Mercurial > repos > vimalkumarvelayudhan > riboplot
diff tests/test_plot.py @ 0:ca58e9466cbf
First commit
| author | Vimalkumar Velayudhan <vimal@biotechcoder.com> |
|---|---|
| date | Mon, 29 Jun 2015 16:38:36 +0100 |
| parents | |
| children |
line wrap: on
line diff
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/tests/test_plot.py Mon Jun 29 16:38:36 2015 +0100 @@ -0,0 +1,52 @@ +import os +import logging +import unittest + +from riboplot import core, config, plot + +# use testing configuration +CONFIG = plot.CONFIG = config.TestingConfig() +logging.disable(logging.CRITICAL) + +RIBO_FILE = os.path.join(CONFIG.DATA_DIR, '5hRPFsorted.bam') +RNA_FILE = os.path.join(CONFIG.DATA_DIR, '5hmRNAsorted.bam') +TRANSCRIPT_NAME = 'gi|148357119|ref|NM_001098396.1|' +TRANSCRIPTOME_FASTA = os.path.join(CONFIG.DATA_DIR, 'zebrafish.fna') +TRANSCRIPTOME_FASTA_MINUS1 = os.path.join(CONFIG.DATA_DIR, 'zebrafish_minus1.fna') + +class RNACountsTestCase(unittest.TestCase): + + def test_get_rna_counts(self): + """Test get RNA counts for transcript from RNA-Seq BAM file""" + counts = plot.get_rna_counts(rna_file=RNA_FILE, transcript_name=TRANSCRIPT_NAME) + self.assertIsInstance(counts, dict) + self.assertTrue(len(counts) > 0) + + def test_missing_rna_file(self): + """Exit with error if RNA BAM file does not exist. """ + self.assertRaises(OSError, plot.get_rna_counts, rna_file='{}.absent'.format(RNA_FILE), + transcript_name=TRANSCRIPT_NAME) + + def test_missing_bedtools(self): + """Exit with error if bedtools is missing.""" + # reset env temporarily + paths = os.environ['PATH'] + os.environ['PATH'] = '' + self.assertRaises(OSError, plot.get_rna_counts, rna_file=RNA_FILE, + transcript_name=TRANSCRIPT_NAME) + os.environ['PATH'] = paths + + +class PlotTestCase(unittest.TestCase): + + def test_get_codon_positions(self): + """Test get codon positions. """ + # input is the sequence obtained from get_transcript so no new lines. + fasta = ('AACCGGAGCACCCAGAGAAAACCCACGCAAACGCAGGGAGAATTTGCAAACTCCACACA' + 'GAAATGCCAGCTGATCCAGCCGAGCCTCGAGTCAGCATCCTTGCTTGTTGGATGCCTGA' + 'TTGCAGTTCAACTCCAAACTCAGTTGGACCAGCTGATCAGTG') + codon_positions = plot.get_start_stops(fasta) + expected = {1: {'starts': [], 'stops': []}, + 2: {'starts': [], 'stops': [71, 116, 152]}, + 3: {'starts': [63, 111], 'stops': []}} + self.assertEqual(codon_positions, expected) \ No newline at end of file
