Mercurial > repos > vimalkumarvelayudhan > riboplot
view tests/test_riboplot.py @ 3:8e1efafa6277
Updated version
* Bugfix: blue lines in some plots (bar colors were not set correctly)
* Cookiecutter template
* Additional unit tests
* Add plot legend
| author | Vimalkumar Velayudhan <vimal@biotechcoder.com> |
|---|---|
| date | Wed, 12 Aug 2015 09:27:45 +0100 |
| parents | |
| children | 2ffa8172dce1 |
line wrap: on
line source
import os import shutil import logging import unittest import tempfile from riboplot import ribocore, riboplot # use testing configuration CONFIG = riboplot.CONFIG = riboplot.config.TestingConfig() logging.disable(logging.CRITICAL) RIBO_FILE = os.path.join(CONFIG.DATA_DIR, '5hRPFsorted.bam') RNA_FILE = os.path.join(CONFIG.DATA_DIR, '5hmRNAsorted.bam') TRANSCRIPT_NAME = 'gi|148357119|ref|NM_001098396.1|' TRANSCRIPTOME_FASTA = os.path.join(CONFIG.DATA_DIR, 'zebrafish.fna') TRANSCRIPTOME_FASTA_MINUS1 = os.path.join(CONFIG.DATA_DIR, 'zebrafish_minus1.fna') class CheckArgumentsTestCase(unittest.TestCase): """Check if all arguments sent on the command line are valid.""" parser = riboplot.create_parser() def test_bedtools_missing(self): """If bedtools is not in PATH, raise an error.""" args = self.parser.parse_args( ['-b', RIBO_FILE, '-f', TRANSCRIPTOME_FASTA, '-t', TRANSCRIPT_NAME, '-n', RNA_FILE]) save_path = os.environ['PATH'] os.environ['PATH'] = '' self.assertRaises(OSError, ribocore.check_optional_arguments, args.ribo_file, args.rna_file) os.environ['PATH'] = save_path def test_is_bam_valid(self): """Test if BAM file is valid.""" valid = ribocore.is_bam_valid(RIBO_FILE) self.assertTrue(valid) # test with a FASTA file (which is not BAM) self.assertRaises(ValueError, ribocore.is_bam_valid, TRANSCRIPTOME_FASTA) def test_bam_has_index(self): """Check if BAM file has an index.""" # RPF file has an index has_index = ribocore.bam_has_index(RIBO_FILE) self.assertTrue(has_index) # RNA file doesn't have an index has_index = ribocore.bam_has_index(RNA_FILE) self.assertFalse(has_index) def test_create_bam_index(self): """Index a BAM file.""" ribocore.create_bam_index(RNA_FILE) # check if index exists has_index = ribocore.bam_has_index(RNA_FILE) self.assertTrue(has_index) # remove index os.remove('{}.bai'.format(RNA_FILE)) def test_valid_read_length(self): """Read length should be a valid integer.""" args = self.parser.parse_args(['-b', RIBO_FILE, '-f', TRANSCRIPTOME_FASTA, '-t', TRANSCRIPT_NAME, '-l', '28']) ribocore.check_optional_arguments(ribo_file=args.ribo_file, read_length=args.read_length) def test_invalid_read_length(self): """An error is raised if an invalid read length is used.""" args = self.parser.parse_args(['-b', RIBO_FILE, '-f', TRANSCRIPTOME_FASTA, '-t', TRANSCRIPT_NAME, '-l', '-1']) # invalid read length -1 self.assertRaises(ribocore.ArgumentError, ribocore.check_optional_arguments, args.ribo_file, None, args.read_length) args = self.parser.parse_args(['-b', RIBO_FILE, '-f', TRANSCRIPTOME_FASTA, '-t', TRANSCRIPT_NAME, '-l', '100']) # invalid read length 100 self.assertRaises(ribocore.ArgumentError, ribocore.check_optional_arguments, args.ribo_file, None, args.read_length) def test_valid_read_offset(self): """Read offset should be positive.""" args = self.parser.parse_args(['-b', RIBO_FILE, '-f', TRANSCRIPTOME_FASTA, '-t', TRANSCRIPT_NAME, '-s', '-1']) # invalid read offset -1 self.assertRaises(ribocore.ArgumentError, ribocore.check_optional_arguments, args.ribo_file, None, None, args.read_offset) def test_is_fasta_valid(self): """A valid FASTA file can be opened with pysam.FastaFile.""" self.assertTrue(ribocore.is_fasta_valid(TRANSCRIPTOME_FASTA)) def test_missing_transcript_in_fasta(self): """If a transcript is missing in FASTA, an error is raised.""" args = self.parser.parse_args(['-b', RIBO_FILE, '-f', TRANSCRIPTOME_FASTA, '-t', TRANSCRIPT_NAME]) # invalid read offset -1 self.assertRaises(ribocore.ArgumentError, ribocore.check_required_arguments, args.ribo_file, args.transcriptome_fasta, 'hello') def test_missing_transcript_in_bam(self): """If a transcript is missing in BAM, an error is raised.""" # testing with an unrelated BAM file args = self.parser.parse_args(['-b', '/home/vimal/tmp/empty_tp/RiboSeq.bam', '-f', TRANSCRIPTOME_FASTA, '-t', TRANSCRIPT_NAME]) self.assertRaises(ribocore.ArgumentError, ribocore.check_required_arguments, args.ribo_file, args.transcriptome_fasta, args.transcript_name) class RNACountsTestCase(unittest.TestCase): def test_get_rna_counts(self): """Test get RNA counts for transcript from RNA-Seq BAM file. Assumes bedtools is installed.""" counts = riboplot.get_rna_counts(RNA_FILE, TRANSCRIPT_NAME) self.assertIsInstance(counts, dict) self.assertTrue(len(counts) > 0) class RiboPlotTestCase(unittest.TestCase): def test_get_codon_positions(self): """Get codon positions in all frames given a sequence.""" # the positions on this sequence were calculated manually. fasta = ('AACCGGAGCACCCAGAGAAAACCCACGCAAACGCAGGGAGAATTTGCAAACTCCACACA' 'GAAATGCCAGCTGATCCAGCCGAGCCTCGAGTCAGCATCCTTGCTTGTTGGATGCCTGA' 'TTGCAGTTCAACTCCAAACTCAGTTGGACCAGCTGATCAGTG') codon_positions = riboplot.get_start_stops(fasta) expected = {1: {'starts': [], 'stops': []}, 2: {'starts': [], 'stops': [71, 116, 152]}, 3: {'starts': [63, 111], 'stops': []}} self.assertEqual(codon_positions, expected) def test_valid_riboplot_run(self): """A good riboplot run""" output_dir = tempfile.mkdtemp() print 'Output path is {}'.format(output_dir) parser = riboplot.create_parser() args = parser.parse_args(['-b', RIBO_FILE, '-f', TRANSCRIPTOME_FASTA, '-t', TRANSCRIPT_NAME, '-o', output_dir]) riboplot.main(args) for fname in ('riboplot.png', 'riboplot.svg', 'RiboCounts.csv'): self.assertTrue(os.path.exists(os.path.join(output_dir, fname))) shutil.rmtree(output_dir) def test_transcript_with_no_counts(self): """If the transcript has no ribocounts, no plot should be produced.""" transcript = 'gi|62955616|ref|NM_001017822.1|' # has no reads output_dir = tempfile.mkdtemp() parser = riboplot.create_parser() args = parser.parse_args(['-b', RIBO_FILE, '-f', TRANSCRIPTOME_FASTA, '-t', transcript, '-o', output_dir]) self.assertRaises(ribocore.RiboPlotError, riboplot.main, args) for fname in ('riboplot.png', 'riboplot.svg', 'RiboCounts.csv'): self.assertFalse(os.path.exists(os.path.join(output_dir, fname))) shutil.rmtree(output_dir) @unittest.skip('todo') def test_get_ribo_counts(self): """Get RiboSeq read counts""" pass @unittest.skip('todo') def test_write_ribo_counts(self): """Write RiboSeq read counts as CSV.""" pass @unittest.skip('todo') def test_plot_read_counts(self): """Generate riboplots""" pass
