Mercurial > repos > ucsb-phylogenetics > osiris_phylogenetics

view alignment/phytab_mview.xml @ 0:5b9a38ec4a39 draft default tip

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
First commit of old repositories
author osiris_phylogenetics <ucsb_phylogenetics@lifesci.ucsb.edu>
date Tue, 11 Mar 2014 12:19:13 -0700
parents
children
line wrap: on
line source

<tool id="mview_phytab_python" name="phytab_MView" version="1.0">
	<description>View multiple phytab sequence alignments in HTML</description>
	<requirements><requirement type="package">mview</requirement></requirements>
	<command interpreter="python">phytab_mview.py $phytabinput $dna $output "$output.extra_files_path"
</command>

	<inputs>
		<param format="tabular" name="phytabinput" type="data" label="Phytab file of aligned genes to visualize" />
    		<param name="dna" type="select" label="Data type">
      			<option value="dna">DNA</option>
      			<option value="protein">Protein</option>
		</param>
	</inputs>

	<outputs>
		<data format="html" name="output" label="${tool.name} on ${on_string}: Alignment"/>
	</outputs>
<help>
**What it does**

This tool uses the MVIEW package to convert an aligned sequences file in phytab format (ie, phytab_PRANK or phytab_MUSCLE output) to HTML for visualizing each gene's alignment directly in Galaxy.  

------

**Input**

ALIGNED phytab example input (fields are tab-delimited)::

  Species_1   GeneA   UniqueID   AAAATGCCTA-GTC
  Species_2   GeneA   UniqueID   AAATTGCCTA-GTG
  Species_3   GeneA   UniqueID   AAAATGGCTAGGAC
  Species_1   GeneB   UniqueID   TACGTAG-CTTGATCCTATAA
  Species_2   GeneB   UniqueID   TACGTAGTCTAGATCCTATAA
  Species_3   GeneB   UniqueID   TACGTAGTCTTGATGGTATAA

------

**Output**

links to html files for viewing multiple sequence alignments

------

**Additional Information**

For large datasets, this tool can be slow, as this version runs serially. For a 
parallel version that sends different genes to different processors, contact 
ucsb_phylogenetics@lifesci.ucsb.edu

Please direct questions or comments to ucsb_phylogenetics@lifesci.ucsb.edu or, if you can, enter them on the osiris_phylogenetics site at
bitbucket.org

------

**Citations**   

This tool is part of the Osiris Phylogenetics Tool Package for Galaxy. If you make extensive use of this tool in a publication, please consider citing the following.

Current Osiris Citation is here

http://osiris-phylogenetics.blogspot.com/2012/10/citation.html

Additional Citations for this tool

Citation for MView: 
Brown, N.P., Leroy C., Sander C. (1998). MView: A Web compatible database search or multiple alignment viewer. Bioinformatics. 14(4):380-381.

</help>
</tool>