
+            <!-- <data format="txt" name="cluster_info" label="cluster_info" from_work_dir="slncky.cluster_info.txt"/> -->
+            <output name="cluster_info" file="slncky/reads.simPE.cluster_info.txt" />
+
+            <!-- <data format="txt" name="filtered_info" label="filtered_info" from_work_dir="slncky.filtered_info.txt"/> -->
+            <output name="filtered_info" file="slncky/reads.simPE.filtered_info.txt" />
+
+            <!-- <data format="bed" name="lncs" label="lncs" from_work_dir="slncky.lncs.bed"/> -->
+            <output name="lncs" file="slncky/reads.simPE.lncs.bed" />
+
+            <!-- <data format="txt" name="lncs_info" label="lncs.info" from_work_dir="slncky.lncs.info.txt"/> -->
+            <output name="lncs_info" file="slncky/reads.simPE.lncs.info.txt" />
+
+            <!-- <data format="txt" name="orfs" label="orfs" from_work_dir="slncky.orfs.txt"/> -->
+            <output name="orfs" file="slncky/reads.simPE.orfs.txt" />
+
+            <!-- <data format="txt" name="orthologs_top" label="orthologs.top" from_work_dir="slncky.orthologs.top.txt"/> -->
+            <output name="orthologs_top" file="slncky/reads.simPE.orthologs.top.txt" />
+
+            <!-- <data format="txt" name="orthologs" label="orthologs" from_work_dir="slncky.orthologs.txt"/> -->
+            <output name="orthologs" file="slncky/reads.simPE.orthologs.txt" />
+
+        </test>
+        <test>
+            <param name="bedfile" value="mir-17-92.StringTie.transcripts.bed" />
+            <param name="assembly" value="hg19" /> 
+            <param name="min_overlap" value="0.0" />
+            <param name="min_cluster" value="2" />
+            <param name="min_coding" value="0.1" />
+            <param name="minMatch" value="0.1" />
+            <param name="pad" value="0" />
+            <param name="gap_open" value="200" />
+            <param name="gap_extend" value="40" />
+
+            <!-- <data format="html" name="html_file" label="web_report" from_work_dir="slncky.EvolutionBrowser/browse.html"/> -->
+            <output name="html_file" file="slncky/mir-17-92.browse.html" />
+
+            <!-- <data format="txt" name="canonical_to_lncs" label="canonical_to_lncs" from_work_dir="slncky.canonical_to_lncs.txt"/> -->
+            <output name="canonical_to_lncs" file="slncky/mir-17-92.canonical_to_lncs.txt.sorted" sort="true" />
+ 
+            <!-- <data format="txt" name="cluster_info" label="cluster_info" from_work_dir="slncky.cluster_info.txt"/> -->
+            <!-- This file isn't being created for some reason...
+            <output name="cluster_info" >
+                <assert_contents>
+                    <has_line_matching expression=".+" />
+                </assert_contents>
+            </output>
+            -->
+
+            <!-- <data format="txt" name="filtered_info" label="filtered_info" from_work_dir="slncky.filtered_info.txt"/> -->
+            <output name="filtered_info" file="slncky/mir-17-92.filtered_info.txt.sorted" sort="true" />
+
+            <!-- <data format="bed" name="lncs" label="lncs" from_work_dir="slncky.lncs.bed"/> -->
+            <output name="lncs" file="slncky/mir-17-92.lncs.bed" />
+
+            <!-- <data format="txt" name="lncs_info" label="lncs.info" from_work_dir="slncky.lncs.info.txt"/> -->
+            <output name="lncs_info" file="slncky/mir-17-92.lncs.info.txt" />
+
+            <!-- <data format="txt" name="orfs" label="orfs" from_work_dir="slncky.orfs.txt"/> -->
+            <output name="orfs" file="slncky/mir-17-92.orfs.txt" />
+
+            <!-- <data format="txt" name="orthologs_top" label="orthologs.top" from_work_dir="slncky.orthologs.top.txt"/> -->
+            <output name="orthologs_top" file="slncky/mir-17-92.orthologs.top.txt" />
+
+            <!-- <data format="txt" name="orthologs" label="orthologs" from_work_dir="slncky.orthologs.txt"/> -->
+            <output name="orthologs" file="slncky/mir-17-92.orthologs.txt" />
+        </test>
+    </tests>
+
+    <help>
+.. class:: infomark
+
+slncky is a tool for lncRNA discovery from RNA-Seq data. slncky filters a high-quality set of noncoding transcripts, discovers lncRNA orthologs, and characterizes conserved lncRNA evolution.
+
+To learn more about slncky visit their website_ .
+
+.. _website: https://github.com/slncky/slncky
+
+</help>
+
+<citations>
+        <citation type="doi">10.1186/s13059-016-0880-9</citation>
+</citations>
+
+</tool>
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/slncky/reads.simPE.browse.html	Tue Jul 17 11:49:16 2018 -0400
@@ -0,0 +1,83 @@
+<html>
+<head>
+<script type="text/javascript" charset="utf8" src="search.js"></script>
+
+<!-- DataTables CSS -->
+<link rel="stylesheet" type="text/css" href="https://cdn.datatables.net/1.10.9/css/jquery.dataTables.css">
+<!-- Bootstrap CSS -->
+<link rel="stylesheet" type="text/css" href="https://bootswatch.com/paper/bootstrap.min.css">
+<!-- jQuery -->
+<script type="text/javascript" charset="utf8" src="https://code.jquery.com/jquery-1.11.3.min.js"></script>
+
+<!-- DataTables -->
+<script type="text/javascript" charset="utf8" src="https://cdn.datatables.net/1.10.9/js/jquery.dataTables.min.js"></script>
+<style> select { font-size: 90%; width: 30px; } th { font-size: 80%; } td { font-size: 80%; } td.red {color: red;} td.green {color: #009900;} </style>
+<script type="text/javascript" class="init">
+$(document).ready(function() {
+	$('#table_id').DataTable();
+} );
+</script>
+
+
+</head>
+<body>
+
+<nav class="navbar navbar-default">
+<div class="container-fluid" style="position: absolute; width: 100%;">
+<div class="navbar-header">
+<button type="button" class="navbar-toggle collapsed" data-toggle="collapse" data-target="#bs-example-navbar-collapse-2">
+<span class="sr-only">Toggle navigation</span>
+<span class="icon-bar"></span>
+<span class="icon-bar"></span>
+<span class="icon-bar"></span>
+</button>
+<a class ="navbar-brand" href="#"><p style="font-size:26"><em>slncky</em> Evolution Browser</p></a>
+</div>
+
+<div class="collapse navbar-collapse" id="bs-example-navbar-collapse-2">
+<ul class="nav navbar-nav">
+
+<a href="#"><li class="active">Browse</a></li>
+</ul>
+<ul class="nav navbar-nav navbar-right">
+</ul>
+</div>
+</div>
+</nav>
+
+<div class="container">
+<div class="jumbotron">
+<h2>Browse lncRNAs</h2>  
+<hr>
+<br>
+<table id="table_id" class="table table-striped table-hover" cellspacing="0" width="100%">
+<thead>
+<tr>
+<th>Lnc</th>
+<th>Name</th>
+<th>Ortholog</th>
+<th>Ortholog Name</th>
+<th>Type</th>
+<th>Transcript-Transcript Identity</th>
+<th>Trascript-Genome Identity</th>
+<th>Indel Rate</th>
+<th>Conserved Splice Sites</th>
+<th>Total Splice Sites</th>
+<th>Lnc Exons Aligned</th>
+<th>Ortholog Exons Aligned</th>
+</tr>
+</thead>
+<tbody>
+<tr><td><a href="lnc/STRG.25.1.html" target="_blank">STRG.25.1</a></td><td>MALAT1</td><td>uc008gfj.2</td><td>Malat1</td><td>intergenic</td><td>0.63</td><td>0.63</td><td>-</td><td>0.0</td><td>0</td><td>1,</td><td>1,</td></tr>
+<tr><td><a href="lnc/STRG.5.1.html" target="_blank">STRG.5.1</a></td><td>Unannotated</td><td>uc009vfa.1</td><td>Atpase6</td><td>intergenic</td><td>0.00</td><td>0.00</td><td>-</td><td>0.0</td><td>0</td><td>NA</td><td>NA</td></tr>
+<tr><td><a href="lnc/STRG.52.1.html" target="_blank">STRG.52.1</a></td><td>JA760615</td><td>uc012hdm.1</td><td>BC071253</td><td>intergenic</td><td>0.00</td><td>-0.00</td><td>-</td><td>0.0</td><td>0</td><td>NA</td><td>NA</td></tr>
+<tr><td><a href="lnc/STRG.48.2.html" target="_blank">STRG.48.2</a></td><td>OK/SW-cl.16</td><td>uc009vez.1</td><td>Cox2</td><td>intergenic</td><td>0.00</td><td>-0.00</td><td>-</td><td>0.0</td><td>0</td><td>NA</td><td>NA</td></tr>
+<tr><td><a href="lnc/STRG.44.1.html" target="_blank">STRG.44.1</a></td><td>TVAS5</td><td>uc009vew.1</td><td>AK018753</td><td>intergenic</td><td>0.00</td><td>-0.00</td><td>-</td><td>0.0</td><td>0</td><td>NA</td><td>NA</td></tr>
+<tr><td><a href="lnc/STRG.49.1.html" target="_blank">STRG.49.1</a></td><td>OK/SW-cl.16</td><td>uc009vfa.1</td><td>Atpase6</td><td>intergenic</td><td>0.00</td><td>-0.00</td><td>-</td><td>0.0</td><td>0</td><td>NA</td><td>NA</td></tr>
+<tr><td><a href="lnc/STRG.45.1.html" target="_blank">STRG.45.1</a></td><td>TVAS5</td><td>uc009vew.1</td><td>AK018753</td><td>intergenic</td><td>0.00</td><td>-0.00</td><td>-</td><td>0.0</td><td>0</td><td>NA</td><td>NA</td></tr>
+<tr><td><a href="lnc/STRG.51.1.html" target="_blank">STRG.51.1</a></td><td>MTND5</td><td>uc009vfc.1</td><td>Cytb</td><td>intergenic</td><td>0.00</td><td>-0.00</td><td>-</td><td>0.0</td><td>0</td><td>NA</td><td>NA</td></tr>
+</tbody>
+</table>
+</div>
+</body>
+</html>
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/slncky/reads.simPE.canonical_to_lncs.txt	Tue Jul 17 11:49:16 2018 -0400
@@ -0,0 +1,27 @@
+#canonical	lncs
+STRG.45.1	STRG.45.1,
+STRG.28.1	STRG.28.2,STRG.28.1,
+STRG.25.1	STRG.25.2,STRG.25.1,
+STRG.44.1	STRG.44.1,
+STRG.2.1	STRG.2.1,
+STRG.15.2	STRG.15.2,STRG.15.1,
+STRG.50.1	STRG.50.1,
+STRG.3.1	STRG.3.1,
+STRG.17.1	STRG.17.1,
+STRG.48.1	STRG.48.1,
+STRG.48.2	STRG.48.2,
+STRG.1.1	STRG.1.1,
+STRG.42.1	STRG.42.1,
+STRG.51.1	STRG.51.1,
+STRG.8.1	STRG.8.1,
+STRG.7.1	STRG.7.1,
+STRG.6.1	STRG.6.1,
+STRG.52.1	STRG.52.1,
+STRG.10.1	STRG.10.1,
+STRG.47.1	STRG.47.1,
+STRG.46.1	STRG.46.1,
+STRG.5.1	STRG.5.1,STRG.5.2,STRG.4.1,
+STRG.22.1	STRG.22.1,
+STRG.43.1	STRG.43.1,
+STRG.23.1	STRG.23.1,
+STRG.49.1	STRG.49.1,STRG.49.2,STRG.49.3,
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/slncky/reads.simPE.canonical_to_lncs.txt.sorted	Tue Jul 17 11:49:16 2018 -0400
@@ -0,0 +1,27 @@
+#canonical	lncs
+STRG.10.1	STRG.10.1,
+STRG.1.1	STRG.1.1,
+STRG.15.2	STRG.15.2,STRG.15.1,
+STRG.17.1	STRG.17.1,
+STRG.2.1	STRG.2.1,
+STRG.22.1	STRG.22.1,
+STRG.23.1	STRG.23.1,
+STRG.25.1	STRG.25.2,STRG.25.1,
+STRG.28.1	STRG.28.2,STRG.28.1,
+STRG.3.1	STRG.3.1,
+STRG.42.1	STRG.42.1,
+STRG.43.1	STRG.43.1,
+STRG.44.1	STRG.44.1,
+STRG.45.1	STRG.45.1,
+STRG.46.1	STRG.46.1,
+STRG.47.1	STRG.47.1,
+STRG.48.1	STRG.48.1,
+STRG.48.2	STRG.48.2,
+STRG.49.1	STRG.49.1,STRG.49.2,STRG.49.3,
+STRG.50.1	STRG.50.1,
+STRG.51.1	STRG.51.1,
+STRG.5.1	STRG.5.1,STRG.5.2,STRG.4.1,
+STRG.52.1	STRG.52.1,
+STRG.6.1	STRG.6.1,
+STRG.7.1	STRG.7.1,
+STRG.8.1	STRG.8.1,
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/slncky/reads.simPE.cluster_info.txt	Tue Jul 17 11:49:16 2018 -0400
@@ -0,0 +1,6 @@
+3	N	STRG.22.1,STRG.15.2,STRG.6.1,
+3	N	STRG.7.1,STRG.10.1,STRG.43.1,
+2	N	STRG.1.1,STRG.46.1,
+2	N	STRG.47.1,STRG.2.1,
+2	N	STRG.48.1,STRG.3.1,
+#clusterSize	alignToDup?	transcripts
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/slncky/reads.simPE.cluster_info.txt.sorted	Tue Jul 17 11:49:16 2018 -0400
@@ -0,0 +1,6 @@
+2	N	STRG.1.1,STRG.46.1,
+2	N	STRG.47.1,STRG.2.1,
+2	N	STRG.48.1,STRG.3.1,
+3	N	STRG.22.1,STRG.15.2,STRG.6.1,
+3	N	STRG.7.1,STRG.10.1,STRG.43.1,
+#clusterSize	alignToDup?	transcripts
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/slncky/reads.simPE.filtered_info.txt	Tue Jul 17 11:49:16 2018 -0400
@@ -0,0 +1,49 @@
+STRG.19.1	200.0% exonic overlap with coding transcript uc003ubx.4
+STRG.16.1	100.0% exonic overlap with coding transcript NM_001003806
+STRG.14.1	100.0% exonic overlap with coding transcript uc003nxk.2
+STRG.29.1	100.0% exonic overlap with coding transcript NM_001014449
+STRG.13.1	100.0% exonic overlap with coding transcript NM_005345
+STRG.27.1	100.0% exonic overlap with coding transcript uc001oja.3
+STRG.18.1	100.0% exonic overlap with coding transcript uc003tzi.4
+STRG.26.1	100.0% exonic overlap with coding transcript uc001oiw.2
+STRG.20.1	99.8% exonic overlap with coding transcript NM_198085
+STRG.37.1	99.8% exonic overlap with coding transcript uc002klr.3
+STRG.41.1	99.6% exonic overlap with coding transcript NM_014649
+STRG.33.1	97.7% exonic overlap with coding transcript NM_198993
+STRG.40.1	88.6% exonic overlap with coding transcript NM_002967
+STRG.31.3	71.4% exonic overlap with coding transcript uc002hqy.1
+STRG.32.1	40.2% exonic overlap with coding transcript uc002hrq.1
+STRG.30.1	37.4% exonic overlap with coding transcript uc002fnn.2
+STRG.34.1	35.7% exonic overlap with coding transcript uc002hsq.3
+STRG.24.1	32.7% exonic overlap with coding transcript uc001ocx.3
+STRG.39.1	32.6% exonic overlap with coding transcript NM_004152
+STRG.36.1	20.8% exonic overlap with coding transcript uc002iyw.4
+STRG.38.1	transcript entirely within coding transcript NM_001003652
+STRG.11.1	transcript entirely within coding transcript NM_173666
+STRG.21.2	transcript entirely within coding transcript uc011leg.2
+STRG.21.1	transcript entirely within coding transcript NM_001164750
+STRG.31.1	transcript entirely within coding transcript NM_000978
+STRG.31.2	transcript entirely within coding transcript uc002hqx.1
+STRG.9.1	transcript entirely within coding transcript NM_020357
+STRG.35.1	transcript entirely within coding transcript NM_001075099
+STRG.12.1	transcript entirely within coding transcript uc011dmq.2
+STRG.2.1	aligns to STRG.47.1 with 98.6% identity and 99.9% coverage. Appears to be duplication.
+STRG.15.2	aligns to STRG.22.1 with 99.4% identity and 100.0% coverage. Appears to be duplication.
+STRG.15.2	aligns to STRG.6.1 with 97.0% identity and 100.0% coverage. Appears to be duplication.
+STRG.3.1	aligns to STRG.48.1 with 98.2% identity and 99.9% coverage. Appears to be duplication.
+STRG.48.1	aligns to STRG.3.1 with 98.2% identity and 99.9% coverage. Appears to be duplication.
+STRG.1.1	aligns to STRG.46.1 with 98.5% identity and 99.9% coverage. Appears to be duplication.
+STRG.7.1	aligns to STRG.43.1 with 90.7% identity and 100.0% coverage. Appears to be duplication.
+STRG.7.1	aligns to STRG.10.1 with 90.1% identity and 98.9% coverage. Appears to be duplication.
+STRG.6.1	aligns to STRG.22.1 with 97.1% identity and 100.0% coverage. Appears to be duplication.
+STRG.6.1	aligns to STRG.15.2 with 97.0% identity and 100.0% coverage. Appears to be duplication.
+STRG.10.1	aligns to STRG.7.1 with 90.1% identity and 98.9% coverage. Appears to be duplication.
+STRG.10.1	aligns to STRG.43.1 with 89.5% identity and 99.3% coverage. Appears to be duplication.
+STRG.47.1	aligns to STRG.2.1 with 98.6% identity and 99.9% coverage. Appears to be duplication.
+STRG.46.1	aligns to STRG.1.1 with 98.5% identity and 99.9% coverage. Appears to be duplication.
+STRG.22.1	aligns to STRG.15.2 with 99.4% identity and 100.0% coverage. Appears to be duplication.
+STRG.22.1	aligns to STRG.6.1 with 97.1% identity and 100.0% coverage. Appears to be duplication.
+STRG.43.1	aligns to STRG.10.1 with 89.5% identity and 99.3% coverage. Appears to be duplication.
+STRG.43.1	aligns to STRG.7.1 with 90.7% identity and 100.0% coverage. Appears to be duplication.
+STRG.17.1	aligns to mm9 coding transcript uc008zth.2 with 65.4% exonic identity
+STRG.17.1	aligns to mm9 coding transcript NM_133900 with 65.4% exonic identity
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/slncky/reads.simPE.filtered_info.txt.sorted	Tue Jul 17 11:49:16 2018 -0400
@@ -0,0 +1,49 @@
+STRG.10.1	aligns to STRG.43.1 with 89.5% identity and 99.3% coverage. Appears to be duplication.
+STRG.10.1	aligns to STRG.7.1 with 90.1% identity and 98.9% coverage. Appears to be duplication.
+STRG.11.1	transcript entirely within coding transcript NM_173666
+STRG.1.1	aligns to STRG.46.1 with 98.5% identity and 99.9% coverage. Appears to be duplication.
+STRG.12.1	transcript entirely within coding transcript uc011dmq.2
+STRG.13.1	100.0% exonic overlap with coding transcript NM_005345
+STRG.14.1	100.0% exonic overlap with coding transcript uc003nxk.2
+STRG.15.2	aligns to STRG.22.1 with 99.4% identity and 100.0% coverage. Appears to be duplication.
+STRG.15.2	aligns to STRG.6.1 with 97.0% identity and 100.0% coverage. Appears to be duplication.
+STRG.16.1	100.0% exonic overlap with coding transcript NM_001003806
+STRG.17.1	aligns to mm9 coding transcript NM_133900 with 65.4% exonic identity
+STRG.17.1	aligns to mm9 coding transcript uc008zth.2 with 65.4% exonic identity
+STRG.18.1	100.0% exonic overlap with coding transcript uc003tzi.4
+STRG.19.1	200.0% exonic overlap with coding transcript uc003ubx.4
+STRG.20.1	99.8% exonic overlap with coding transcript NM_198085
+STRG.21.1	transcript entirely within coding transcript NM_001164750
+STRG.21.2	transcript entirely within coding transcript uc011leg.2
+STRG.2.1	aligns to STRG.47.1 with 98.6% identity and 99.9% coverage. Appears to be duplication.
+STRG.22.1	aligns to STRG.15.2 with 99.4% identity and 100.0% coverage. Appears to be duplication.
+STRG.22.1	aligns to STRG.6.1 with 97.1% identity and 100.0% coverage. Appears to be duplication.
+STRG.24.1	32.7% exonic overlap with coding transcript uc001ocx.3
+STRG.26.1	100.0% exonic overlap with coding transcript uc001oiw.2
+STRG.27.1	100.0% exonic overlap with coding transcript uc001oja.3
+STRG.29.1	100.0% exonic overlap with coding transcript NM_001014449
+STRG.30.1	37.4% exonic overlap with coding transcript uc002fnn.2
+STRG.31.1	transcript entirely within coding transcript NM_000978
+STRG.31.2	transcript entirely within coding transcript uc002hqx.1
+STRG.31.3	71.4% exonic overlap with coding transcript uc002hqy.1
+STRG.3.1	aligns to STRG.48.1 with 98.2% identity and 99.9% coverage. Appears to be duplication.
+STRG.32.1	40.2% exonic overlap with coding transcript uc002hrq.1
+STRG.33.1	97.7% exonic overlap with coding transcript NM_198993
+STRG.34.1	35.7% exonic overlap with coding transcript uc002hsq.3
+STRG.35.1	transcript entirely within coding transcript NM_001075099
+STRG.36.1	20.8% exonic overlap with coding transcript uc002iyw.4
+STRG.37.1	99.8% exonic overlap with coding transcript uc002klr.3
+STRG.38.1	transcript entirely within coding transcript NM_001003652
+STRG.39.1	32.6% exonic overlap with coding transcript NM_004152
+STRG.40.1	88.6% exonic overlap with coding transcript NM_002967
+STRG.41.1	99.6% exonic overlap with coding transcript NM_014649
+STRG.43.1	aligns to STRG.10.1 with 89.5% identity and 99.3% coverage. Appears to be duplication.
+STRG.43.1	aligns to STRG.7.1 with 90.7% identity and 100.0% coverage. Appears to be duplication.
+STRG.46.1	aligns to STRG.1.1 with 98.5% identity and 99.9% coverage. Appears to be duplication.
+STRG.47.1	aligns to STRG.2.1 with 98.6% identity and 99.9% coverage. Appears to be duplication.
+STRG.48.1	aligns to STRG.3.1 with 98.2% identity and 99.9% coverage. Appears to be duplication.
+STRG.6.1	aligns to STRG.15.2 with 97.0% identity and 100.0% coverage. Appears to be duplication.
+STRG.6.1	aligns to STRG.22.1 with 97.1% identity and 100.0% coverage. Appears to be duplication.
+STRG.7.1	aligns to STRG.10.1 with 90.1% identity and 98.9% coverage. Appears to be duplication.
+STRG.7.1	aligns to STRG.43.1 with 90.7% identity and 100.0% coverage. Appears to be duplication.
+STRG.9.1	transcript entirely within coding transcript NM_020357
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/slncky/reads.simPE.lncs.bed	Tue Jul 17 11:49:16 2018 -0400
@@ -0,0 +1,13 @@
+chrM	3306	4262	STRG.45.1	100.0	+	3306	4262	255,0,0	1	956	0
+chr13	82264045	82265207	STRG.28.1	100.0	+	82264045	82265207	255,0,0	1	1162	0
+chr11	65265232	65273940	STRG.25.1	100.0	+	65265232	65273940	255,0,0	1	8708	0
+chrM	1670	3229	STRG.44.1	100.0	+	1670	3229	255,0,0	1	1559	0
+chrM	10058	10404	STRG.50.1	100.0	+	10058	10404	255,0,0	1	346	0
+chrM	8294	8364	STRG.48.2	100.0	+	8294	8364	255,0,0	1	70	0
+chrX	108297360	108297792	STRG.42.1	100.0	-	108297360	108297792	255,0,0	1	432	0
+chrM	12336	14148	STRG.51.1	100.0	+	12336	14148	255,0,0	1	1812	0
+chr2	26901086	26901378	STRG.8.1	100.0	-	26901086	26901378	255,0,0	1	292	0
+chrM	14148	14673	STRG.52.1	100.0	-	14148	14673	255,0,0	1	525	0
+chr1	569075	569756	STRG.5.1	100.0	+	569075	569756	255,0,0	1	681	0
+chr10	23425852	23426590	STRG.23.1	100.0	+	23425852	23426590	255,0,0	1	738	0
+chrM	9206	9990	STRG.49.1	100.0	+	9206	9990	255,0,0	1	784	0
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/slncky/reads.simPE.lncs.bed.sorted	Tue Jul 17 11:49:16 2018 -0400
@@ -0,0 +1,13 @@
+chr10	23425852	23426590	STRG.23.1	100.0	+	23425852	23426590	255,0,0	1	738	0
+chr11	65265232	65273940	STRG.25.1	100.0	+	65265232	65273940	255,0,0	1	8708	0
+chr13	82264045	82265207	STRG.28.1	100.0	+	82264045	82265207	255,0,0	1	1162	0
+chr1	569075	569756	STRG.5.1	100.0	+	569075	569756	255,0,0	1	681	0
+chr2	26901086	26901378	STRG.8.1	100.0	-	26901086	26901378	255,0,0	1	292	0
+chrM	10058	10404	STRG.50.1	100.0	+	10058	10404	255,0,0	1	346	0
+chrM	12336	14148	STRG.51.1	100.0	+	12336	14148	255,0,0	1	1812	0
+chrM	14148	14673	STRG.52.1	100.0	-	14148	14673	255,0,0	1	525	0
+chrM	1670	3229	STRG.44.1	100.0	+	1670	3229	255,0,0	1	1559	0
+chrM	3306	4262	STRG.45.1	100.0	+	3306	4262	255,0,0	1	956	0
+chrM	8294	8364	STRG.48.2	100.0	+	8294	8364	255,0,0	1	70	0
+chrM	9206	9990	STRG.49.1	100.0	+	9206	9990	255,0,0	1	784	0
+chrX	108297360	108297792	STRG.42.1	100.0	-	108297360	108297792	255,0,0	1	432	0
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/slncky/reads.simPE.lncs.info.txt	Tue Jul 17 11:49:16 2018 -0400
@@ -0,0 +1,13 @@
+STRG.45.1	TVAS5	intergenic
+STRG.28.1	Unannotated	intergenic
+STRG.25.1	MALAT1	intergenic
+STRG.44.1	TVAS5	intergenic
+STRG.50.1	AD	intergenic
+STRG.48.2	OK/SW-cl.16	intergenic
+STRG.42.1	Unannotated	intergenic
+STRG.51.1	MTND5	intergenic
+STRG.8.1	Unannotated	intergenic
+STRG.52.1	JA760615	intergenic
+STRG.5.1	Unannotated	intergenic
+STRG.23.1	Unannotated	intergenic
+STRG.49.1	OK/SW-cl.16	intergenic
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/slncky/reads.simPE.lncs.info.txt.sorted	Tue Jul 17 11:49:16 2018 -0400
@@ -0,0 +1,13 @@
+STRG.23.1	Unannotated	intergenic
+STRG.25.1	MALAT1	intergenic
+STRG.28.1	Unannotated	intergenic
+STRG.42.1	Unannotated	intergenic
+STRG.44.1	TVAS5	intergenic
+STRG.45.1	TVAS5	intergenic
+STRG.48.2	OK/SW-cl.16	intergenic
+STRG.49.1	OK/SW-cl.16	intergenic
+STRG.50.1	AD	intergenic
+STRG.51.1	MTND5	intergenic
+STRG.5.1	Unannotated	intergenic
+STRG.52.1	JA760615	intergenic
+STRG.8.1	Unannotated	intergenic
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/slncky/reads.simPE.orfs.txt	Tue Jul 17 11:49:16 2018 -0400
@@ -0,0 +1,3 @@
+lnc	lncName	ortholog	orthologName	alignScore	lengthLncOrf	lengthOrthOrf	kN	kS	kN\kS	lncOrf	orthOrf
+STRG.25.1	MALAT1	uc008gfj.2	Malat1	455430	90	90	0.04	0.02	2.286	ATGTTTCGTTTGCCTCAGACAGGTATCTCTTCGTTATCAGAAGAGTTGCTTCATTTCATCTGGGAGCAGAAAACAGCAGGCAGCTGTTAA	ATGTTTCGTTTGCCTCAGACAGGTTTCTCTTCATAAGCAGAAGAGTTGCTTCATTCCATCTCGGAGCAGGAAACAGCAGACTGCTGTTGA
+STRG.25.1	MALAT1	cast.naive_gene.v2.1_1455.0_chr19	Malat1	455430	90	90	0.04	0.02	2.286	ATGTTTCGTTTGCCTCAGACAGGTATCTCTTCGTTATCAGAAGAGTTGCTTCATTTCATCTGGGAGCAGAAAACAGCAGGCAGCTGTTAA	ATGTTTCGTTTGCCTCAGACAGGTTTCTCTTCATAAGCAGAAGAGTTGCTTCATTCCATCTCGGAGCAGGAAACAGCAGACTGCTGTTGA
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/slncky/reads.simPE.orthologs.top.txt	Tue Jul 17 11:49:16 2018 -0400
@@ -0,0 +1,9 @@
+#lnc	lncGeneSymbol	ortholog	orthologGeneSymbol	alignScore	exonID	locusID	indelRate(exon)	indelRate(intron)	lncExonsAligned	orthExonsAligned	spliceConserved	spliceTotal	category(hg19)	category(mm9)
+STRG.25.1	MALAT1	uc008gfj.2	Malat1	455430	0.63	0.63	0.049	NA	1,	1,	0.0	0	intergenic	intergenic
+STRG.5.1	Unannotated	uc009vfa.1	Atpase6	281595	0.00	0.00	NA	NA	NA	NA	0.0	0	intergenic	intergenic
+STRG.52.1	JA760615	uc012hdm.1	BC071253	726896	0.00	-0.00	NA	NA	NA	NA	0.0	0	intergenic	intergenic
+STRG.48.2	OK/SW-cl.16	uc009vez.1	Cox2	726896	0.00	-0.00	NA	NA	NA	NA	0.0	0	intergenic	intergenic
+STRG.44.1	TVAS5	uc009vew.1	AK018753	726896	0.00	-0.00	NA	NA	NA	NA	0.0	0	intergenic	intergenic
+STRG.49.1	OK/SW-cl.16	uc009vfa.1	Atpase6	726896	0.00	-0.00	NA	NA	NA	NA	0.0	0	intergenic	intergenic
+STRG.45.1	TVAS5	uc009vew.1	AK018753	726896	0.00	-0.00	NA	NA	NA	NA	0.0	0	intergenic	intergenic
+STRG.51.1	MTND5	uc009vfc.1	Cytb	726896	0.00	-0.00	NA	NA	NA	NA	0.0	0	intergenic	intergenic
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/slncky/reads.simPE.orthologs.top.txt.sorted	Tue Jul 17 11:49:16 2018 -0400
@@ -0,0 +1,9 @@
+#lnc	lncGeneSymbol	ortholog	orthologGeneSymbol	alignScore	exonID	locusID	indelRate(exon)	indelRate(intron)	lncExonsAligned	orthExonsAligned	spliceConserved	spliceTotal	category(hg19)	category(mm9)
+STRG.25.1	MALAT1	uc008gfj.2	Malat1	455430	0.63	0.63	0.049	NA	1,	1,	0.0	0	intergenic	intergenic
+STRG.44.1	TVAS5	uc009vew.1	AK018753	726896	0.00	-0.00	NA	NA	NA	NA	0.0	0	intergenic	intergenic
+STRG.45.1	TVAS5	uc009vew.1	AK018753	726896	0.00	-0.00	NA	NA	NA	NA	0.0	0	intergenic	intergenic
+STRG.48.2	OK/SW-cl.16	uc009vez.1	Cox2	726896	0.00	-0.00	NA	NA	NA	NA	0.0	0	intergenic	intergenic
+STRG.49.1	OK/SW-cl.16	uc009vfa.1	Atpase6	726896	0.00	-0.00	NA	NA	NA	NA	0.0	0	intergenic	intergenic
+STRG.51.1	MTND5	uc009vfc.1	Cytb	726896	0.00	-0.00	NA	NA	NA	NA	0.0	0	intergenic	intergenic
+STRG.5.1	Unannotated	uc009vfa.1	Atpase6	281595	0.00	0.00	NA	NA	NA	NA	0.0	0	intergenic	intergenic
+STRG.52.1	JA760615	uc012hdm.1	BC071253	726896	0.00	-0.00	NA	NA	NA	NA	0.0	0	intergenic	intergenic
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/slncky/reads.simPE.orthologs.txt	Tue Jul 17 11:49:16 2018 -0400
@@ -0,0 +1,10 @@
+#lnc	lncGeneSymbol	ortholog	orthologGeneSymbol	alignScore	exonID	locusID	indelRate(exon)	indelRate(intron)	lncExonsAligned	orthExonsAligned	spliceConserved	spliceTotal	category(hg19)	category(mm9)
+STRG.52.1	JA760615	uc012hdm.1	BC071253	726896	0.00	-0.00	NA	NA	NA	NA	0.0	0	intergenic	intergenic
+STRG.51.1	MTND5	uc009vfc.1	Cytb	726896	0.00	-0.00	NA	NA	NA	NA	0.0	0	intergenic	intergenic
+STRG.5.1	Unannotated	uc009vfa.1	Atpase6	281595	0.00	0.00	NA	NA	NA	NA	0.0	0	intergenic	intergenic
+STRG.49.1	OK/SW-cl.16	uc009vfa.1	Atpase6	726896	0.00	-0.00	NA	NA	NA	NA	0.0	0	intergenic	intergenic
+STRG.48.2	OK/SW-cl.16	uc009vez.1	Cox2	726896	0.00	-0.00	NA	NA	NA	NA	0.0	0	intergenic	intergenic
+STRG.45.1	TVAS5	uc009vew.1	AK018753	726896	0.00	-0.00	NA	NA	NA	NA	0.0	0	intergenic	intergenic
+STRG.44.1	TVAS5	uc009vew.1	AK018753	726896	0.00	-0.00	NA	NA	NA	NA	0.0	0	intergenic	intergenic
+STRG.25.1	MALAT1	uc008gfj.2	Malat1	455430	0.63	0.63	0.049	NA	1,	1,	0.0	0	intergenic	intergenic
+STRG.25.1	MALAT1	cast.naive_gene.v2.1_1455.0_chr19	Malat1	455430	0.60	0.64	0.048	NA	1,	1,2,	0.0	0	intergenic	intergenic
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/slncky/reads.simPE.orthologs.txt.sorted	Tue Jul 17 11:49:16 2018 -0400
@@ -0,0 +1,10 @@
+#lnc	lncGeneSymbol	ortholog	orthologGeneSymbol	alignScore	exonID	locusID	indelRate(exon)	indelRate(intron)	lncExonsAligned	orthExonsAligned	spliceConserved	spliceTotal	category(hg19)	category(mm9)
+STRG.25.1	MALAT1	cast.naive_gene.v2.1_1455.0_chr19	Malat1	455430	0.60	0.64	0.048	NA	1,	1,2,	0.0	0	intergenic	intergenic
+STRG.25.1	MALAT1	uc008gfj.2	Malat1	455430	0.63	0.63	0.049	NA	1,	1,	0.0	0	intergenic	intergenic
+STRG.44.1	TVAS5	uc009vew.1	AK018753	726896	0.00	-0.00	NA	NA	NA	NA	0.0	0	intergenic	intergenic
+STRG.45.1	TVAS5	uc009vew.1	AK018753	726896	0.00	-0.00	NA	NA	NA	NA	0.0	0	intergenic	intergenic
+STRG.48.2	OK/SW-cl.16	uc009vez.1	Cox2	726896	0.00	-0.00	NA	NA	NA	NA	0.0	0	intergenic	intergenic
+STRG.49.1	OK/SW-cl.16	uc009vfa.1	Atpase6	726896	0.00	-0.00	NA	NA	NA	NA	0.0	0	intergenic	intergenic
+STRG.51.1	MTND5	uc009vfc.1	Cytb	726896	0.00	-0.00	NA	NA	NA	NA	0.0	0	intergenic	intergenic
+STRG.5.1	Unannotated	uc009vfa.1	Atpase6	281595	0.00	0.00	NA	NA	NA	NA	0.0	0	intergenic	intergenic
+STRG.52.1	JA760615	uc012hdm.1	BC071253	726896	0.00	-0.00	NA	NA	NA	NA	0.0	0	intergenic	intergenic
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/tool-data/ctat_lncrna_annotations.loc.sample	Tue Jul 17 11:49:16 2018 -0400
@@ -0,0 +1,15 @@
+# This file lists the locations of CTAT lncrna annotations
+# Usually there will only be one index, but it is concievable 
+# that there could be multiple annotations.
+# This file format is as follows
+# (white space characters are TAB characters):
+#
+#<value>    <name>  <path>
+# value is a unique id
+# name is the display name
+# path is the directory where the index files are stored
+#
+#ctat_lncrna_annotations.loc could look like:
+#
+#slncky_annotations	CTAT_lncrna_annotations	/path/to/lncrna/annotations
+#
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/tool_data_table_conf.xml.sample	Tue Jul 17 11:49:16 2018 -0400
@@ -0,0 +1,14 @@
+<tables>
+    <table name="ctat_genome_resource_libs" comment_char="#" allow_duplicate_entries="False">
+        <columns>value, name, path</columns>
+        <file path="tool-data/ctat_genome_resource_libs.loc" />
+    </table>
+    <table name="ctat_centrifuge_indexes" comment_char="#" allow_duplicate_entries="False">
+        <columns>value, name, path</columns>
+        <file path="tool-data/ctat_centrifuge_indexes.loc" />
+    </table>
+    <table name="ctat_lncrna_annotations" comment_char="#" allow_duplicate_entries="False">
+        <columns>value, name, path</columns>
+        <file path="tool-data/ctat_lncrna_annotations.loc" />
+    </table>
+</tables>