Mercurial > repos > vimalkumarvelayudhan > riboplot
view tests/test_plot.py @ 0:ca58e9466cbf
First commit
| author | Vimalkumar Velayudhan <vimal@biotechcoder.com> |
|---|---|
| date | Mon, 29 Jun 2015 16:38:36 +0100 |
| parents | |
| children |
line wrap: on
line source
import os import logging import unittest from riboplot import core, config, plot # use testing configuration CONFIG = plot.CONFIG = config.TestingConfig() logging.disable(logging.CRITICAL) RIBO_FILE = os.path.join(CONFIG.DATA_DIR, '5hRPFsorted.bam') RNA_FILE = os.path.join(CONFIG.DATA_DIR, '5hmRNAsorted.bam') TRANSCRIPT_NAME = 'gi|148357119|ref|NM_001098396.1|' TRANSCRIPTOME_FASTA = os.path.join(CONFIG.DATA_DIR, 'zebrafish.fna') TRANSCRIPTOME_FASTA_MINUS1 = os.path.join(CONFIG.DATA_DIR, 'zebrafish_minus1.fna') class RNACountsTestCase(unittest.TestCase): def test_get_rna_counts(self): """Test get RNA counts for transcript from RNA-Seq BAM file""" counts = plot.get_rna_counts(rna_file=RNA_FILE, transcript_name=TRANSCRIPT_NAME) self.assertIsInstance(counts, dict) self.assertTrue(len(counts) > 0) def test_missing_rna_file(self): """Exit with error if RNA BAM file does not exist. """ self.assertRaises(OSError, plot.get_rna_counts, rna_file='{}.absent'.format(RNA_FILE), transcript_name=TRANSCRIPT_NAME) def test_missing_bedtools(self): """Exit with error if bedtools is missing.""" # reset env temporarily paths = os.environ['PATH'] os.environ['PATH'] = '' self.assertRaises(OSError, plot.get_rna_counts, rna_file=RNA_FILE, transcript_name=TRANSCRIPT_NAME) os.environ['PATH'] = paths class PlotTestCase(unittest.TestCase): def test_get_codon_positions(self): """Test get codon positions. """ # input is the sequence obtained from get_transcript so no new lines. fasta = ('AACCGGAGCACCCAGAGAAAACCCACGCAAACGCAGGGAGAATTTGCAAACTCCACACA' 'GAAATGCCAGCTGATCCAGCCGAGCCTCGAGTCAGCATCCTTGCTTGTTGGATGCCTGA' 'TTGCAGTTCAACTCCAAACTCAGTTGGACCAGCTGATCAGTG') codon_positions = plot.get_start_stops(fasta) expected = {1: {'starts': [], 'stops': []}, 2: {'starts': [], 'stops': [71, 116, 152]}, 3: {'starts': [63, 111], 'stops': []}} self.assertEqual(codon_positions, expected)
